Entry information : HaPrx90 (HanXRQChr11g0322211)
Entry ID 13644
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx90 (HanXRQChr11g0322211)
Name (synonym) HaPrx90 (HanXRQChr11g0322211)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx90
start..stop
S start..stop
HaPrx82 533 0 9..320 49..360
HaPrx87 528 0 8..320 10..322
HaPrx83 526 0 8..320 10..322
HaPrx86 525 0 9..320 11..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7566130..7566345 216 N° 2 7565195..7565383 189 N° 3 7564379..7564541 163 N° 4 7563093..7563487 395
complement(join(7563093..7563487,7564379..7564541,7565195..7565383,7566130..7566 345))


exon

Literature and cross-references HaPrx90 (HanXRQChr11g0322211)
DNA ref. HanXRQ genome:   HanXRQChr11 (7566345..7563093)
Protein sequence: HaPrx90 (HanXRQChr11g0322211)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (294)
PWM (Da):   %s   34758.39 (31959.9)  
PI (pH):   %s   8.65 (8.58) Peptide Signal:   %s   cut: 27 range:27-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASCNNSSLIIGFLVLALVHFNRINALSSNYYDQTCPMVESTVTSSVKKAMLNDRTVPAALLRMHFHDCFIRGCDGSVLLNSTANNQAEKDGPPNISLHAFYVIDHAKKALEAVCPGTVSCADIVALAARDAVHLSGGPTWVVPKGRKDGRISRASETRQLAAPTSNISQLQQSFSQRGLSMEDLVALSGGHTLGFAHCSSFQNRIHNFATTQDVDPSMHKSFAASLRSVCPMHNKVRSAGANLDSTPTTFDNRYYKLLLEGKSIFTSDQALLTNPTTNTLVKKFANSREEFEKAFVESMIKMSSITGGQEVRLNCRFVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCATGCAATAACTCTTCACTTATTATTGGGTTTCTTGTGCTTGCATTAGTCCATTTTAACAGGATTAACGCACTTAGTTCTAACTACTATGATCAAACATGTCCCATGGTTGAA
TCAACGGTCACAAGCTCCGTGAAGAAAGCTATGTTGAATGATCGAACAGTTCCTGCTGCACTCCTGAGAATGCACTTCCATGATTGCTTCATTAGG
GTAAATCATATGCATTTCAACTCT
TGCTGATTTCCTTATAAAAAGGGAAAATTACAAAAATGTCAGTTGACCAACCATGTTTTCGAATTTGTCACGCTCCTGCGTCCGTGGACGGACCTCTGAGCATAGGATGAGTCGGGGTAT
CATGTTGAAAAGTCCTTGTATCACGCTCCTTCGGAAGAGTCCACCGACGCTTCGGAAGAGTCACCGACGCTTCGGAATAGTTCACTGACGCTTCGGATGGACATGGACTCTTCAACATGA
TACGCCGACTCATCCCATGCTCAGAGGTCCGTCCACGGACGCAGGAACATGACGAATTTGAAAACACGGTTGGTCAACTGACATTTTCGTAAATTTCCGTTATAAAAAACTCATTTGAAT
TCTTGGCATTATTGGTAAAAATGATTTGTTATTTTTGTTTGCTAGCTGTTTCAAATCTTTTATTTACAACGTTTTCAGTTATCCAATTCTATAGTAGTAGTTTTTTGTTTTTTGGTTCAA
ATCTTGATCATTTGATCATGGGCAGTGGCTACTGCCATGGTTTTGGGGGCGGCCAACCTCGTAAAAAAATAATTTAGTGTATTATTTAAGCAAAATCCCGATCGCACCCCTTAAAAATAT
GGTTAAACCCTACGATCGCACCCCTGAAAATAAATTATGGGTCTGCCACTGATCATGGGTGTTTTTTCATGAAATCTTATTTGGTTTTATTTATTTATCTTTTTTTTGGTTTTGTATTGA
AGGGATGTGATGGTTCTGTGTTGTTGAACTCAACCGCTAACAACCAAGCTGAGAAAGACGGGCCTCCGAACATATCTCTTCATGCATTTTACGTCATCGATCACGCAAAGAAAGCATTAG
AGGCTGTGTGCCCTGGTACTGTTTCATGTGCTGACATTGTAGCTTTAGCAGCAAGAGATGCAGTTCATCTT
GTAAGCATGTGTTCTTCCTTCATACATATATGATTCAATCACAACATCA
AATACTTGAATCTTTCTTGAGACATTCAGTTTCCTCATACTAAAAGATTTAGATTGTTTAGGAATGAGATTGGTACTTTTAGGTGTTTTCTAGAACTTCTACACAATTCACTACCACATG
TAAGCGAACTCGACAAATTTGCTTCGGTGGCAAGCAAACTCTGTTGAATTGAATTTGGTGAAAAACTTTATAAAGTTCGCTTGCCACCCAAGCGAAACTTGTTGCTTTTGCTTACAACTG
TCTATAAGTTTAAAAAGTACAAAAGACTTAGTTTTGTTATTAAAAAAGGAGTAGCGGTGCAACTTGTTGCTCGTTCACCTTCTATTTCGATGTAATTTCCATTTGGAATTCGTTTAACGA
GTCGAAACAAGTTTATTATTAAAAACACCTAAAAGTACAATATTTGTTACTAAACAACCCCCTTCTACACAAGTTTCCTGAAAGATAGTATCCATGTTCTATGATGATGCTTGCACTAGC
TAGAAACAATTAACCGATAATCATAATGAAACCAAATCGAAATATCGAATAAACTCTAAGCCCTAAGCCCTAATCACGTACATGACTTGGATAAAATGTAAACCCTAAATATTGTATATT
ACAGTCCGGAGGTCCCACTTGGGTTGTGCCAAAAGGGCGAAAAGATGGTCGGATTTCAAGAGCATCTGAAACTAGACAATTGGCAGCTCCCACCTCCAACATATCTCAACTCCAACAAAG
TTTTTCGCAACGAGGTCTTTCCATGGAAGACTTAGTTGCACTTTCAG
GTATATTCCAATTGTACTATACTAGAATAAATGTCTCTTAATTCTTCACACTCTAGTCTAACAAGTTCTTAAA
GCTATATTCATTTGGCTGTCAATATAAGGGTCATCTTAGTGGTACACCTCAAAATCTTATTGGTACACACTATAAGTAACACCCAAATATATATAATTACAAGATGTTTATATATTTGTG
GAGTGTCAATGATGTCTGGAAACCTTTAGTGGTGTCTGAACATCTGCAGCCTAAGATTATTATAAGTATTTTATATGTGTGGACGTTTTTTTATATAAATATTAAGTGTTAAAAATGTGA
TAATTTATATTTTTCATAGCACTTATGTATTTATTTACATTTTGTATCTGTTTATTAGACCGTGTGTAGTGGGGCGTGATTTATAAAATTTTTTCAAAAAAAACGCCCTATAACGCCCCG
GTAACCACTACACCCGGCGTTACCGGGCGTTATTTTTCCAAAAAATTGAATCAGGCGTGATTATTAAAACGCCATTTTGCATTGTTGGAGCTTTGACTTATGTTTGACCCACCAATGAGA
AATCACTTTGGTTTTTTTTTTTTTTTTTTTTTTTTTTGTTTAAGGATTGAAAGGGGCATTATTTGGGCATTATTCCCACTACGCCACTTTTGCTATAATGCCCCCTTGCTGACTAGGACG
CCACGTGTCGGATAATGCCCCATGGTGGGGGCATTATAAGGTGTTACCACTACACATGGTCTTATAGGTGTGCACAACTTTATTGAGAGGATTTTACTTATTTTTAAAAGTGTGTAAAAA
GTGTGCATACAAATTAATGATATATTTAATTATAGCCCTTGTTTAATTTTCTTGATCGGAATCAAGAAACTAAGTTTTTTATGTACAAACTTATGTAGGAGGACATACTCTCGGGTTTGC
TCATTGCTCCTCATTCCAAAACAGGATCCACAACTTTGCAACCACACAAGACGTTGATCCATCAATGCACAAATCTTTTGCAGCCAGTTTACGCAGTGTGTGCCCAATGCATAATAAGGT
GAGAAGTGCTGGTGCAAACTTGGATTCAACCCCTACCACCTTTGACAATAGATATTATAAGTTACTTCTTGAAGGGAAGAGTATCTTCACTTCTGATCAAGCCTTACTTACCAACCCAAC
AACCAACACATTGGTTAAGAAGTTTGCGAATTCACGTGAAGAATTTGAGAAAGCATTTGTAGAATCCATGATCAAGATGAGCAGCATAACCGGTGGCCAGGAGGTTAGGCTAAATTGTAG
GTTCGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCATGCAATAACTCTTCACTTATTATTGGGTTTCTTGTGCTTGCATTAGTCCATTTTAACAGGATTAACGCACTTAGTTCTAACTACTATGATCAAACATGTCCCATGGTTGAA
TCAACGGTCACAAGCTCCGTGAAGAAAGCTATGTTGAATGATCGAACAGTTCCTGCTGCACTCCTGAGAATGCACTTCCATGATTGCTTCATTAGG
GGATGTGATGGTTCTGTGTTGTTG
AACTCAACCGCTAACAACCAAGCTGAGAAAGACGGGCCTCCGAACATATCTCTTCATGCATTTTACGTCATCGATCACGCAAAGAAAGCATTAGAGGCTGTGTGCCCTGGTACTGTTTCA
TGTGCTGACATTGTAGCTTTAGCAGCAAGAGATGCAGTTCATCTT
TCCGGAGGTCCCACTTGGGTTGTGCCAAAAGGGCGAAAAGATGGTCGGATTTCAAGAGCATCTGAAACTAGACAA
TTGGCAGCTCCCACCTCCAACATATCTCAACTCCAACAAAGTTTTTCGCAACGAGGTCTTTCCATGGAAGACTTAGTTGCACTTTCAG
GAGGACATACTCTCGGGTTTGCTCATTGCTCC
TCATTCCAAAACAGGATCCACAACTTTGCAACCACACAAGACGTTGATCCATCAATGCACAAATCTTTTGCAGCCAGTTTACGCAGTGTGTGCCCAATGCATAATAAGGTGAGAAGTGCT
GGTGCAAACTTGGATTCAACCCCTACCACCTTTGACAATAGATATTATAAGTTACTTCTTGAAGGGAAGAGTATCTTCACTTCTGATCAAGCCTTACTTACCAACCCAACAACCAACACA
TTGGTTAAGAAGTTTGCGAATTCACGTGAAGAATTTGAGAAAGCATTTGTAGAATCCATGATCAAGATGAGCAGCATAACCGGTGGCCAGGAGGTTAGGCTAAATTGTAGGTTCGTGAAT
TGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGCTTAGA TTTATAGCTC GATTTCAAAT CCGAGCCGAG CCAGCTCAAT TTATAATCGA GCCGAGCCCG AGCTTGCCCT ATCTCGGCTC GTGAACAACC CGACTTTTCT CAAGTGATCG  TGCTAGGGGT GATATATTGC TGGAATAGTA GCACTAGACA AGATAATTTG TGAGGATCTA AAGAGTTATT GAGTCCGTTA ATTAAGCTCT AAAACAATAG CATATTATGA AGTATAGAAA  GAGAATGAAG GGGTCTTGTT AGGTTAATAA TTAAGTTAAC CTTGATACAT ACAACTCTAT ACATCATTAT GCCTCAACAA CTTATATAAA AATAAACCAA ATGAGTTTCG GCTCACCAAA  TATGCAAAAA ACAACTATGC AAAACCTACT TTAAAAATCA ATTTAATACA TAAGAACTCA CCTTTTTCTT CCATACAAAT ACTTGGACCT TCTCTCAATC TCCATCACAA CAAGAAACTG  CTACTTGTGT TTAACTGTTT ACATTTTAAA AAATGGCATC ATGCAATAAC TCTTCACTTA TTATTGGGTT TCTTGTGCTT GCATTAGTCC ATTTTAACAG GATTAACGCA CTTAGTTCTA  ACTACTATGA TCAAACATGT CCCATGGTTG AATCAACGGT CACAAGCTCC GTGAAGAAAG CTATGTTGAA TGATCGAACA GTTCCTGCTG CACTCCTGAG AATGCACTTC CATGATTGCT  TCATTAGGGG ATGTGATGGT TCTGTGTTGT TGAACTCAAC CGCTAACAAC CAAGCTGAGA AAGACGGGCC TCCGAACATA TCTCTTCATG CATTTTACGT CATCGATCAC GCAAAGAAAG  CATTAGAGGC TGTGTGCCCT GGTACTGTTT CATGTGCTGA CATTGTAGCT TTAGCAGCAA GAGATGCAGT TCATCTTTCC GGAGGTCCCA CTTGGGTTGT GCCAAAAGGG CGAAAAGATG  GTCGGATTTC AAGAGCATCT GAAACTAGAC AATTGGCAGC TCCCACCTCC AACATATCTC AACTCCAACA AAGTTTTTCG CAACGAGGTC TTTCCATGGA AGACTTAGTT GCACTTTCAG  GAGGACATAC TCTCGGGTTT GCTCATTGCT CCTCATTCCA AAACAGGATC CACAACTTTG CAACCACACA AGACGTTGAT CCATCAATGC ACAAATCTTT TGCAGCCAGT TTACGCAGTG  TGTGCCCAAT GCATAATAAG GTGAGAAGTG CTGGTGCAAA CTTGGATTCA ACCCCTACCA CCTTTGACAA TAGATATTAT AAGTTACTTC TTGAAGGGAA GAGTATCTTC ACTTCTGATC  AAGCCTTACT TACCAACCCA ACAACCAACA CATTGGTTAA GAAGTTTGCG AATTCACGTG AAGAATTTGA GAAAGCATTT GTAGAATCCA TGATCAAGAT GAGCAGCATA ACCGGTGGCC  AGGAGGTTAG GCTAAATTGT AGGTTCGTGA ATTGATTCCG TGATCTTTAT CATTCTTATT TCGTTTGTGT TCTTTAGTGT TTTAGTTTCA TTTTTCTAAG GTTTCGAAAC TGAGATCTGT 
TGTAAATGTG TGAATGTGTG TTGCACTTTA TGTATTGTTT TTGGATTGTG TAAAGCATCA TTGAG 

Retrieve as FASTA