Entry information : HaPrx99 (HanXRQChr12g0380061)
Entry ID 13653
Creation 2016-05-02 (Christophe Dunand)
Last sequence changes 2016-05-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrx99 (HanXRQChr12g0380061)
Name (synonym) HaPrx99 (HanXRQChr12g0380061)
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrx99
start..stop
S start..stop
HaPrx48 538 0 7..341 7..341
LsePrx49 520 0 12..306 8..304
HaPrx105 519 0 11..340 31..360
LvPrx49 495 5e-179 12..283 8..281
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 126349910..126350188 279 N° 2 126349453..126349795 343 N° 3 126348951..126349354 404  
complement(join(126348951..126349354,126349453..126349795,126349910..126350188))


exon

Literature and cross-references HaPrx99 (HanXRQChr12g0380061)
DNA ref. HanXRQ genome:   HanXRQChr12 (126350188..126348951)
Protein sequence: HaPrx99 (HanXRQChr12g0380061)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (318)
PWM (Da):   %s   37980.47 (35504.2) Transmb domain:   %s   i2-24o
PI (pH):   %s   9.02 (9.13) Peptide Signal:   %s   cut: 24 range:24-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMIGTIMCLAFISFLSIFISVSAFNNPSLTHSLKVPSLPDITSFEDDLSYSLYHKGCPNVEGIIYRKVKEWVKRDPSLAPSLMRLHFHDCAVRGCDASILLDHSGSERSANVSKSLRGFELINDIKAELEKKCPKIVSCADILTTAARDATVLAGGPFWTIPFGRKDGRVSLAKEAAAVPMGRESITQLIEFFQSKGLNVLDLVVLSGAHTIGRSSCEAVQYRLYNYKGTKKPDPSINPLYLNYLRRKCRWASENVYLDATSPNKFDTQYYHNLKKKMGLLSTDQLLYSDSRTKPIADALSFQSSLFYNQFSVSMVKLANILDVKSQDNGEIRTNCNRVNY

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGATTGGCACGATCATGTGTCTCGCATTCATCTCCTTCTTGTCGATCTTTATCTCGGTATCTGCCTTCAACAATCCTTCGTTAACGCACTCTCTTAAAGTACCAAGCCTACCTGAT
ATCACAAGCTTTGAGGACGATCTTTCGTACTCTTTATATCATAAAGGTTGCCCTAACGTCGAAGGCATCATCTATAGGAAAGTAAAAGAATGGGTCAAGAGGGACCCGTCACTCGCTCCT
AGTCTCATGAGACTACATTTTCACGATTGTGCCGTTAGA
GTAAATAAGCTTTCCCACATTTTTATGACTTTTTGGCTACCACATTTAAACGGTCAAATGTTCATTTGTGTAGCAGTTAAC
TAAGAGAAGTATATATTTGCTTCAATTTTGTAGGGGTGCGATGCTTCCATACTATTAGACCATAGTGGAAGCGAAAGGTCTGCGAATGTAAGCAAGTCATTAAGAGGGTTCGAACTGATC
AATGATATTAAGGCTGAACTTGAGAAAAAATGCCCTAAAATCGTCTCGTGTGCTGACATCTTGACCACTGCGGCAAGAGATGCCACTGTCTTAGCCGGTGGACCATTTTGGACGATACCC
TTTGGACGGAAAGATGGTCGTGTGTCCCTAGCAAAGGAAGCTGCAGCAGTCCCTATGGGTCGCGAAAGTATTACCCAACTTATAGAGTTTTTCCAGTCCAAGGGACTGAATGTTCTTGAC
TTGGTTGTTCTCTCAG
GTACATCTTTTAACTAAAAGATAGTTTTCTTTTCTAGTAGTGTTCAATTGTTTATCTTGATTTCAAAAGCCAACAAGATAAGACACTTTGGTTTGTAGGTGCCC
ATACCATAGGAAGGAGTTCATGTGAGGCGGTGCAATATCGCCTATACAACTACAAAGGAACAAAGAAGCCCGATCCATCCATCAATCCTTTATATTTGAACTACTTGAGGAGAAAATGTA
GGTGGGCGTCAGAAAACGTGTATCTTGATGCCACAAGCCCAAATAAATTTGACACGCAATACTATCACAATCTTAAGAAGAAGATGGGGCTCCTATCAACGGACCAGTTGCTCTACTCCG
ACTCAAGGACTAAACCAATTGCCGATGCTTTGTCTTTCCAGTCATCACTCTTCTACAACCAATTTAGTGTCTCCATGGTCAAGCTTGCAAATATTCTTGATGTTAAATCTCAGGATAATG
GTGAAATCCGTACAAATTGCAATCGTGTTAACTATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGATTGGCACGATCATGTGTCTCGCATTCATCTCCTTCTTGTCGATCTTTATCTCGGTATCTGCCTTCAACAATCCTTCGTTAACGCACTCTCTTAAAGTACCAAGCCTACCTGAT
ATCACAAGCTTTGAGGACGATCTTTCGTACTCTTTATATCATAAAGGTTGCCCTAACGTCGAAGGCATCATCTATAGGAAAGTAAAAGAATGGGTCAAGAGGGACCCGTCACTCGCTCCT
AGTCTCATGAGACTACATTTTCACGATTGTGCCGTTAGA
GGGTGCGATGCTTCCATACTATTAGACCATAGTGGAAGCGAAAGGTCTGCGAATGTAAGCAAGTCATTAAGAGGGTTCGAA
CTGATCAATGATATTAAGGCTGAACTTGAGAAAAAATGCCCTAAAATCGTCTCGTGTGCTGACATCTTGACCACTGCGGCAAGAGATGCCACTGTCTTAGCCGGTGGACCATTTTGGACG
ATACCCTTTGGACGGAAAGATGGTCGTGTGTCCCTAGCAAAGGAAGCTGCAGCAGTCCCTATGGGTCGCGAAAGTATTACCCAACTTATAGAGTTTTTCCAGTCCAAGGGACTGAATGTT
CTTGACTTGGTTGTTCTCTCAG
GTGCCCATACCATAGGAAGGAGTTCATGTGAGGCGGTGCAATATCGCCTATACAACTACAAAGGAACAAAGAAGCCCGATCCATCCATCAATCCTTTA
TATTTGAACTACTTGAGGAGAAAATGTAGGTGGGCGTCAGAAAACGTGTATCTTGATGCCACAAGCCCAAATAAATTTGACACGCAATACTATCACAATCTTAAGAAGAAGATGGGGCTC
CTATCAACGGACCAGTTGCTCTACTCCGACTCAAGGACTAAACCAATTGCCGATGCTTTGTCTTTCCAGTCATCACTCTTCTACAACCAATTTAGTGTCTCCATGGTCAAGCTTGCAAAT
ATTCTTGATGTTAAATCTCAGGATAATGGTGAAATCCGTACAAATTGCAATCGTGTTAACTATTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTGCTTCTTC AAAAACAACC ATGATGATTG GCACGATCAT GTGTCTCGCA TTCATCTCCT TCTTGTCGAT CTTTATCTCG GTATCTGCCT TCAACAATCC TTCGTTAACG CACTCTCTTA  AAGTACCAAG CCTACCTGAT ATCACAAGCT TTGAGGACGA TCTTTCGTAC TCTTTATATC ATAAAGGTTG CCCTAACGTC GAAGGCATCA TCTATAGGAA AGTAAAAGAA TGGGTCAAGA  GGGACCCGTC ACTCGCTCCT AGTCTCATGA GACTACATTT TCACGATTGT GCCGTTAGAG GGTGCGATGC TTCCATACTA TTAGACCATA GTGGAAGCGA AAGGTCTGCG AATGTAAGCA  AGTCATTAAG AGGGTTCGAA CTGATCAATG ATATTAAGGC TGAACTTGAG AAAAAATGCC CTAAAATCGT CTCGTGTGCT GACATCTTGA CCACTGCGGC AAGAGATGCC ACTGTCTTAG  CCGGTGGACC ATTTTGGACG ATACCCTTTG GACGGAAAGA TGGTCGTGTG TCCCTAGCAA AGGAAGCTGC AGCAGTCCCT ATGGGTCGCG AAAGTATTAC CCAACTTATA GAGTTTTTCC  AGTCCAAGGG ACTGAATGTT CTTGACTTGG TTGTTCTCTC AGGTGCCCAT ACCATAGGAA GGAGTTCATG TGAGGCGGTG CAATATCGCC TATACAACTA CAAAGGAACA AAGAAGCCCG  ATCCATCCAT CAATCCTTTA TATTTGAACT ACTTGAGGAG AAAATGTAGG TGGGCGTCAG AAAACGTGTA TCTTGATGCC ACAAGCCCAA ATAAATTTGA CACGCAATAC TATCACAATC  TTAAGAAGAA GATGGGGCTC CTATCAACGG ACCAGTTGCT CTACTCCGAC TCAAGGACTA AACCAATTGC CGATGCTTTG TCTTTCCAGT CATCACTCTT CTACAACCAA TTTAGTGTCT  CCATGGTCAA GCTTGCAAAT ATTCTTGATG TTAAATCTCA GGATAATGGT GAAATCCGTA CAAATTGCAA TCGTGTTAAC TATTGACATG CAAGGAAAAA AAACAATATG GAATATTATC  GTTTGTTAAA TGCAAAAATT GATCCATTAA AATATAATTT CTATTTGTAA ACTGAGTTTT GATAATTTGT GCTTTTATTG TTGTAATTTG GATGATTAAT GTTGTAATGC TATGCTTTTT 
ACTCAGAAAT CATTTGTTAA TTTCTTGAAT CGACGTTTGT ATGAACTTCA ATATTTGTAA TGCCAACATA TAAAACTG 

Retrieve as FASTA