Entry information : HaPrx93 (HanXRQChr11g0339521)
Entry ID 13647
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx93 (HanXRQChr11g0339521)
Name (synonym) HaPrx93 (HanXRQChr11g0339521)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx93
start..stop
S start..stop
LsaPrx50 431 3e-153 23..295 16..285
CroPrx46 422 5e-148 29..353 72..400
LePrx106 406 3e-141 30..353 82..415
EglPrx93 403 2e-140 26..353 73..399
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 104350344..104350568 225 N° 2 104351083..104351271 189 N° 3 104351364..104351526 163 N° 4 104352340..104352836 497
join(104350344..104350568,104351083..104351271,104351364..104351526,104352340..1 04352836)


exon

Literature and cross-references HaPrx93 (HanXRQChr11g0339521)
DNA ref. HanXRQ genome:   HanXRQChr11 (104350344..104352836)
Protein sequence: HaPrx93 (HanXRQChr11g0339521)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (329)
PWM (Da):   %s   39302.49 (36232.8) Transmb domain:   %s   i7-26o
PI (pH):   %s   5.23 (5.23) Peptide Signal:   %s   cut: 29 range:29-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTQDAKILHLLLLIGYSLLISFISPSDSSLEYDYYRESCPQAQQVIRSTLRRIYDRNSTVAPAILRLVFHDCFVQGCDASVLLDRTVFMGSEKDTLPNQSLRGFDHIDIIKSELENVCPGVVSCADLLVVAARESVVLAGGPFYPVHTGRKDSDHSFPEISYELPSPLDDLPTTIARFASRGFTVKETVTLLGAHSTGMIHCKFFERRLYKFGGTDQPDPSLDPEFAELLRSVCNSTQTQSQSESSSASPSASPSPSTTSTKSDEERSMKMDYEGRGSGFGILYYRGLLQGRGILFVDQQLTAGEETASWVRQYASDVSMFHKDFAQVMMKLSSTQVLTGLSGEVRTNCREVSSSLW

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACAGGATGCTAAAATCCTTCATCTTCTTCTTCTAATCGGATACTCTCTTCTCATATCTTTCATTTCTCCATCTGATTCATCGCTCGAGTACGACTATTATCGCGAATCATGTCCT
CAAGCGCAACAAGTTATCAGATCGACGTTACGCCGGATCTACGACCGGAATTCGACCGTCGCTCCTGCTATTCTTCGTCTCGTTTTTCACGATTGTTTTGTACAG
GTTTGTTATGCTTCT
TTTGATGTGTTAATTGTTGTCGATTTCATATGTTATGAGTTATTATTTTTATCAACTGTTGATGATCTACTGGTTATTGTGCTTATCTAATTTGTATCGATGTTGTAATTTCGAATCGTG
TTTGATGTGAATAGGATTTTGTTACGTGTAATAGGATATTGATAGAGCGGCTAGATCTTGATGAGATTTTGTATTGTTATTGCAAATTAATACAGTAGTTCTAGGTTTTGATGCCAGTTG
TAGCTTACTTAGATCATATTCTGTGAATAGTAGACACACTACTAGTGGAAACTGGAAAGTGGCAATTCACATGGAAATTGATGTATGTAAAATGTTCTTTTGAGACAGAGGATGTATAAA
TAAATATTCATATAATCATATGTATGTTTGTGTACGCATATACGCGTCACACAAACATATGTAGACACACAGATGTATTGTATGCATTTGTTATGTTTAGACTTCAGTTTTAATTGAATT
ACAGTGAAACATGATGTAGGGATGTGATGCGTCGGTGCTTTTGGATCGTACTGTCTTTATGGGGAGTGAGAAAGACACTCTACCAAATCAGTCTTTGAGGGGATTTGATCACATTGACAT
TATCAAGTCCGAATTGGAAAACGTTTGCCCTGGTGTGGTTTCTTGTGCTGATCTTCTTGTGGTGGCTGCTCGTGAGAGCGTGGTTTTG
GTAATTAGCTTATTCCTCTTACAGTTAGTTAT
ATCTGAGAGGATATAACTATATAGCATCTTGATTACTAACGTTTGATCTTTTGTTTATAGGCTGGTGGACCATTTTATCCTGTACACACCGGTAGGAAAGACAGTGATCACTCTTTCCCT
GAAATTTCATATGAGCTTCCTAGCCCCTTAGATGATCTTCCTACAACCATTGCGAGATTTGCGTCAAGGGGATTTACTGTAAAAGAAACAGTCACTCTTTTAG
GTACGAATTAATCATAT
GTTATACTGTCTTAGTTGTGCTTATTATGTCTTTCAAGTTCCCAATGTTGATTTTAATTCTCTAGTCTTTTTGGTTGGAGAACTACCATCTTCCGTTTTTTATGGTTTTTAATCCCAGTC
AGAAGTACTACTATTCCAGTTTGAAAAACTTAGCTCTATGAATTATTGATGTTGTTCTTCAATGCTTAGTTATTGAAATAACCGAATTAGTGATACCATGTAATCTAACTTGCAGCACAT
GGCAATTAGGTTCAATACATTAACTTAGAACTTACCTCTTAAAATGGCATCTCTGGTAGACACCAGGTTTAAGGTAAAATGTTCAAACAACACAGAACTACAAACATTGTCTCCTTGGTC
AATGTTATCTTTTAGCCTTTATAAATCCATCCTTCAGTTCTTTTCCTGTATTTTATTCTTTCTTGTTGCATTATTGGTGGTCAGATAGGGTGACTGACGGCAGGTAGGACAAAAGGTCAA
AGAGGTTGGTTGGGTAATAGACTGCAAATAGTGCATTAACAGATTTTAGAAACATTATCGTAATAATGGTAATCTGAACTTCGAGTAAAACAGTTTAGGAGGCTGTTTGCATTAAACATA
CACTCCAGCAAACTTTAAATCCCCCATCCCTTTGACCATTCGTTTTTACGTAGATTATTTTGACCCGTTTAAGTATATAAATAAGCCAAGCCAAACCAAACTAAACCATTCAGAACTAAA
TTTGTAGCTATTTCCACTTATTGTCTGCATCATTGTTGCATAACACTAGAGGAATCACAACTTGATTTATTTGCAGGTGCCCATAGTACTGGAATGATTCACTGCAAGTTCTTTGAAAGA
CGGCTTTACAAATTTGGTGGGACTGATCAGCCAGACCCATCGTTGGATCCTGAATTTGCAGAACTCCTACGATCCGTATGCAACAGCACCCAAACCCAAAGCCAATCTGAGTCTTCTTCA
GCATCACCATCAGCATCTCCGTCACCATCAACAACTTCAACAAAAAGTGATGAAGAAAGATCCATGAAGATGGACTATGAAGGAAGAGGATCAGGATTTGGGATTTTGTATTACCGCGGT
CTTTTGCAGGGCAGGGGAATCCTGTTTGTAGATCAACAGCTAACAGCTGGGGAGGAAACCGCAAGTTGGGTCAGGCAATATGCATCAGATGTTTCTATGTTTCATAAAGATTTTGCACAG
GTGATGATGAAGCTTTCCAGTACCCAAGTGCTGACTGGACTAAGCGGTGAGGTAAGAACAAACTGCAGAGAAGTGAGTTCATCTTTGTGGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACAGGATGCTAAAATCCTTCATCTTCTTCTTCTAATCGGATACTCTCTTCTCATATCTTTCATTTCTCCATCTGATTCATCGCTCGAGTACGACTATTATCGCGAATCATGTCCT
CAAGCGCAACAAGTTATCAGATCGACGTTACGCCGGATCTACGACCGGAATTCGACCGTCGCTCCTGCTATTCTTCGTCTCGTTTTTCACGATTGTTTTGTACAG
GGATGTGATGCGTCG
GTGCTTTTGGATCGTACTGTCTTTATGGGGAGTGAGAAAGACACTCTACCAAATCAGTCTTTGAGGGGATTTGATCACATTGACATTATCAAGTCCGAATTGGAAAACGTTTGCCCTGGT
GTGGTTTCTTGTGCTGATCTTCTTGTGGTGGCTGCTCGTGAGAGCGTGGTTTTG
GCTGGTGGACCATTTTATCCTGTACACACCGGTAGGAAAGACAGTGATCACTCTTTCCCTGAAATT
TCATATGAGCTTCCTAGCCCCTTAGATGATCTTCCTACAACCATTGCGAGATTTGCGTCAAGGGGATTTACTGTAAAAGAAACAGTCACTCTTTTAG
GTGCCCATAGTACTGGAATGATT
CACTGCAAGTTCTTTGAAAGACGGCTTTACAAATTTGGTGGGACTGATCAGCCAGACCCATCGTTGGATCCTGAATTTGCAGAACTCCTACGATCCGTATGCAACAGCACCCAAACCCAA
AGCCAATCTGAGTCTTCTTCAGCATCACCATCAGCATCTCCGTCACCATCAACAACTTCAACAAAAAGTGATGAAGAAAGATCCATGAAGATGGACTATGAAGGAAGAGGATCAGGATTT
GGGATTTTGTATTACCGCGGTCTTTTGCAGGGCAGGGGAATCCTGTTTGTAGATCAACAGCTAACAGCTGGGGAGGAAACCGCAAGTTGGGTCAGGCAATATGCATCAGATGTTTCTATG
TTTCATAAAGATTTTGCACAGGTGATGATGAAGCTTTCCAGTACCCAAGTGCTGACTGGACTAAGCGGTGAGGTAAGAACAAACTGCAGAGAAGTGAGTTCATCTTTGTGGTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACAGG ATGCTAAAAT CCTTCATCTT CTTCTTCTAA TCGGATACTC TCTTCTCATA TCTTTCATTT CTCCATCTGA TTCATCGCTC GAGTACGACT ATTATCGCGA ATCATGTCCT  CAAGCGCAAC AAGTTATCAG ATCGACGTTA CGCCGGATCT ACGACCGGAA TTCGACCGTC GCTCCTGCTA TTCTTCGTCT CGTTTTTCAC GATTGTTTTG TACAGGGATG TGATGCGTCG  GTGCTTTTGG ATCGTACTGT CTTTATGGGG AGTGAGAAAG ACACTCTACC AAATCAGTCT TTGAGGGGAT TTGATCACAT TGACATTATC AAGTCCGAAT TGGAAAACGT TTGCCCTGGT  GTGGTTTCTT GTGCTGATCT TCTTGTGGTG GCTGCTCGTG AGAGCGTGGT TTTGGCTGGT GGACCATTTT ATCCTGTACA CACCGGTAGG AAAGACAGTG ATCACTCTTT CCCTGAAATT  TCATATGAGC TTCCTAGCCC CTTAGATGAT CTTCCTACAA CCATTGCGAG ATTTGCGTCA AGGGGATTTA CTGTAAAAGA AACAGTCACT CTTTTAGGTG CCCATAGTAC TGGAATGATT  CACTGCAAGT TCTTTGAAAG ACGGCTTTAC AAATTTGGTG GGACTGATCA GCCAGACCCA TCGTTGGATC CTGAATTTGC AGAACTCCTA CGATCCGTAT GCAACAGCAC CCAAACCCAA  AGCCAATCTG AGTCTTCTTC AGCATCACCA TCAGCATCTC CGTCACCATC AACAACTTCA ACAAAAAGTG ATGAAGAAAG ATCCATGAAG ATGGACTATG AAGGAAGAGG ATCAGGATTT  GGGATTTTGT ATTACCGCGG TCTTTTGCAG GGCAGGGGAA TCCTGTTTGT AGATCAACAG CTAACAGCTG GGGAGGAAAC CGCAAGTTGG GTCAGGCAAT ATGCATCAGA TGTTTCTATG 
TTTCATAAAG ATTTTGCACA GGTGATGATG AAGCTTTCCA GTACCCAAGT GCTGACTGGA CTAAGCGGTG AGGTAAGAAC AAACTGCAGA GAAGTGAGTT CATCTTTGTG GTAG 

Retrieve as FASTA