Entry information : HaPrx98 (HanXRQChr12g0378371)
Entry ID 13652
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx98 (HanXRQChr12g0378371)
Name (synonym) HaPrx98 (HanXRQChr12g0378371)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx98
start..stop
S start..stop
LvPrx18 462 1e-165 5..300 10..304
NtPrx31-1A 461 6e-165 2..323 6..327
LsaPrx18 459 1e-164 5..300 10..304
LePrx69 446 4e-159 2..323 13..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 112836176..112836379 204 N° 2 112836619..112836810 192 N° 3 112836891..112837056 166 N° 4 112837182..112837591 410
join(112836176..112836379,112836619..112836810,112836891..112837056,112837182..1 12837591)


exon

Literature and cross-references HaPrx98 (HanXRQChr12g0378371)
DNA ref. HanXRQ genome:   HanXRQChr12 (112836176..112837591)
Protein sequence: HaPrx98 (HanXRQChr12g0378371)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (302)
PWM (Da):   %s   35377.59 (32904.4)  
PI (pH):   %s   6.12 (5.76) Peptide Signal:   %s   cut: 22 range:22-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHFPTISLVFCLFVFQPFVYGQLDYKFYDTTCPNLTKIVRFGVWSAMANDTRMAASLLRLHFHDCISNGCDASVLLDETSSFRSEKDALPNLNSARGFELIESIKANVEKVCPKTVSCVDILTLAVRDAVLLTGGRYWNVALGRRDGLTANITAANTMTPSPFESLDDIIAKFTAKGLDIKDVVALSGAHTIGFVQCFAFKFRLFNFSGTGSFDPSLDASFASSLQTQCPNQDASDTTLVPLDAVTTTKFDNMFFRNLVNNSGVLGSDQALMSDNRTSAMVINYSKYPFWFAKDFSDSMVKLSNVGVITGQNGQVRDKCNLVN

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTTCCTACTATTAGTCTCGTCTTTTGCCTTTTCGTTTTTCAACCGTTTGTATATGGTCAACTTGATTACAAATTTTATGATACCACTTGTCCTAATTTGACGAAAATCGTGAGG
TTCGGTGTTTGGTCTGCGATGGCTAACGATACCAGAATGGCGGCATCACTTCTTCGCTTGCATTTTCATGACTGTATTTCTAAT
GTAATAATTTCGTCATTTTCATTTCTTGTATTTTGA
AATTTTTAATCGAATATTTTTATGTGAATCATGGGGACCCCACCAATACCCTGCTAACCAATAAGATTAAGAAAAAACGCAGCTTGCGTTGGGTAGGTAGCCTTCAACGGGGTTAAATGC
ATAAATCACTGCCAGCCGCTTAAATGTTAAATCTTTTAAATGTCGGACTAAATTAAATTAACTTTTTTTTCGTGTGTGTCTAGGGGTGTGATGCTTCGGTGTTACTTGATGAGACTAGTA
GTTTCAGGAGCGAGAAGGACGCTCTTCCTAATCTAAATTCAGCTAGAGGGTTTGAGCTTATTGAAAGCATAAAAGCAAATGTGGAGAAAGTTTGTCCTAAAACAGTTTCGTGTGTTGACA
TATTGACACTCGCTGTGAGAGACGCAGTTTTACTG
GTAAGACCTTTGTTATATAAACAACATTACAAAAAAAAAATTGGTATTTTTCTAACATATAAATATGCTTTGTTTTCTAGACGGG
AGGGCGTTATTGGAATGTAGCCCTGGGACGTCGAGATGGTCTCACAGCAAATATAACTGCGGCAAACACGATGACTCCATCACCTTTTGAGTCTTTAGATGACATTATTGCAAAATTCAC
AGCAAAAGGTCTTGATATAAAAGACGTAGTTGCATTATCAG
GTAAAAAAACATAACATTACCACAAGTTAGCTAATTAATTATACAAATTTTTGTTTGTTGTCATTTTCACACACATGTA
AGGTGTAGTAGGATTGTGATGTTATGTTGCTTTAATTTGTGTGAAGGTGCGCATACCATAGGATTTGTACAATGCTTCGCGTTCAAGTTCAGACTATTCAACTTTAGTGGAACAGGGAGT
TTTGATCCATCACTAGACGCATCATTTGCAAGTAGTTTGCAAACTCAGTGTCCGAATCAAGATGCTTCGGACACCACACTAGTCCCTCTTGACGCGGTGACAACTACAAAGTTTGACAAC
ATGTTTTTCAGGAATCTTGTGAACAACTCGGGGGTTTTAGGTTCAGATCAAGCTCTTATGAGTGATAATAGGACCTCGGCCATGGTTATAAACTATAGCAAGTATCCGTTCTGGTTTGCT
AAAGATTTTAGTGATTCGATGGTTAAGCTAAGCAACGTGGGTGTAATTACGGGGCAAAATGGTCAAGTTAGAGACAAATGCAACCTTGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTTTCCTACTATTAGTCTCGTCTTTTGCCTTTTCGTTTTTCAACCGTTTGTATATGGTCAACTTGATTACAAATTTTATGATACCACTTGTCCTAATTTGACGAAAATCGTGAGG
TTCGGTGTTTGGTCTGCGATGGCTAACGATACCAGAATGGCGGCATCACTTCTTCGCTTGCATTTTCATGACTGTATTTCTAAT
GGGTGTGATGCTTCGGTGTTACTTGATGAGACTAGT
AGTTTCAGGAGCGAGAAGGACGCTCTTCCTAATCTAAATTCAGCTAGAGGGTTTGAGCTTATTGAAAGCATAAAAGCAAATGTGGAGAAAGTTTGTCCTAAAACAGTTTCGTGTGTTGAC
ATATTGACACTCGCTGTGAGAGACGCAGTTTTACTG
ACGGGAGGGCGTTATTGGAATGTAGCCCTGGGACGTCGAGATGGTCTCACAGCAAATATAACTGCGGCAAACACGATGACTCCA
TCACCTTTTGAGTCTTTAGATGACATTATTGCAAAATTCACAGCAAAAGGTCTTGATATAAAAGACGTAGTTGCATTATCAG
GTGCGCATACCATAGGATTTGTACAATGCTTCGCGTTC
AAGTTCAGACTATTCAACTTTAGTGGAACAGGGAGTTTTGATCCATCACTAGACGCATCATTTGCAAGTAGTTTGCAAACTCAGTGTCCGAATCAAGATGCTTCGGACACCACACTAGTC
CCTCTTGACGCGGTGACAACTACAAAGTTTGACAACATGTTTTTCAGGAATCTTGTGAACAACTCGGGGGTTTTAGGTTCAGATCAAGCTCTTATGAGTGATAATAGGACCTCGGCCATG
GTTATAAACTATAGCAAGTATCCGTTCTGGTTTGCTAAAGATTTTAGTGATTCGATGGTTAAGCTAAGCAACGTGGGTGTAATTACGGGGCAAAATGGTCAAGTTAGAGACAAATGCAAC
CTTGTGAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCTATTATCT TAACGACAAA GTTCACTGAA TTAGGAGGCT TCCTTACATA CACCAATATT ACATATAAAA TACACAATTG TTTAGAGTGT AATCCTAGTG TCTTGAACTA TCAACTGCTT  TTTGCATACT GAATGAGCAC CAACTCCACT TAGGAGCTTC AGCTCAGCAT CCAAACTCAA AAGTGCCTTC ATTTTATCTT GATGTTGACT TGTTCCAAAC TCTTTCTAGT GGCAGACCCA  CTGTATATAT AACAAAAATA TCTATTTAAG CCCATCTTGT GTTGCCATAA GTTCTAAGAG TAAGAGCTCT TGAAGCAGCA CATAACTACA AACATGCATT TTCCTACTAT TAGTCTCGTC  TTTTGCCTTT TCGTTTTTCA ACCGTTTGTA TATGGTCAAC TTGATTACAA ATTTTATGAT ACCACTTGTC CTAATTTGAC GAAAATCGTG AGGTTCGGTG TTTGGTCTGC GATGGCTAAC  GATACCAGAA TGGCGGCATC ACTTCTTCGC TTGCATTTTC ATGACTGTAT TTCTAATGGG TGTGATGCTT CGGTGTTACT TGATGAGACT AGTAGTTTCA GGAGCGAGAA GGACGCTCTT  CCTAATCTAA ATTCAGCTAG AGGGTTTGAG CTTATTGAAA GCATAAAAGC AAATGTGGAG AAAGTTTGTC CTAAAACAGT TTCGTGTGTT GACATATTGA CACTCGCTGT GAGAGACGCA  GTTTTACTGA CGGGAGGGCG TTATTGGAAT GTAGCCCTGG GACGTCGAGA TGGTCTCACA GCAAATATAA CTGCGGCAAA CACGATGACT CCATCACCTT TTGAGTCTTT AGATGACATT  ATTGCAAAAT TCACAGCAAA AGGTCTTGAT ATAAAAGACG TAGTTGCATT ATCAGGTGCG CATACCATAG GATTTGTACA ATGCTTCGCG TTCAAGTTCA GACTATTCAA CTTTAGTGGA  ACAGGGAGTT TTGATCCATC ACTAGACGCA TCATTTGCAA GTAGTTTGCA AACTCAGTGT CCGAATCAAG ATGCTTCGGA CACCACACTA GTCCCTCTTG ACGCGGTGAC AACTACAAAG  TTTGACAACA TGTTTTTCAG GAATCTTGTG AACAACTCGG GGGTTTTAGG TTCAGATCAA GCTCTTATGA GTGATAATAG GACCTCGGCC ATGGTTATAA ACTATAGCAA GTATCCGTTC  TGGTTTGCTA AAGATTTTAG TGATTCGATG GTTAAGCTAA GCAACGTGGG TGTAATTACG GGGCAAAATG GTCAAGTTAG AGACAAATGC AACCTTGTGA ACTAGAAAAT CTGTAGCTTT  TCATGGTTGT TGTAGATTGT GTTTCAGACT TGTTTATGTT TTTGGATGAA TAATTATGCT TATTGCAAAT ATTGAATTCT GCTATATGCG ACAATTTCAA CTCATTTACT TTATAAATTG 
ATCGTTTTTA GCTGTAAATA TAAATAAATA CATGTTAACT GTTAAGAAAA CTTAAAA 

Retrieve as FASTA