Entry information : HaPrx92 (HanXRQChr11g0334751)
Entry ID 13646
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx92 (HanXRQChr11g0334751)
Name (synonym) HaPrx92 (HanXRQChr11g0334751)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx92
start..stop
S start..stop
HaPrx46 572 0 2..328 1..327
HaPrx[P]47 566 0 22..328 21..329
LsaPrx12 521 0 2..328 1..327
LsaPrx13 493 2e-177 2..328 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 68276365..68276769 405 N° 2 68276132..68276294 163 N° 3 68274852..68275270 419  
complement(join(68274852..68275270,68276132..68276294,68276365..68276769))


exon

Literature and cross-references HaPrx92 (HanXRQChr11g0334751)
DNA ref. HanXRQ genome:   HanXRQChr11 (68276769..68274852)
Protein sequence: HaPrx92 (HanXRQChr11g0334751)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   34960.75 (31986.1) Transmb domain:   %s   i13-35o
PI (pH):   %s   7.97 (7.66) Peptide Signal:   %s   cut: 28 range:28-328
Sequence 369
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMQTFPNNKGLIIIFILLATFITLAIGQGTRVGFYQTSCPRAETIVRSVVQSAVNSNAAVAPGLLRMFFHDCFVNGCDASILIDGSSSEKTAAPNSLLRGFEVIDAAKTQLETACPGVVSCADILALAARDSVVQTGGTGWSVPLGRRDGLVSRAADTANLPAFNDPVSVQIRKFTDKGLNTQDLVALSGAHTLGTAACTLFSYRLYNFNSTNGPDPSIDPAFLPTLQNLCPNGGDGTVRVDLDNGSGGRFDNSYYANLRNRRGVLESDAALWNDPTTQRFVQRFLGVRGLLGLTFNVEFGRSMVRMGNIEVKSGTQGEIRRVCTAIN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCAGACTTTTCCCAACAACAAAGGGCTAATCATTATTTTCATCTTGTTAGCCACCTTCATCACATTGGCAATAGGCCAAGGCACCCGAGTCGGGTTCTACCAGACCTCATGCCCA
CGGGCAGAAACCATCGTACGCTCTGTGGTCCAGTCTGCAGTCAACTCCAACGCCGCAGTTGCACCTGGTTTACTAAGAATGTTCTTTCACGACTGCTTTGTTAACGGCTGTGATGCCTCT
ATCCTAATTGACGGTTCTTCTTCCGAGAAAACCGCTGCCCCAAATTCGTTACTTAGAGGCTTTGAAGTCATTGATGCTGCAAAGACACAGCTGGAAACCGCGTGTCCAGGTGTGGTCTCT
TGTGCGGACATTCTTGCCCTTGCTGCCCGTGATTCTGTCGTGCAG
GTATATACATTTTTACAAGGTATCTGTTTGGCTTAAAAAATGTACTGATTCAACTTTTTGGATGTTGTAGACTGG
AGGAACAGGATGGTCAGTGCCATTAGGTCGCCGAGATGGATTAGTTTCACGGGCAGCTGATACCGCGAACCTTCCCGCTTTTAATGACCCTGTTAGTGTCCAAATCAGGAAGTTTACGGA
CAAAGGTCTTAACACCCAAGATCTTGTTGCACTTAGTG
GTAAGTTAAACAAAGAATAGTGTCATAATGAATTCCCATATCATACACTACAAGAATTATATACCAATAGCGGAGACAGGCA
ATAGCGGCGACACAAGGCGTCGCTAAAGGTACCCGTTTCTTGTAGTGATAACCACTAATACCCATGGTGTAAGCACTATAAAAAAGTAAACTCTTTCTTATCGATGGTTACTTTTTATAT
ATAAATGCTTAATTACGTTATGCATGGGAAAAACAATAAACTAATTTTGTTAATATATTTCCAAAACAAAAATTTAATATATAAATAATATATATGTTGTTATATATGTATATAAATATT
AATTTGAATATTAGGAGATGAACAAATATAACATATTTATCATTGTCTTCGTTCGTTTAATAAATAAACGAACACGAAAAAAAATTCTGTTTGTTTAGTTAAATTAAGGAAAATAAATAG
AGGTCGCGTTCGTTTATTTATGTTGGTGAACGTTCGATAATGAGTTTCTTTGTGTTCGATAGTTTATTAGTATTTTTAATTTTTATATTTTATTAATTGCTTCAAAACTCCAAAAAATTA
AAATATTCATATTTTGTTCATTATCGATTATATGTCTTCGTTTGTTTCCATTTGTGTAAATGAACATTAGTTTCTTTTCATTTGTGTTCATCAAATTTGTTTGCAATATTCTTTTCCTAA
AATTAACAAACAAATACAAACGAACATGAGCTAGTTCATTTCCTTATAACAAGCGAACATGAATATAAAATCTCGTTCGATAATTGTTCATTAACAGTTCGTAAACACATATATTTCTTA
ACAAACGAACACGAACAATTACAACCCTAATAGCGTTTCATGGTTTGATTTATTCGTAGGAGCACACACACTCGGGACAGCAGCTTGCACATTATTTAGCTACCGGCTATACAACTTTAA
CAGCACGAATGGACCTGACCCGAGTATCGATCCAGCATTCCTTCCAACCCTCCAAAACCTGTGCCCCAACGGTGGTGATGGCACAGTACGTGTGGATTTAGACAACGGAAGCGGAGGCAG
ATTCGACAATTCATACTACGCAAACTTGAGGAACAGGCGAGGAGTACTTGAATCCGATGCGGCCTTATGGAACGACCCGACGACACAAAGGTTTGTGCAACGGTTTCTTGGAGTTAGGGG
ACTGCTTGGATTAACATTTAACGTTGAGTTTGGGAGATCAATGGTGAGGATGGGTAATATTGAGGTAAAAAGTGGGACTCAAGGTGAAATTCGTAGGGTTTGTACGGCGATTAATTA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCAGACTTTTCCCAACAACAAAGGGCTAATCATTATTTTCATCTTGTTAGCCACCTTCATCACATTGGCAATAGGCCAAGGCACCCGAGTCGGGTTCTACCAGACCTCATGCCCA
CGGGCAGAAACCATCGTACGCTCTGTGGTCCAGTCTGCAGTCAACTCCAACGCCGCAGTTGCACCTGGTTTACTAAGAATGTTCTTTCACGACTGCTTTGTTAACGGCTGTGATGCCTCT
ATCCTAATTGACGGTTCTTCTTCCGAGAAAACCGCTGCCCCAAATTCGTTACTTAGAGGCTTTGAAGTCATTGATGCTGCAAAGACACAGCTGGAAACCGCGTGTCCAGGTGTGGTCTCT
TGTGCGGACATTCTTGCCCTTGCTGCCCGTGATTCTGTCGTGCAG
ACTGGAGGAACAGGATGGTCAGTGCCATTAGGTCGCCGAGATGGATTAGTTTCACGGGCAGCTGATACCGCGAAC
CTTCCCGCTTTTAATGACCCTGTTAGTGTCCAAATCAGGAAGTTTACGGACAAAGGTCTTAACACCCAAGATCTTGTTGCACTTAGTG
GAGCACACACACTCGGGACAGCAGCTTGCACA
TTATTTAGCTACCGGCTATACAACTTTAACAGCACGAATGGACCTGACCCGAGTATCGATCCAGCATTCCTTCCAACCCTCCAAAACCTGTGCCCCAACGGTGGTGATGGCACAGTACGT
GTGGATTTAGACAACGGAAGCGGAGGCAGATTCGACAATTCATACTACGCAAACTTGAGGAACAGGCGAGGAGTACTTGAATCCGATGCGGCCTTATGGAACGACCCGACGACACAAAGG
TTTGTGCAACGGTTTCTTGGAGTTAGGGGACTGCTTGGATTAACATTTAACGTTGAGTTTGGGAGATCAATGGTGAGGATGGGTAATATTGAGGTAAAAAGTGGGACTCAAGGTGAAATT
CGTAGGGTTTGTACGGCGATTAATTA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CATTAGAAAC CATATAATCT CTTAAAACCA GAAACAACTT ATTCTAATGA TGCAGACTTT TCCCAACAAC AAAGGGCTAA TCATTATTTT CATCTTGTTA GCCACCTTCA TCACATTGGC  AATAGGCCAA GGCACCCGAG TCGGGTTCTA CCAGACCTCA TGCCCACGGG CAGAAACCAT CGTACGCTCT GTGGTCCAGT CTGCAGTCAA CTCCAACGCC GCAGTTGCAC CTGGTTTACT  AAGAATGTTC TTTCACGACT GCTTTGTTAA CGGCTGTGAT GCCTCTATCC TAATTGACGG TTCTTCTTCC GAGAAAACCG CTGCCCCAAA TTCGTTACTT AGAGGCTTTG AAGTCATTGA  TGCTGCAAAG ACACAGCTGG AAACCGCGTG TCCAGGTGTG GTCTCTTGTG CGGACATTCT TGCCCTTGCT GCCCGTGATT CTGTCGTGCA GACTGGAGGA ACAGGATGGT CAGTGCCATT  AGGTCGCCGA GATGGATTAG TTTCACGGGC AGCTGATACC GCGAACCTTC CCGCTTTTAA TGACCCTGTT AGTGTCCAAA TCAGGAAGTT TACGGACAAA GGTCTTAACA CCCAAGATCT  TGTTGCACTT AGTGGAGCAC ACACACTCGG GACAGCAGCT TGCACATTAT TTAGCTACCG GCTATACAAC TTTAACAGCA CGAATGGACC TGACCCGAGT ATCGATCCAG CATTCCTTCC  AACCCTCCAA AACCTGTGCC CCAACGGTGG TGATGGCACA GTACGTGTGG ATTTAGACAA CGGAAGCGGA GGCAGATTCG ACAATTCATA CTACGCAAAC TTGAGGAACA GGCGAGGAGT  ACTTGAATCC GATGCGGCCT TATGGAACGA CCCGACGACA CAAAGGTTTG TGCAACGGTT TCTTGGAGTT AGGGGACTGC TTGGATTAAC ATTTAACGTT GAGTTTGGGA GATCAATGGT  GAGGATGGGT AATATTGAGG TAAAAAGTGG GACTCAAGGT GAAATTCGTA GGGTTTGTAC GGCGATTAAT TAATCAGTGA CGGTTGGTAA TGGTGCTTTG TATTTATTGA GAGTTGTAAC  TTGTTAATAC TATCATTACC GGTTTAGGAA CAAGTTTTTA TATAATAAAT GAATAATATA GTGTGTTTGT TTCTATTGAT TGTTTTCGTT ACATGCAATG GTTTTACACG ATAGTATTTG 
CCATACTACA ATGATGCCCT TATAATATCT GGTATATTCT AA 

Retrieve as FASTA