Entry information : HaFer03 (HanXRQChr14g0459361)
Entry ID 13699
Creation 2016-05-12 (Christophe Dunand)
Last sequence changes 2016-05-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaFer03 (HanXRQChr14g0459361)
Name (synonym) HaFer03 (HanXRQChr14g0459361)
Class Ferritin    [Orthogroup: Fer001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaFer03
start..stop
S start..stop
HaFer06 428 2e-154 1..246 1..245
HaFer01 413 1e-148 1..243 1..241
HaFer02 407 2e-146 1..246 1..251
LeFer01 392 4e-140 1..247 1..257
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 167095315..167095583 269 N° 2 167095988..167096071 84 N° 3 167096169..167096229 61 N° 4 167096365..167096452 88
N° 5 167096541..167096602 62 N° 6 167096724..167096789 66 N° 7 167096891..167096954 64 N° 8 167097049..167097095 47
join(167095315..167095583,167095988..167096071,167096169..167096229,167096365..1 67096452,167096541..167096602,167096724..167096789,167096891..167096954,16709704 9..167097095)


exon

Literature and cross-references HaFer03 (HanXRQChr14g0459361)
DNA ref. HanXRQ genome:   HanXRQChr14 (167095315..167097095)
Protein sequence: HaFer03 (HanXRQChr14g0459361)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   247
PWM (Da):   %s   27350.99  
PI (pH):   %s   5.65
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLLRAPPTIFLRTGSGENFSGTLISSAPSTIVCAAAKGGSSNSKPITGVVFEPFEEVKKELNLVPTVPQQSLARQKYADESEAAINEQINVEYNVSYVYHAMYAYFDRDNVALKGLAKFFKESSEEEREHAEKLMEYNKRGGKVKLQSILMPLSEFDHAEKGDALYAMELALSLEKLTNEKLLHLHVANKKNDVQLADFVESEFLGEQVEAIKKISEYVAQLRRVGKGHGVWHFDQALLNDGAA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCTCAGAGCTCCACCGACTATCTTCTTGCGGACCGGCTCCGGCGAGAACTTCAGTGGAACTCTGATCTCATCGGCTCCCTCGACCATCGTTTGCGCAGCGGCCAAAGGCGGTTCT
TCCAACAGTAAGCCGATCACAGGCGTTGTGTTTGAACCGTTTGAAGAAGTCAAAAAGGAGCTCAATCTTGTCCCTACGGTTCCTCAACAGTCTCTTGCTCGTCAAAAGTACGCTGATGAA
TCCGAAGCCGCCATCAATGAACAGATCAA
GTAGTTTTTCTTACTCTCAATTTCTCATTTTTGTTCCTTCTGTTTATTAATTTTGTTATTAGGTTAAGTCATAAGTGACTGTTTATTGACT
TTGTGTTTATATGTTATAATTGAAACCTTATTAGTTTGGTATTGGAATTTTAACGTGAGTTTAGAATGCACAGTAGGTGTTTGATGAAATGATTAGGAGAACATAAGGTCTAGTTATATG
TGTATATGATTAGGGCTTGCTGTACATGATGTTTGATACATTTTTCTGTATTTAATTGTCTTATGTTTATCAGTTTGATTGGGACTGAACTTTTTTTTAATTCATTTTTAAGTTTTGTAT
ACATTTGTTAAAGGATTGATGGTGACTTTGTTCTTATTTTTATGATATATTTCTGTTTTCTGTTTGTTTTCAGTGTTGAGTACAATGTTTCATACGTGTACCATGCTATGTATGCCTACT
TTGATAGGGACAATGTTGCTCTCAAGGGGTTAGCCAA
GTAAGTTACTAAAATCGTTGTCATTTTTATAAATAAACTTGTACTAACAATCGGTGGGACGGTGTTTGATCCGGCTATGCTAC
ATGAATACGTGTAGATTCTTTAAGGAGTCCAGTGAAGAAGAAAGGGAACATGCGGAGAAGCTTATGGAATACCAGGTGTTTGATAATTTCCCTATAAATAGCAGTCTTTGTGCTTTGTGT
TTCGTTATATGCTTGAGAACTTGATGCGTAGACTATTTGATCGTCACTGATTAAAATCGTCGAAATTTCTGTAAAACTTTCTGTTTTCAGAACAAACGTGGTGGGAAGGTGAAGCTGCAA
TCTATTTTAATGCCCTTGTCAGAGTTTGATCATGCTGAGAAAGGAGACGCACTATATG
GTAAGTTCTTTGTTAATTGCTTGGTTCGGTAAATTTTTTCAACTATTTTGGATTGAATGATT
ATGGTTTTACTTCTTTGTTCTTGTAGCAATGGAGCTTGCATTGTCATTGGAGAAACTAACAAATGAGAAACTTCTACACTTGCACGCGGTATGACAATACTTTTTTTGCATTTTTTTGTA
TGCCCGCCAGTAAACCTGTTAATGGCTACTAATTAGGTGAAGATAAGGTTGGATTTGTGTTTCTGAATTGTGACATTTGATGAGAACAGGTGGCCAACAAGAAGAATGATGTGCAATTAG
CTGATTTTGTTGAAAGCGAATTCTTGGGTGAACAG
GTAGAATTATTGATTTCACTTTATATATTCTGATTCGATAAAGTGGTTATCTTTTCTCCTTTTTAAAAGGGGAGATTGATAGTAT
TTTCACTTTGTTAAAGGTTGAGGCGATTAAAAAGATATCTGAATATGTTGCTCAACTGAGAAGAGTCGGCAAAGGACATGGTATATTTAGTGCTTAACATTTTTTATTTAAAGTTTGAGG
CATCATCGATATACCATATGATCGCTAAAGGTAGTAATTTTCTTGAAATATCAGGAGTTTGGCATTTTGATCAAGCGCTTCTTAACGATGGTGCTGCTGTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTTCTCAGAGCTCCACCGACTATCTTCTTGCGGACCGGCTCCGGCGAGAACTTCAGTGGAACTCTGATCTCATCGGCTCCCTCGACCATCGTTTGCGCAGCGGCCAAAGGCGGTTCT
TCCAACAGTAAGCCGATCACAGGCGTTGTGTTTGAACCGTTTGAAGAAGTCAAAAAGGAGCTCAATCTTGTCCCTACGGTTCCTCAACAGTCTCTTGCTCGTCAAAAGTACGCTGATGAA
TCCGAAGCCGCCATCAATGAACAGATCAA
TGTTGAGTACAATGTTTCATACGTGTACCATGCTATGTATGCCTACTTTGATAGGGACAATGTTGCTCTCAAGGGGTTAGCCAAATTCTTT
AAGGAGTCCAGTGAAGAAGAAAGGGAACATGCGGAGAAGCTTATGGAATACCAG
AACAAACGTGGTGGGAAGGTGAAGCTGCAATCTATTTTAATGCCCTTGTCAGAGTTTGATCATGCT
GAGAAAGGAGACGCACTATATG
CAATGGAGCTTGCATTGTCATTGGAGAAACTAACAAATGAGAAACTTCTACACTTGCACGCGGTGGCCAACAAGAAGAATGATGTGCAATTAGCTGAT
TTTGTTGAAAGCGAATTCTTGGGTGAACAG
GTTGAGGCGATTAAAAAGATATCTGAATATGTTGCTCAACTGAGAAGAGTCGGCAAAGGACATGGAGTTTGGCATTTTGATCAAGCGCTT
CTTAACGATGGTGCTGCTGTT

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCACTTATCA GTCAAAACTG TTATCCGTTT CCGTTGTTTC CCCCTTTTCC ACTCTCTCTC TCTCTCTCTC TCTTACTTTC TCTCTCTAAA AACCATGCTT CTCAGAGCTC CACCGACTAT  CTTCTTGCGG ACCGGCTCCG GCGAGAACTT CAGTGGAACT CTGATCTCAT CGGCTCCCTC GACCATCGTT TGCGCAGCGG CCAAAGGCGG TTCTTCCAAC AGTAAGCCGA TCACAGGCGT  TGTGTTTGAA CCGTTTGAAG AAGTCAAAAA GGAGCTCAAT CTTGTCCCTA CGGTTCCTCA ACAGTCTCTT GCTCGTCAAA AGTACGCTGA TGAATCCGAA GCCGCCATCA ATGAACAGAT  CAATGTTGAG TACAATGTTT CATACGTGTA CCATGCTATG TATGCCTACT TTGATAGGGA CAATGTTGCT CTCAAGGGGT TAGCCAAATT CTTTAAGGAG TCCAGTGAAG AAGAAAGGGA  ACATGCGGAG AAGCTTATGG AATACCAGAA CAAACGTGGT GGGAAGGTGA AGCTGCAATC TATTTTAATG CCCTTGTCAG AGTTTGATCA TGCTGAGAAA GGAGACGCAC TATATGCAAT  GGAGCTTGCA TTGTCATTGG AGAAACTAAC AAATGAGAAA CTTCTACACT TGCACGCGGT GGCCAACAAG AAGAATGATG TGCAATTAGC TGATTTTGTT GAAAGCGAAT TCTTGGGTGA  ACAGGTTGAG GCGATTAAAA AGATATCTGA ATATGTTGCT CAACTGAGAA GAGTCGGCAA AGGACATGGA GTTTGGCATT TTGATCAAGC GCTTCTTAAC GATGGTGCTG CTGTTTGAAC  AATTATGAAG GTTTTTTGGG GTTGTTTCGG ATGAGGGATT AGTTGCTATT AACATTTTGG TTTGTTCTAC ACCAGAATTG CAATATGGAG ACTGTATAGT TCTTTATTTC CCTAAATGCT  TTGATAATCT TGACGCTATT TTGGTTCAAT TGTAAGAACG CCAGATTTGG GTTCGTAATC TGTGGTTATA TATTGGAATT TGAATAATAT GAACCATGAA AATTGAGGCT TATGTATCAT  GGTCAGGCTT ATGTAACATT ATTGGTTTGT TCTACACCAG AATTTCAATA AAGAATAGGT ATTAAAACAG GTTCACCCGT TATATTCACA TTTATTGTGG TAGTGGGATG GATGGCAACA 
GTGTTGGCGG TGATAGCGA 

Retrieve as FASTA