Entry information : HaPrx97 (HanXRQChr12g0364521)
Entry ID 13651
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx97 (HanXRQChr12g0364521)
Name (synonym) HaPrx97 (HanXRQChr12g0364521)
Class Class III peroxidase    [Orthogroup: Prx024]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx97
start..stop
S start..stop
HaPrx60 614 0 1..333 29..363
CroPrx18 516 0 21..333 12..324
MguPrx88 505 0 13..333 19..341
SaPrx46 502 0 17..333 22..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34455641..34455859 219 N° 2 34455293..34455484 192 N° 3 34455049..34455214 166 N° 4 34453979..34454403 425
complement(join(34453979..34454403,34455049..34455214,34455293..34455484,3445564 1..34455859))


exon

Literature and cross-references HaPrx97 (HanXRQChr12g0364521)
DNA ref. HanXRQ genome:   HanXRQChr12 (34455859..34453979)
Protein sequence: HaPrx97 (HanXRQChr12g0364521)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (310)
PWM (Da):   %s   36569.07 (33880.7)  
PI (pH):   %s   5.19 (4.92) Peptide Signal:   %s   cut: 24 range:24-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQIISTIFILSFFTICCLKFMHAADPPLSLDYYKSSCPNAEAIVRKEMECAVLSDLRNAALILRLHFHDCFVQGCDGSVLLDDTFTLQGEKNAPTNLNALKGFEIIDRIKNKLESECPNTVSCADILTYAARDATVLVGGPYWHVPAGRKDSKTASFSLVESNIPGANDGLLSIIAKFMYQSLSVTDMVALSGAHTIGMARCTNYRERIYGDYQATSTMGDIAESHLKTLKATCPAAGGGDNNEAAMDYVSPNLFDNSYYHILLRGEGLLNSDQELYSSILGVQTRKLVKQYAENAIAFFEQFSESMVKLGNITNPETYVDGEVRKNCRFVNT

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAATCATATCAACCATCTTCATTCTTTCATTTTTCACCATATGTTGCCTCAAATTCATGCATGCAGCTGACCCACCATTATCTTTAGATTACTACAAGTCTTCTTGCCCAAATGCA
GAAGCCATTGTTAGGAAAGAAATGGAGTGTGCTGTGCTATCTGATCTCAGAAATGCCGCTTTGATCCTACGCTTACACTTCCATGACTGCTTCGTGCAG
GTGTGTTCATGGTTCGGTTAG
AAACCCTCCAAACCAGTCATAGATTTAGTTTCAAAGATGGTTTTTTTCCTTTTTTAATACCGTTTCGAAGCTAATGATTTGGTTTTTAACTATCGAAACACAATCGTTTCTCTAATCTTT
CTTGATTTAATCTAGGGTTGTGATGGATCAGTGTTGCTAGATGACACATTCACTTTACAAGGAGAAAAGAATGCTCCCACTAATTTAAATGCTTTGAAAGGTTTTGAAATCATTGATAGG
ATAAAGAACAAGCTTGAATCTGAGTGTCCTAACACAGTTTCATGTGCTGATATTCTTACATATGCTGCAAGAGATGCAACTGTGTTG
GTAAGTTGACATGCTAGTAATCTAGCAATAAAA
AGTTGTTTATTTTAATGATATTGTTTTATGTTACTTTGGGTATAGGTTGGTGGACCTTATTGGCATGTCCCGGCTGGAAGAAAAGACTCGAAAACGGCTAGCTTTTCGCTTGTGGAATCG
AATATTCCTGGTGCGAATGACGGCCTTCTATCGATCATTGCTAAGTTTATGTATCAAAGCCTCTCGGTCACCGATATGGTGGCACTTTCTG
GTAAGAGAACTTTTGTAAATGTATAAATC
GAAGGGCGTGTGTCCGGGTTGTGTTTTGAAAGTCATTATCTGATTGTTACATTTTCAAGGGTTTTTTTTTTATATATCAATATCATTCCACACGAAAAAGGGCAATTACAAAGCAATGGC
AGGTAGTCGGGCAACAAGTTGCGCCGCCACCCACTTTTGAAATTAGTTCCTAGTGTTTGTGTTATACATAAAAATTCTTTAATAATCACAAACCCTTAAACACCATATCATTACAACTTT
AAACAATAGAAGCACATCAAATAAACACTATTTGTTAGGACGTCCACGCCCCTCATAATTAAACAACTAATGGATTGATGTTTAGCCGATCAGAATGTTGTAAATTGTTTTGAAACGACA
TAAATGAAAGTTAGGGGCAGACCAAGTGATTTTTATGCTAAAGTGAAATTACCCTTAATTACTAGTATGGATTATTATCGACCAATGAGTCATAATTTGGAATACTAAAATCCATATTTG
CTAATTTTTAAACAATATTGTGAGAAAATATATATTTGACACTAAATATGCTTGTGCATTAAGCTCATGCTAGTAATTCTTTAAACTTGAACAAGCATTGTTTATAACATTATGAAATGA
TCAAAACATGTACAAGGTGCTCACACAATCGGGATGGCGCGTTGTACAAACTATCGAGAAAGAATCTACGGAGATTACCAAGCAACTTCAACTATGGGTGATATCGCGGAATCACACCTC
AAAACTTTAAAGGCAACATGCCCGGCTGCAGGAGGAGGAGACAATAACGAAGCCGCAATGGATTATGTTTCACCTAATCTTTTCGACAACTCGTATTACCACATACTTCTTAGAGGAGAA
GGTCTTCTTAATTCTGATCAAGAACTCTATTCTAGCATTCTTGGAGTCCAAACAAGGAAGCTTGTCAAGCAATATGCAGAAAATGCAATAGCCTTTTTTGAACAGTTTTCTGAGTCTATG
GTGAAACTGGGAAATATTACAAATCCTGAGACTTATGTTGATGGTGAAGTTAGGAAGAATTGCAGGTTTGTGAACACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAATCATATCAACCATCTTCATTCTTTCATTTTTCACCATATGTTGCCTCAAATTCATGCATGCAGCTGACCCACCATTATCTTTAGATTACTACAAGTCTTCTTGCCCAAATGCA
GAAGCCATTGTTAGGAAAGAAATGGAGTGTGCTGTGCTATCTGATCTCAGAAATGCCGCTTTGATCCTACGCTTACACTTCCATGACTGCTTCGTGCAG
GGTTGTGATGGATCAGTGTTG
CTAGATGACACATTCACTTTACAAGGAGAAAAGAATGCTCCCACTAATTTAAATGCTTTGAAAGGTTTTGAAATCATTGATAGGATAAAGAACAAGCTTGAATCTGAGTGTCCTAACACA
GTTTCATGTGCTGATATTCTTACATATGCTGCAAGAGATGCAACTGTGTTG
GTTGGTGGACCTTATTGGCATGTCCCGGCTGGAAGAAAAGACTCGAAAACGGCTAGCTTTTCGCTTGTG
GAATCGAATATTCCTGGTGCGAATGACGGCCTTCTATCGATCATTGCTAAGTTTATGTATCAAAGCCTCTCGGTCACCGATATGGTGGCACTTTCTG
GTGCTCACACAATCGGGATGGCG
CGTTGTACAAACTATCGAGAAAGAATCTACGGAGATTACCAAGCAACTTCAACTATGGGTGATATCGCGGAATCACACCTCAAAACTTTAAAGGCAACATGCCCGGCTGCAGGAGGAGGA
GACAATAACGAAGCCGCAATGGATTATGTTTCACCTAATCTTTTCGACAACTCGTATTACCACATACTTCTTAGAGGAGAAGGTCTTCTTAATTCTGATCAAGAACTCTATTCTAGCATT
CTTGGAGTCCAAACAAGGAAGCTTGTCAAGCAATATGCAGAAAATGCAATAGCCTTTTTTGAACAGTTTTCTGAGTCTATGGTGAAACTGGGAAATATTACAAATCCTGAGACTTATGTT
GATGGTGAAGTTAGGAAGAATTGCAGGTTTGTGAACACATAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCCAACCATT TTTCATTAAC TACCACTCAA GAAACTCTAA ATCAAGATCA AACAAACACC ATGCAAATCA TATCAACCAT CTTCATTCTT TCATTTTTCA CCATATGTTG CCTCAAATTC  ATGCATGCAG CTGACCCACC ATTATCTTTA GATTACTACA AGTCTTCTTG CCCAAATGCA GAAGCCATTG TTAGGAAAGA AATGGAGTGT GCTGTGCTAT CTGATCTCAG AAATGCCGCT  TTGATCCTAC GCTTACACTT CCATGACTGC TTCGTGCAGG GTTGTGATGG ATCAGTGTTG CTAGATGACA CATTCACTTT ACAAGGAGAA AAGAATGCTC CCACTAATTT AAATGCTTTG  AAAGGTTTTG AAATCATTGA TAGGATAAAG AACAAGCTTG AATCTGAGTG TCCTAACACA GTTTCATGTG CTGATATTCT TACATATGCT GCAAGAGATG CAACTGTGTT GGTTGGTGGA  CCTTATTGGC ATGTCCCGGC TGGAAGAAAA GACTCGAAAA CGGCTAGCTT TTCGCTTGTG GAATCGAATA TTCCTGGTGC GAATGACGGC CTTCTATCGA TCATTGCTAA GTTTATGTAT  CAAAGCCTCT CGGTCACCGA TATGGTGGCA CTTTCTGGTG CTCACACAAT CGGGATGGCG CGTTGTACAA ACTATCGAGA AAGAATCTAC GGAGATTACC AAGCAACTTC AACTATGGGT  GATATCGCGG AATCACACCT CAAAACTTTA AAGGCAACAT GCCCGGCTGC AGGAGGAGGA GACAATAACG AAGCCGCAAT GGATTATGTT TCACCTAATC TTTTCGACAA CTCGTATTAC  CACATACTTC TTAGAGGAGA AGGTCTTCTT AATTCTGATC AAGAACTCTA TTCTAGCATT CTTGGAGTCC AAACAAGGAA GCTTGTCAAG CAATATGCAG AAAATGCAAT AGCCTTTTTT  GAACAGTTTT CTGAGTCTAT GGTGAAACTG GGAAATATTA CAAATCCTGA GACTTATGTT GATGGTGAAG TTAGGAAGAA TTGCAGGTTT GTGAACACAT AAAGATGATG ATTAACTAGT  TAACTTGTGT TGTTTCATAT TCATATATTC ATGTGTTTTT ATAATTTGAA TTTGTGTCAT TTGTACGATG TATGAGACCA TCTGCAATAG GAGGCTCACG GACTATTTTA AAATGGTTTT 
TGAATTGTAA TACTAAGAAA ATGTAATTTT TTTTACAATT TCTTTATTAA GTTTCCTAAT TAATTTCTTG TTATTTCTAT ATAAAA 

Retrieve as FASTA