Entry information : HaKat04 (HanXRQChr08g0216431)
Entry ID 13670
Creation 2016-05-11 (Christophe Dunand)
Last sequence changes 2016-05-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaKat04 (HanXRQChr08g0216431)
Name (synonym) HaKat04 (HanXRQChr08g0216431)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaKat04
start..stop
S start..stop
HaKat05 1010 0 1..492 1..492
HaKat08 965 0 1..492 1..502
HaKat01 863 0 1..492 1..492
McKat01 862 0 1..490 1..490
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28476116..28476130 15 N° 2 28478341..28478437 97 N° 3 28479198..28479475 278 N° 4 28479543..28480319 777
N° 5 28480411..28480500 90 N° 6 28480696..28480763 68 N° 7 28480861..28480954 94 N° 8 28481263..28481319 57
join(28476116..28476130,28478341..28478437,28479198..28479475,28479543..28480319 ,28480411..28480500,28480696..28480763,28480861..28480954,28481263..28481319)


exon

Literature and cross-references HaKat04 (HanXRQChr08g0216431)
DNA ref. HanXRQ genome:   HanXRQChr08 (28476116..28481319)
Protein sequence: HaKat04 (HanXRQChr08g0216431)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56769.19  
PI (pH):   %s   7.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKQRPSSAYNAPFWTTNAGLPVYNNTASLTVGNRGPILLEDYHLIEKLANFTRERIPERIVHARGASAKGFFEVTHDITHLTCADFLRAPGVQTPTIVRFSTVIHERGSPETIRDPRGFATKFYTRGNFDIVGNNFPVFFTRDAMAFPDVIHAFKPNPKSHIQEDWRILDFLSHHPESLNTMTFWLDDVGIPTDYRHMEGSSVNTLTLVNKEGKIHYVKFTWKPTCGVKCLMDDEAIKIGGANHSHATQDLYDSIQAGNFPEWKLYLQVIDPDHEDRLDFDPLDGTMTWPEDIIPLQPVGRMVLNKNIDNFFAENEQLAFNPGLVVPGIYYSDDKMLQGRIFAYSDTQRHRLGPNYLQLPVNAPKCAHHNNHYDGNMNFMHRDEEVDYFPSRYDRVQHAKQYPINSRQVTGTRDRTVIPKYNDFKQPGDRYRSWDPARQERFIVRMCKMLSDPRVTHELRSIWISYWTADQSLGQKIASRLNVRPNY

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGGTACAACTCTAATGATAATCCTCTTTCTTACGTACAACTCTTTATGCATATAATGTCGATGATTGGAATGATAAAATACTATCATTTTACCCTTTGTTTACTTTT
TCTTGGGATAAAACTATAATAAGATTATTTTCTATAACCATTCCATATAAAAAAAAATTCTGATAAATTGTAAGTAGTGTGTATCTTGCTATAAACTTTGGAGTTTTCTCTGTTAATTTA
TAGCTCTTTGCTAAGTCGTCCTTCATTTCTGGAATGATGTTTGCCGTTCAAAAAAAGTTATGTAAACAATATCAAGATCGATTGCTTATCGATCAGACGATCACTTCACATTATTCATAT
CGCATGCAACATGAGACACGATGATCTAACCTTATTTTAGATCGATCATATTGTGTGACGGTTAATCAACGGTAGCTTGAGGTCATACAAGTTTATAGGACCATATACGATGTATTTGAA
CTGGATCAAGGCTTAAAACACATTAAATTCGATCGATCTAGGTGGCTTGAGTGAGCTAGCTAAAGATCCGAAGTTTAGACACATGACATGGACTTGCCTTGTCTCATCGTGTTAATAAGA
GAGATCACGATATATGTCTTGTTCTAGATGACAAAAGTTTTTTTAGATGTATATTTAATATTTGTATGCATATGAAGCAAATCGAGTAATATCCTAGTGTCAATAAACAAATACACATGT
AGATGAATATATATATGTGTGTGTGTGAGAGAATAAGGTGCACACGTTCATCTAATTACTTAAATTTATACTCTTAGTTTTCTTGATTTTAAGGCTCGAATCCATGTGCGCACGCGTGTG
TATATATATAGGTATAATAAAGATTTGGAATGAAAGAGATATAATAAAATTGGATGGTTTATGATCAAATACAAAGGCTCCTAAAAATACGAAGTGTACAAAGGCTCGTAAAAATAAACC
CACTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACACCCACCACCACCTAAAAACCTAAACACCCCACCCTCACCCACGTGATAATACTTGGTGGGACTGATTAGAAATATG
TTGTTATCTTGACAAGTATTCACCTTGACATCGAATGTTCATTTGAATCAATCACTTTTCTGTTGATTATACAGTTAGTTCGTAAGTCTGCCATCACCTAAATTCACAAATTAATATCCA
TAATTATTGTTGATGACTTAACTAAATTCTAAAACCTTTTGAAGTTAAAATATCCATAATTCTTTTCTTTATATACATATGATAATAATTACTTTTCTAAATATTGTAAACTATATATTT
TTATATTCAATATTATATATATATACATATATGTGTGTGTGTGTGTTACATGTTATTACAAATATATTATATAACATTAAAATCATTATATTTATATGAATAATAGACAATAACTTATCA
GAAACATATTATTTCTCTTTTAGAAAAACACATATTATTATCTATGATATGATGTTAGATCAAATACAAATATTATTTTAACATGTTAAAACAACGTAACAATAATTACTTTTGTTCAAA
CATAATTACTTCATTCGCATTTACATGTTACCAATTTGTACGAGACCTCCCTTATCAAAAAAAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAAATCTTATAAATTATTGCTTTCCTTTT
AATTTTATTATATTTCATGTCTTACATATTTTAAAGTTTCATGTTTTAATATAAAAAGCAAATAAGAGCTCAAAATATTTTGTATTAAATGATTATACTTCTAAAAATATACATAAACAA
TGAACTAAATAGTGGACATAATTTTGTCGTGGTTATTTTTAACAAAAAAATGTACTGTTATTTTGAAATGATTGTGCTTCTTAAAAAAATGAAAACCATATAAATCAATTGTACCGTTGT
ACCTGACGGTGTATTTTTTTATTCGAATATAAATTTAATAAAAAAAATAGTGTCATATTTATTGAAACACCTTCCTTGTTATTATTATTATTTAGAAAATACGAATTACTTTTTGAATAT
TTGTAAAAAGATGGAATAAGTGAAGTGTTTCGTCCGGTTGTGCAGGAGTCGAAACTCATCCTACCTCACCCTGATGTAAATGAAGATACCACTAGCTATTATCTATCTTTGTTGTTGCAA
ACATGATTATTTTATGTGGATTAGTCATGTTGGCTAATGTTTTTTGATTGTTTTATTTGTTGTAGCAACGCCCTTCAAGTGCTTACAATGCCCCTTTCTGGACAACAAATGCCGGTTTAC
CGGTTTACAACAACACTGCATCATTGACTGTTGGAAATCGAG
GTACGTTATGTTGATACTACAGGATCCGTTATGTTGATCTAATATGTATGTATGAAATAGTGTTGTTAAAGATACACC
ACCTCCAAAAATGTACGCTAAGTCACCTTTCATATCATACTTGTCATATGGAGTATACGGGCTGTATGATTGTCGGTAGTCATATCAGTCATTTTTTGTTGTTGAAAATGATCATATGGG
TTGTATGATTTCACCCTATCATACGGCCCGGACTGTATGACTATCATACGGCCCGGACCGTATGACTATCATACGACCCATATAACCACTTTTCACCGGTATGATACGCTAGTGGTGTTT
GAATAGTGTGTCGATGGTCAAATCAGTCATTTTTTTGTCATTGGTCGTATAACTTGGCTTTCATGGACGACTATCTTTTTGCCCTATATACGTATGACTATCATACGACACATATGATCA
TTTTTTGCTGTATGATAAACTAATAATGTTTGGATAGTGTGTCGGTGGTGTTTGTATAATTCATTTTGAATCCATCATTGTTAGCCTAGAAATGAATATTGTCAGCCTAAAAATGAATAG
AGAGAGAAACAATATTTTGGTCCAAGCTAGTTTTTCATTCATGAATTCTTTTAATTCTTTTAATAGCCATCAAGTAACCTTTTAAATGTTAGTTAATGTTAGTTAATGAATTACAAAAGT
TTACAAACTAGCCCCTCTACTTTTAACAATTGACTAAAACAACTATATTAGTCCTAACATGCATGTTCTTGTCAATCTTCAGGTCCAATTCTCCTTGAGGACTATCATTTGATTGAGAAA
CTTGCCAACTTCACTCGTGAGCGGATCCCCGAACGTATCGTTCATGCGAGGGGTGCGAGCGCAAAGGGGTTCTTCGAGGTCACACACGACATTACTCATCTCACCTGCGCTGACTTCCTC
CGCGCCCCTGGAGTTCAAACTCCTACCATTGTTCGTTTCTCGACTGTTATCCATGAGCGTGGAAGCCCCGAAACCATCCGAGATCCCCGAGGATTTGCAACAAAGTTCTACACCAGAGAA
GTAAACAAGATTCATAAGATTGTTTGATTTTCTTTATCTTTTTTACTCATTTGTGTTTAACTTGTAGGGTAACTTTGACATTGTGGGAAACAATTTCCCCGTGTTCTTTACGCGTGATGC
AATGGCGTTCCCAGACGTGATCCACGCGTTTAAACCAAACCCGAAGTCACACATCCAAGAAGACTGGAGGATTCTTGACTTCTTGTCACACCATCCAGAGAGTTTGAACACCATGACATT
CTGGCTCGATGATGTCGGTATCCCAACCGATTACCGACACATGGAAGGCTCAAGTGTCAACACTCTCACTTTAGTTAACAAAGAAGGAAAAATTCACTATGTGAAGTTCACATGGAAGCC
CACATGTGGAGTCAAATGTTTGATGGACGACGAAGCGATCAAAATCGGAGGCGCGAATCACAGTCACGCCACTCAAGATCTTTACGATTCGATCCAAGCTGGTAACTTCCCTGAATGGAA
GCTGTATCTCCAAGTGATTGACCCTGATCATGAAGATAGGCTTGACTTTGACCCGCTCGATGGCACCATGACCTGGCCCGAGGACATCATACCTTTGCAGCCCGTTGGGCGTATGGTGTT
GAACAAGAACATTGACAACTTCTTTGCTGAAAATGAACAGCTAGCGTTCAACCCGGGTCTTGTTGTTCCTGGGATTTATTACTCTGATGATAAGATGCTTCAAGGGCGTATTTTCGCGTA
CTCTGATACCCAAAGGCACCGTCTCGGACCGAATTACTTGCAGCTCCCTGTCAATGCACCTAAGTGTGCTCATCATAATAATCATTATGATGGAAACATGAACTTCATGCACAGAGATGA
GGAG
GTACACTATTTTGTTTTGTGTACATATTAGTTATTGTTAATTATTAGTTGAGGTTTTTTTGTTTACGCGAGTTAATGTTTTTTTTTTTCAGGTTGATTACTTCCCTTCGAGGTATG
ATCGTGTTCAACATGCTAAGCAGTACCCGATCAATTCCCGTCAAGTTACTGGAACCCGTGACAGG
GTTAGTTTCTTGTATCATTGGTTTGTTTTAGTCTGATGAACCACTTGTTATCAAC
TACTAGAAGGGGAAAACCGGACGGGTTGGGTGATGGGCCACTTGAGTTTGGGCAAAAGGGCCACCTCAATAGTAACCAATACCAAGTAAATGAATGTGTTTGGTTATTTTATTTATTTAT
TTATTTTTTTGTGAATGCAGACTGTGATCCCAAAATACAACGATTTCAAGCAGCCCGGAGACAGATACCGATCATGGGATCCAGCCAGGTATATGTTTTATGTGGTTTGTTTGTTTGTTT
TTTTTTTTTTTTTTAATATTCCATGATGCCATAAATTTGCTAAATTATGTCTGATTTTTCTATAGGCAAGAGAGATTCATTGTCCGAATGTGTAAGATGTTGTCTGACCCAAGGGTAACC
CACGAACTCCGCAGTATTTGGATCTCCTACTGGACCCAG
GTTTGTACACGCTTTCCGTCTTAAGTCTTACACTCTTACTTTCATTCCCACAAAAGAAAACGTTCATCCGTCCCATTATAT
TTACAAAAAAAAAAATACCTCTAGTATAGTTTAGAACTTCAATGCATCGTGTTCTTAATAAGTTTACATCAAATGGAAGAAGTTAAAGCTGGTAAAATGGGTGGGTTGAGTAACGGGTAA
ACAGGCCAATCTAAACATGTGATTTTTTAGTACAAGCCAAAACAGGCTTAAAAACTTTCTTTAGAAATATATGCTGATTTGGTACATTTTGGGTGGTGGTGTTGCAGGCCGACCAGTCTC
TGGGGCAGAAGATAGCATCACGCCTCAATGTGCGCCCCAATTAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCCTACAAGCAACGCCCTTCAAGTGCTTACAATGCCCCTTTCTGGACAACAAATGCCGGTTTACCGGTTTACAACAACACTGCATCATTGACTGTTGGAAATCGAGGTCCAATT
CTCCTTGAGGACTATCATTTGATTGAGAAACTTGCCAACTTCACTCGTGAGCGGATCCCCGAACGTATCGTTCATGCGAGGGGTGCGAGCGCAAAGGGGTTCTTCGAGGTCACACACGAC
ATTACTCATCTCACCTGCGCTGACTTCCTCCGCGCCCCTGGAGTTCAAACTCCTACCATTGTTCGTTTCTCGACTGTTATCCATGAGCGTGGAAGCCCCGAAACCATCCGAGATCCCCGA
GGATTTGCAACAAAGTTCTACACCAGAGAA
GGTAACTTTGACATTGTGGGAAACAATTTCCCCGTGTTCTTTACGCGTGATGCAATGGCGTTCCCAGACGTGATCCACGCGTTTAAACCA
AACCCGAAGTCACACATCCAAGAAGACTGGAGGATTCTTGACTTCTTGTCACACCATCCAGAGAGTTTGAACACCATGACATTCTGGCTCGATGATGTCGGTATCCCAACCGATTACCGA
CACATGGAAGGCTCAAGTGTCAACACTCTCACTTTAGTTAACAAAGAAGGAAAAATTCACTATGTGAAGTTCACATGGAAGCCCACATGTGGAGTCAAATGTTTGATGGACGACGAAGCG
ATCAAAATCGGAGGCGCGAATCACAGTCACGCCACTCAAGATCTTTACGATTCGATCCAAGCTGGTAACTTCCCTGAATGGAAGCTGTATCTCCAAGTGATTGACCCTGATCATGAAGAT
AGGCTTGACTTTGACCCGCTCGATGGCACCATGACCTGGCCCGAGGACATCATACCTTTGCAGCCCGTTGGGCGTATGGTGTTGAACAAGAACATTGACAACTTCTTTGCTGAAAATGAA
CAGCTAGCGTTCAACCCGGGTCTTGTTGTTCCTGGGATTTATTACTCTGATGATAAGATGCTTCAAGGGCGTATTTTCGCGTACTCTGATACCCAAAGGCACCGTCTCGGACCGAATTAC
TTGCAGCTCCCTGTCAATGCACCTAAGTGTGCTCATCATAATAATCATTATGATGGAAACATGAACTTCATGCACAGAGATGAGGAG
GTTGATTACTTCCCTTCGAGGTATGATCGTGTT
CAACATGCTAAGCAGTACCCGATCAATTCCCGTCAAGTTACTGGAACCCGTGACAGG
ACTGTGATCCCAAAATACAACGATTTCAAGCAGCCCGGAGACAGATACCGATCATGGGATCCA
GCCAG
GCAAGAGAGATTCATTGTCCGAATGTGTAAGATGTTGTCTGACCCAAGGGTAACCCACGAACTCCGCAGTATTTGGATCTCCTACTGGACCCAGGCCGACCAGTCTCTGGGGCAG
AAGATAGCATCACGCCTCAATGTGCGCCCCAATTAT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTGATAGCA AGCGGAAAGC TTCTCTCTAC TGTCTTATCT TCACTCTCTA TTCAAGATCA TGGATCCCTA CAAGCAACGC CCTTCAAGTG CTTACAATGC CCCTTTCTGG ACAACAAATG  CCGGTTTACC GGTTTACAAC AACACTGCAT CATTGACTGT TGGAAATCGA GGTCCAATTC TCCTTGAGGA CTATCATTTG ATTGAGAAAC TTGCCAACTT CACTCGTGAG CGGATCCCCG  AACGTATCGT TCATGCGAGG GGTGCGAGCG CAAAGGGGTT CTTCGAGGTC ACACACGACA TTACTCATCT CACCTGCGCT GACTTCCTCC GCGCCCCTGG AGTTCAAACT CCTACCATTG  TTCGTTTCTC GACTGTTATC CATGAGCGTG GAAGCCCCGA AACCATCCGA GATCCCCGAG GATTTGCAAC AAAGTTCTAC ACCAGAGAAG GTAACTTTGA CATTGTGGGA AACAATTTCC  CCGTGTTCTT TACGCGTGAT GCAATGGCGT TCCCAGACGT GATCCACGCG TTTAAACCAA ACCCGAAGTC ACACATCCAA GAAGACTGGA GGATTCTTGA CTTCTTGTCA CACCATCCAG  AGAGTTTGAA CACCATGACA TTCTGGCTCG ATGATGTCGG TATCCCAACC GATTACCGAC ACATGGAAGG CTCAAGTGTC AACACTCTCA CTTTAGTTAA CAAAGAAGGA AAAATTCACT  ATGTGAAGTT CACATGGAAG CCCACATGTG GAGTCAAATG TTTGATGGAC GACGAAGCGA TCAAAATCGG AGGCGCGAAT CACAGTCACG CCACTCAAGA TCTTTACGAT TCGATCCAAG  CTGGTAACTT CCCTGAATGG AAGCTGTATC TCCAAGTGAT TGACCCTGAT CATGAAGATA GGCTTGACTT TGACCCGCTC GATGGCACCA TGACCTGGCC CGAGGACATC ATACCTTTGC  AGCCCGTTGG GCGTATGGTG TTGAACAAGA ACATTGACAA CTTCTTTGCT GAAAATGAAC AGCTAGCGTT CAACCCGGGT CTTGTTGTTC CTGGGATTTA TTACTCTGAT GATAAGATGC  TTCAAGGGCG TATTTTCGCG TACTCTGATA CCCAAAGGCA CCGTCTCGGA CCGAATTACT TGCAGCTCCC TGTCAATGCA CCTAAGTGTG CTCATCATAA TAATCATTAT GATGGAAACA  TGAACTTCAT GCACAGAGAT GAGGAGGTTG ATTACTTCCC TTCGAGGTAT GATCGTGTTC AACATGCTAA GCAGTACCCG ATCAATTCCC GTCAAGTTAC TGGAACCCGT GACAGGACTG  TGATCCCAAA ATACAACGAT TTCAAGCAGC CCGGAGACAG ATACCGATCA TGGGATCCAG CCAGGCAAGA GAGATTCATT GTCCGAATGT GTAAGATGTT GTCTGACCCA AGGGTAACCC  ACGAACTCCG CAGTATTTGG ATCTCCTACT GGACCCAGGC CGACCAGTCT CTGGGGCAGA AGATAGCATC ACGCCTCAAT GTGCGCCCCA ATTATTGAAC ACGGTTATCT TGAGTTTGGG  CCCGATTAAG CTAGATTGAT GATCATGCTA TAGGAGGTCC GTCTCTAAGA TTGTTATGTT ACACAAGCGG TGTTGTATGT ATCAGTCCTA CCTTTCGTCT GTAATATTTT ATCTTTTACT  TAAGGAACCT GAAACTTAGA ATAAGCGCAC ACCTAGATGT GTGAGTCACT GTGTTTCAGG TTCGGGTCTG TAAAGTGAAA GCCTAAACTT TTTTGGCACA CATGTTATGT AAGTTGTTTT  TCTTCAAATG TATTGTTGTT TTTGGCTATC TATTTGATGC TTCTGTTCAT GTATTTCTTG CTATTGATTT GTGTGTTTTA GCTTTAGTTG GGCTGGGCCT TGTTTGAATA TAAATGGGCT  CGGGCTTGGC TCGTGAGTAA CTTGGCATGT ATGAGTTTTG TTTTTGTTGC ATATATATGT ATATGTGGTG GTTCTTTTCT TTATTTTAAT GGGAACAAGA TCCCATGGGC CAAATGTGAG  ATATTTACAG CCACAGGCCC ACAAATGGTT ATTGGCCCAC TCGGAAGTGA CAAGCACAAT GGGAACAAGA TTTCATGGGC CAAATGTGAG ATATTTATAG CATCAGGCCG ATAAATTGTT  ATTGGCCCAC TTGGCATGAC AACTGACAAT GGGAGATCCA TGTTCATCAA TCTGCATTAT CAGACTCAGC CCAGCATGTT GGCCCTTTGA CTAAATGATG GTCAATTCCG TTATCATATG 
GTACGAAATA GCTCTTTTGA AAAAAAAAAA TAATGATTAC AATTTCAAAT TTAATGTTTT CCTGAAATTG ATATGATTTT TGGGGCTGTA TTGGGCCAAA CAAATGGCCC 

Retrieve as FASTA