Entry information : HaAOX03(HanXRQr2_Chr13g0598181 / HanXRQChr13g0411111)
Entry ID 13684
Creation 2016-05-12 (Christophe Dunand)
Last sequence changes 2016-05-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2021-11-25 (Christophe Dunand)
Peroxidase information: HaAOX03(HanXRQr2_Chr13g0598181 / HanXRQChr13g0411111)
Name HaAOX03(HanXRQr2_Chr13g0598181 / HanXRQChr13g0411111)
Class Alternative Oxidase    [Orthogroup: AOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaAOX03
start..stop
S start..stop
HdebAOX03 702 0 1..342 1..342
HargAOX03 646 0 1..342 1..341
HnegAOX03 645 0 1..342 1..342
HargAOX01 568 0 1..342 1..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 138295279..138295629 351 N° 2 138294896..138295024 129 N° 3 138293832..138294320 489 N° 4 138293682..138293738 57
complement(join(138293682..138293738,138293832..138294320,138294896..138295024,1 38295279..138295629))


exon

Literature and cross-references HaAOX03(HanXRQr2_Chr13g0598181 / HanXRQChr13g0411111)
DNA ref. HanXRQ genome:   HanXRQChr13 (138295629..138293682)
Protein sequence: HaAOX03(HanXRQr2_Chr13g0598181 / HanXRQChr13g0411111)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342
PWM (Da):   %s   38123.34 Transmb domain:   %s   i163-185o225-247i
PI (pH):   %s   7.71
Sequence 383
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATRVATTIVRSLTRQTSPRLLSTATGTSPGLVGAEPAVATWWIMSAPVFGARNASTMTLAEKEQKEQKEEAVGGGGGATEAAAGGQKGKEVASYWGVPPSRLTKEDGSEWKWNCFRPWETYEADLSIDLKKHHVPKTFLDKFAYWTVKSLRLPTDIFFQRRYGCRAMMLETVAAVPGMVGGMLLHCKSLRRFEPSGGWIKALLEEAENERMHLMTFMEVAKPKWYERALVFAVQGIFFNAYFVAYLASPKLAHRITGYLEEEAIHSYTEFLKELDAGNIENVKAPAIAIDYWRLPANSTLRDVVMVVRADEAHHRDVNHFASDIHYQGLELKDSPAPIGYH

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCGTGTAGCGACGACTATAGTCCGATCCCTCACTAGACAAACGAGTCCACGTTTATTATCAACCGCCACCGGCACCAGCCCCGGTCTCGTCGGGGCTGAGCCGGCGGTGGCA
ACATGGTGGATTATGTCAGCTCCGGTGTTCGGTGCTCGTAATGCGAGTACAATGACGTTGGCGGAGAAGGAACAGAAAGAGCAGAAGGAAGAGGCGGTGGGTGGTGGTGGTGGTGCAACG
GAGGCAGCCGCTGGTGGTCAGAAAGGTAAAGAGGTGGCGAGTTATTGGGGAGTGCCACCGTCGAGACTTACGAAAGAAGATGGTTCAGAGTGGAAGTGGAATTGTTTTAGG
GTATGTTTA
TTATTGTTTTGTCGCTAATAGCCGTCACAAATAACCACGGGAAGGTTGTAAGTTGGTCGCAAATTCATAGGTTATTTGTCACTGTAATTGGTTGCAAGTCCGTCACAAAATAGATGGGCT
TTTGTCACTATAATTTTGGTCGCAATTTATCGCGAATGGGTATTTGCGACTGAATTTGTGGTCCGAATTGACTAGTTTTTTTTAGTGGTGTATGATATGTTTGCTGATTTGAATTTTAAT
GTCAGCCATGGGAGACGTATGAAGCAGATTTGTCGATTGATCTGAAGAAACATCATGTTCCGAAGACGTTTTTGGACAAATTTGCATATTGGACTGTCAAGTCGCTACGATTGCCTACTG
ATATCTTCTTTCAG
GTCACAAATCACTTTCTTTATAAATTTTACAAGATGATTCATTAGCCACAATCTGAATTAGATACGAGTATAGGTAATTCCAATCTTAAATAATTTAAATATGATA
TTTAATTGTAAAACCGTGTCTTATATTCGGACTAATATTGTCATAACCACTTGCTAGGTGTCGGGTATACCCGTTGGTTTTTAAAAATAATTGGTTAGGATTTTCATTTCTTTTTACCTT
TTTAATTTATATATAGTTTTAATTTTGTTTTAATACCAAGGAAATTAGAAATATAAAAACTAATAATTAGTGAATTAGTAGATTTTTTTATTAAACATTGACAAAGGAAAATCAAATAAA
ATGTTTATGGGCATTTTTGGGTAAACCGGTATGTATGAAAGGGTAATCGAGCTGGGTACCACCTAATCTAAACCCGTCTCATATTTGCGACATTTTTAAAACTAAACCCATGCCCCGGCT
TATACCCGAGTACCCGTACCATTACTTGCCTAGAATGTTTTGCGTTTCGAGTTTGCCATTCGTGTTACCCTAATGTGAATTTTGATGACATTCGATTTGATAATAACAGAGGCGATATGG
ATGTCGAGCAATGATGCTCGAAACAGTGGCTGCGGTTCCCGGAATGGTGGGAGGAATGCTGCTTCACTGTAAATCACTGCGGCGGTTCGAGCCAAGTGGCGGGTGGATCAAAGCTCTGTT
AGAAGAAGCCGAGAACGAAAGAATGCACCTAATGACTTTCATGGAGGTTGCAAAGCCAAAATGGTACGAACGAGCGCTTGTTTTCGCGGTCCAAGGCATCTTCTTCAATGCCTACTTTGT
TGCATACCTTGCTTCCCCTAAACTAGCTCACCGGATCACCGGGTACCTTGAGGAAGAAGCAATCCACTCGTACACCGAGTTCTTGAAGGAGCTTGATGCTGGAAACATAGAAAATGTCAA
GGCGCCCGCCATTGCTATTGACTATTGGCGTCTTCCTGCTAATTCAACGCTTCGCGATGTTGTGATGGTTGTGAGAGCGGACGAAGCTCATCATCGCGACGTTAATCACTTTGCTTCG
GT
AATTGTTACATTGTTTTTTTTTTTTTTTTGTGTGTGTGTGTGTGTTTTGTTGAATGGAAGTTGGTGACATTTTGGATTGAATATGTTGCAGGATATACATTATCAAGGACTTGAGCTTAA
AGATTCACCAGCTCCAATTGGATATCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCGTGTAGCGACGACTATAGTCCGATCCCTCACTAGACAAACGAGTCCACGTTTATTATCAACCGCCACCGGCACCAGCCCCGGTCTCGTCGGGGCTGAGCCGGCGGTGGCA
ACATGGTGGATTATGTCAGCTCCGGTGTTCGGTGCTCGTAATGCGAGTACAATGACGTTGGCGGAGAAGGAACAGAAAGAGCAGAAGGAAGAGGCGGTGGGTGGTGGTGGTGGTGCAACG
GAGGCAGCCGCTGGTGGTCAGAAAGGTAAAGAGGTGGCGAGTTATTGGGGAGTGCCACCGTCGAGACTTACGAAAGAAGATGGTTCAGAGTGGAAGTGGAATTGTTTTAGG
CCATGGGAG
ACGTATGAAGCAGATTTGTCGATTGATCTGAAGAAACATCATGTTCCGAAGACGTTTTTGGACAAATTTGCATATTGGACTGTCAAGTCGCTACGATTGCCTACTGATATCTTCTTTCAG
AGGCGATATGGATGTCGAGCAATGATGCTCGAAACAGTGGCTGCGGTTCCCGGAATGGTGGGAGGAATGCTGCTTCACTGTAAATCACTGCGGCGGTTCGAGCCAAGTGGCGGGTGGATC
AAAGCTCTGTTAGAAGAAGCCGAGAACGAAAGAATGCACCTAATGACTTTCATGGAGGTTGCAAAGCCAAAATGGTACGAACGAGCGCTTGTTTTCGCGGTCCAAGGCATCTTCTTCAAT
GCCTACTTTGTTGCATACCTTGCTTCCCCTAAACTAGCTCACCGGATCACCGGGTACCTTGAGGAAGAAGCAATCCACTCGTACACCGAGTTCTTGAAGGAGCTTGATGCTGGAAACATA
GAAAATGTCAAGGCGCCCGCCATTGCTATTGACTATTGGCGTCTTCCTGCTAATTCAACGCTTCGCGATGTTGTGATGGTTGTGAGAGCGGACGAAGCTCATCATCGCGACGTTAATCAC
TTTGCTTCG
GATATACATTATCAAGGACTTGAGCTTAAAGATTCACCAGCTCCAATTGGATATCA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACATATACAA AATATTTCAC GCCAATAAAC ACCCATTTAT CCCATCCCCA TTTTCTTGGT GTCCAAAATC TCTCACTGTA GCAACCGCCA GCAAAAATGG CTACTCGTGT AGCGACGACT  ATAGTCCGAT CCCTCACTAG ACAAACGAGT CCACGTTTAT TATCAACCGC CACCGGCACC AGCCCCGGTC TCGTCGGGGC TGAGCCGGCG GTGGCAACAT GGTGGATTAT GTCAGCTCCG  GTGTTCGGTG CTCGTAATGC GAGTACAATG ACGTTGGCGG AGAAGGAACA GAAAGAGCAG AAGGAAGAGG CGGTGGGTGG TGGTGGTGGT GCAACGGAGG CAGCCGCTGG TGGTCAGAAA  GGTAAAGAGG TGGCGAGTTA TTGGGGAGTG CCACCGTCGA GACTTACGAA AGAAGATGGT TCAGAGTGGA AGTGGAATTG TTTTAGGCCA TGGGAGACGT ATGAAGCAGA TTTGTCGATT  GATCTGAAGA AACATCATGT TCCGAAGACG TTTTTGGACA AATTTGCATA TTGGACTGTC AAGTCGCTAC GATTGCCTAC TGATATCTTC TTTCAGAGGC GATATGGATG TCGAGCAATG  ATGCTCGAAA CAGTGGCTGC GGTTCCCGGA ATGGTGGGAG GAATGCTGCT TCACTGTAAA TCACTGCGGC GGTTCGAGCC AAGTGGCGGG TGGATCAAAG CTCTGTTAGA AGAAGCCGAG  AACGAAAGAA TGCACCTAAT GACTTTCATG GAGGTTGCAA AGCCAAAATG GTACGAACGA GCGCTTGTTT TCGCGGTCCA AGGCATCTTC TTCAATGCCT ACTTTGTTGC ATACCTTGCT  TCCCCTAAAC TAGCTCACCG GATCACCGGG TACCTTGAGG AAGAAGCAAT CCACTCGTAC ACCGAGTTCT TGAAGGAGCT TGATGCTGGA AACATAGAAA ATGTCAAGGC GCCCGCCATT  GCTATTGACT ATTGGCGTCT TCCTGCTAAT TCAACGCTTC GCGATGTTGT GATGGTTGTG AGAGCGGACG AAGCTCATCA TCGCGACGTT AATCACTTTG CTTCGGATAT ACATTATCAA  GGACTTGAGC TTAAAGATTC ACCAGCTCCA ATTGGATATC ACTGAAGTAT ATGCTCTATG ATGGCTTGGG ACTTTGGGTA CCCATTGTCA AAACATACTT GTATATATTT AATGATTACA  TATGTACGTT GTTTGGTACT CGTCGGTAAG AAAATATTTT TGTGTTCGTT CGTCTAATAG ATAAAGGAAC ATACAAGAAA AGAAATATAA AATGATTAGC AAATAGTCTA CAAAATATGA  AGTTCAAATA TACAAAACAT TTATTTTCTT AATTATACGG TTGTTCTTGA AGGAACTTGT ACGTTAATGG CTTAAGAGCA TTCACATTCT ATCCACCAAA TCTTGAGAGA GATGTTTTTA 
AATTATAAAA AGTGGTTTAA GTGGTTGTGA GTGGAGGAGA GAGA 

Retrieve as FASTA