Entry information : HaPrx96 (HanXRQChr12g0364091)
Entry ID 13650
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx96 (HanXRQChr12g0364091)
Name (synonym) HaPrx96 (HanXRQChr12g0364091)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx96
start..stop
S start..stop
HaPrx134 673 0 1..328 1..328
HaPrx45 640 0 1..329 1..329
HaPrx62 632 0 1..329 1..329
HaPrx74 451 8e-161 8..329 5..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32832633..32832854 222 N° 2 32832964..32833146 183 N° 3 32833291..32833453 163 N° 4 32835194..32835615 422
join(32832633..32832854,32832964..32833146,32833291..32833453,32835194..32835615 )


exon

Literature and cross-references HaPrx96 (HanXRQChr12g0364091)
DNA ref. HanXRQ genome:   HanXRQChr12 (32832633..32835615)
Protein sequence: HaPrx96 (HanXRQChr12g0364091)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329
PWM (Da):   %s   35989.35 Transmb domain:   %s   i7-24o
PI (pH):   %s   6.31
Sequence 370
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLIKMTIVVLTIIIIFEFLIVANSQNQLKVGFYNQVCPNAESVVTNIVRDAAKSDHRIPPGLLRLHFHDCFVEGCDGSILIDKGNTSEKGAFEHQGLTGFNIIEDAKAKLESICPGVVSCADIVAMAARDAVAFSHGPVYHVETGRKDGLVSNIDLANRMPDVRDSIQLLKQKFIEKGLNEKDLVILSAAHTIGSTACFFMEERLYNFASLGGPDPSINPRLLPELTSTCPKNGDVGVRLPMDHGSEDTFDIQILQNIRSGFAVLQSDAKLMDDLTTRGIVDSYFNVWAPFFGPSFEADFVISMVRMGRIGVKTGSNGNIRRQCKSFN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAATTGATCAAAATGACCATTGTGGTGCTGACTATCATAATAATTTTTGAGTTTTTAATTGTAGCTAATTCACAAAATCAACTCAAAGTAGGGTTTTACAATCAGGTGTGTCCCAACG
CAGAATCGGTGGTTACTAATATTGTGAGAGATGCAGCAAAGTCCGATCATCGTATTCCTCCTGGCTTGCTCAGGCTTCACTTTCATGACTGCTTTGTTGAG
GTTCTCCATCTCTCACAAA
CACATTTATAAATTTATTAAACGACCGGTTTGTGATCGTTTATGTCGTCATCTTTGTAGCAGTATTTCTTACAGTTGTGTTTATATGCAGGGGTGTGATGGGTCCATATTAATAGATAAG
GGTAACACTTCAGAGAAAGGTGCATTCGAGCATCAAGGGTTAACAGGGTTTAACATAATAGAGGATGCAAAAGCAAAGTTGGAAAGTATATGTCCTGGTGTGGTTTCATGTGCGGATATT
GTGGCCATGGCTGCAAGAGATGCCGTTGCATTT
GTAAGTTAAAAGAACATGTACAACGATAATCTGAATGACTCAATCTATCTCTCTCTCTCTCTCTCTCTCACACACGTATACTTACAA
TGTGTGTGAGACAAAGACAGTAAAAATGACATCTGATAATGACTGTTTTTCTGACAGAGTCATGGACCAGTTTATCATGTTGAAACCGGAAGGAAGGATGGTCTAGTGTCAAATATTGAT
CTTGCTAATAGAATGCCTGATGTGAGAGATTCAATTCAGCTTCTGAAACAAAAGTTCATTGAGAAGGGGCTTAATGAAAAAGACCTTGTGATCCTTAGTG
GTAATTTTGTTCGGTTTATA
TTTGTTTTATGTTTTGGAAAAATTACAAAAATAGTTATGTTGACCAAACAGTTTTCTAAAACAGTCAAGGAAATTTAGTCTTTAGCAAAGTACTTATCACTCATTTCCGCAAATTGAAAG
CCCGCCACATAAGCTTCATCAGTTGAGACAATGGAAATTTAGCCTACACTTTTGGCTGTCGGCTAAGACTGCACTTTTAGCAAAAGGGTCGGCCAAGTCTGCGCCTTTGGGTGCTTGCTA
AGGGTTAACCACGCCTTTTGAGAACGGCTAAGATTCACTGACTATTTTTTTAAATATTGGGTCAACTACACTATTTTGATAATTTTCCTTAATCTTTTGGGTTCCATTCATGCACTTTGA
AATGTTATAGGATATCTTTCAACATAGTTAACAATATATTGTGTTATTAATCATAATATTTACTATTTCTGTGATTATACCAATCATATTCTTTCCTGCCTGAAATGCTTTTATTGTTTC
TGCAATAAATGAAAGCAAATCGTCTAGTTTTCTAAGTAGGGAATTTTAAAAATTTTAAAAAATTATATTTTGGAGTATATTTATACAGTACGCGGTATATTTATCCATTTAATATACGTT
CCTGAATTAATAAAAATACATCTGGAAAATGAAGTAGATATGTGTGAAAAGTAGATAATAAAAAGCGACATGTAGCCCACTCATAAGTTTATATATTTAAAGCATTAATTCTTTGTATTG
ATATGTGAGCATAAATTAAAGTTTTTATGGAATATTTTGTGTACTTCGTTAATATAGACTTTAACTGCATAAATTACATTACAAATAAATGTATAAAAAATAATTTCACGTGAGTTTCTT
TTAGGCTAATTGACATGGTCAACACAGAAATTAAGTTGACATCATAAGGGGTCGAATACAAATATTAACATGTCATCAAAGTCAAGATATAAATACATGAAAAGAAAATAATGTATTTTC
ACCTGGTTGCGAAGGTGAAATTTAATGGCGTGATGTTGTAACGGCCCCATATTATGTGCACTAATGTTTGTAATAAATATTGTTTTTCGTTAGAACACAATTTGTATATTGAAATATGTA
TATTAAAAGTTTGTACAAAAACATGAATAAAATTATATGCTTGTATATTGAAATATGTATATTAAAAGTTTGTACAAAAAACATGAATAAAATTATATGCGAATTATATATATTTCGAAG
AACCATAAATAGTAATTATAAATTTAAAATAGTATATAGCTTTTTAATATTTTATTATTTGAATATATTATAGTATAATATTATATTTATTTTTAACATATTTTCAATTTTTCCCTTTTA
TTATTATATGCACTTTTTACATATTTTCCTTTTTTTTTTCTAAAATCATATATCCTTTCTCATTTATTTTTTATTTTTAATAATTCTTTTTTTAAATCATCTTTACTTTATCAATTATTT
TGATATTTCTTTATTAACTTAAGTTCCTACATTTTTTTACTAAAAACTTAAGTACGTAGTTGTGCTTTAAAAACCGAAGTTGTACTAAAAATAGAGTATGTATTTGGTAGCGTAAAATGG
TACGATGATAAACTGAATCGATTCTAATGGTTGGGCTTTCTAAACAACATGTTTCATTTTCAAATAACGTTTGTTTTAAATTATTGTTTGCTTTGTTACGCCGCAACGCGCGATATAAAA
AAACCTAGTTTTAATGGTTTCTTTTATTGATAATATTCAGCTGCACATACTATTGGTTCAACTGCGTGCTTCTTCATGGAGGAACGACTCTACAACTTTGCATCGCTTGGTGGTCCAGAC
CCAAGTATCAACCCTCGTTTGCTACCTGAACTGACATCGACATGCCCTAAAAATGGAGACGTTGGAGTCAGATTACCAATGGATCATGGGAGCGAAGACACATTTGACATTCAAATCCTA
CAAAACATTAGGAGTGGTTTTGCGGTGCTACAATCTGATGCAAAGCTTATGGACGACCTGACAACAAGGGGAATAGTAGATTCGTATTTCAACGTGTGGGCTCCGTTTTTTGGACCATCA
TTTGAGGCAGATTTTGTGATTTCCATGGTAAGAATGGGCAGAATTGGGGTCAAGACCGGTTCTAATGGAAATATTAGGCGTCAATGTAAATCATTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAATTGATCAAAATGACCATTGTGGTGCTGACTATCATAATAATTTTTGAGTTTTTAATTGTAGCTAATTCACAAAATCAACTCAAAGTAGGGTTTTACAATCAGGTGTGTCCCAACG
CAGAATCGGTGGTTACTAATATTGTGAGAGATGCAGCAAAGTCCGATCATCGTATTCCTCCTGGCTTGCTCAGGCTTCACTTTCATGACTGCTTTGTTGAG
GGGTGTGATGGGTCCATAT
TAATAGATAAGGGTAACACTTCAGAGAAAGGTGCATTCGAGCATCAAGGGTTAACAGGGTTTAACATAATAGAGGATGCAAAAGCAAAGTTGGAAAGTATATGTCCTGGTGTGGTTTCAT
GTGCGGATATTGTGGCCATGGCTGCAAGAGATGCCGTTGCATTT
AGTCATGGACCAGTTTATCATGTTGAAACCGGAAGGAAGGATGGTCTAGTGTCAAATATTGATCTTGCTAATAGAA
TGCCTGATGTGAGAGATTCAATTCAGCTTCTGAAACAAAAGTTCATTGAGAAGGGGCTTAATGAAAAAGACCTTGTGATCCTTAGTG
CTGCACATACTATTGGTTCAACTGCGTGCTTCT
TCATGGAGGAACGACTCTACAACTTTGCATCGCTTGGTGGTCCAGACCCAAGTATCAACCCTCGTTTGCTACCTGAACTGACATCGACATGCCCTAAAAATGGAGACGTTGGAGTCAGAT
TACCAATGGATCATGGGAGCGAAGACACATTTGACATTCAAATCCTACAAAACATTAGGAGTGGTTTTGCGGTGCTACAATCTGATGCAAAGCTTATGGACGACCTGACAACAAGGGGAA
TAGTAGATTCGTATTTCAACGTGTGGGCTCCGTTTTTTGGACCATCATTTGAGGCAGATTTTGTGATTTCCATGGTAAGAATGGGCAGAATTGGGGTCAAGACCGGTTCTAATGGAAATA
TTAGGCGTCAATGTAAATCATTTAATTAA

Retrieve as FASTA