Entry information : CsPrx62 (orange1.1g018871m/orange1.1t02044)
Entry ID 1372
Creation 2007-02-14 (Christophe Dunand)
Last sequence changes 2011-07-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx62 (orange1.1g018871m/orange1.1t02044)
Name (synonym) CsPrx62 (orange1.1g018871m/orange1.1t02044)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue types Ovaries
Seedlings
Shoot meristems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx62
start..stop
S start..stop
CclPrx02 709 0 1..349 1..349
CppPrx02 679 0 10..349 1..340
CclPrx20 662 0 1..349 1..349
CsPrx53 662 0 1..349 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53184..53399 216 N° 2 54173..54364 192 N° 3 55126..55294 169 N° 4 55549..56021 473
join(53184..53399,54173..54364,55126..55294,55549..56021)


exon

Literature and cross-references CsPrx62 (orange1.1g018871m/orange1.1t02044)
Literature Close,T.J., Roose,M.L., Ye,X.R., Fenton,R.D., Wanamaker,S., Kim ,H.R., Kudrna,D., Stum,D., Wissotski,M. and Wing,R. Development of EST Resources and New Genetic Markers for California Citrus - Washington Navel Orange Callus - UCRCS08-1.
DNA ref. Citrus sinensis Annotation Project:   chrUn (32247294..32250519) Phytozome 12:   scaffold00043 (53184..56021)
EST ref. GenBank:   CV715519.1 [5' end]   CN182316.1 [3' end]
Cluster/Prediction ref. UniGene:   Csi.9504
Protein sequence: CsPrx62 (orange1.1g018871m/orange1.1t02044)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (324)
PWM (Da):   %s   37800.02 (35080.5)  
PI (pH):   %s   7.68 (7.68) Peptide Signal:   %s   cut: 26 range:26-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRYLLAAALLVAFVLEGSPSQAQLSPSFYSSTCPNVLNTIEDVLKKAFSSDIRIGASLIRLHFHDCFVDGCDASILLDSTNTIDSEKFAAPNNNSARGFEVIDNMKAAVERACPRVVSCADILTIAAERSVALSGGPSWAVPLGRRDSRTANRALANQNLPGPFDTLDELKSSFRNVGLNDKLDLVALSGAHTFGRAQCQFFRGRLYDFNNTGKPDPTLDATFLQQLRKLCPQGGNGGVLANFDVTTPDVFDNKYFSNLRGRKGLLQSDQELFSTPGADTAAIVEDFGRNQNAFFKNFVTSMIRMGNLKPLTGNQGEIRLNCRRVNGNSNIATRSSSSEGDLVSSF*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 44 ESTs (probable mix of sequences).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTCGCAGCAGCTCTTCTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACACTATCGAGGATGTGCTTAAGAAAGCTTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GTAAGCAATCTCTGCTCTCTCATT
TTTCATATTCTTTACTTTATCAAGCTCTCTGTCCATGTACTTACTGATATAACATAGTTTCAAGTATGTCAATGAACAGTATCTTTATAATTTTTATGGCATTAAACAAAATATAGAGTT
TTCATAAAGCCTAAGGAAGAGTTTGAATATATCATTTTATGTTCAACAACTTCCAAAACCATTTATATATATTTTCTCTTTTATCTGTCTGCTACTCATTGCATTCTTCTTCTGACCGCA
TATTCATGCACGTAGAGATCCTCACCCCCAACCCCAAGCTAAAAGATCTGATTTTTTCGCTTCAGCCGTACAACAAAACTTTCCTCTCTAATTTGGATGTACCGAAGACCATGTAATTCT
TTTTTATAAATAAATTTAATATGGGGTTTTCATGCACTAAAAATTTTAATCTAGTAAAGATTTGGTCCAAAACAGGAATTAAAATCCATCTCATGGCCTCACCCCTGCTGAGTGCTTTTA
ATGATCATGGGTCCAATATTAATGGTGTATGGTTGAAAATAAATCACACTTGTTTTATATTCTTCCAGCCGAAAATTTAAATCAACAGGAAATCCTAGTCATAAAAACATATGTAATAAT
AAGACAATTTAAACAAGAAGAGTTTGCATTATTTATATAATTTTTTTGAATTCCTGTCCATAAGATAAGAAGGAATCTATCTACTTGTAAAACTAACAATACAATGGACTGTTAACATAG
CAAGTTGTTAATTAATATTATTTTTTCAGGGGTGTGATGCATCGATTTTGCTGGACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAACAATTCGGCGAGGGGTTTTG
AAGTTATTGATAACATGAAAGCTGCCGTTGAAAGGGCATGTCCAAGGGTTGTTTCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
GTAATGAATTTCTATTACC
AACTCCTCTTCCTGGTTAATATTTTACGCTTAGAAGTAAATTAATATGGGTATCAGAATAAGTTAAGAGAATAATGGTAAACCTTTGCAGTATTAATGTAATTTTTAACTATTTTTTTCA
ATTAATAATAACCCCTATAAATTTAACGTGTTTTTATATTATTTTTTCAGTTAATTAAATAACCCGTGAGTTCAACTTTACCCTTAGAAGAATACATTAATTAAATAATTATTTACATAG
AACAATGTGCAAGATCTGGGTCCACATGTTTAGCCTTTGCTAGTTTTTTTGACAAAATTGTCTATGTTTAGCCTTTACTAGCCTTTGCTAGTTATTGCATCTGCTATTCAACGACAAAAT
TGTCCCACCATGTGGAAATTGATTTAAGTGAAGGGATTCATCCTTGGACCCATCATTTTTAAATTCGGACGATGTGGTGGACTCCATTATTTAAAAGGGGTGATTTATTGACTATGGTGC
ATTAGCTACACTGTATGGTACCAAAATTGCTACACGTATGGCAATATAGTGAATATTGACGGATAAATTGTTACCGACAGCGAGACACTTTTTACTGCGCTGGTGCATCGTAGTAGCAAG
GCCTTAGTTTTAAACTTAAAAGTTTTCTTCTTTTGTTATACGACAAAGTTTTGATTCAACGGCTAGCAAATTAAATAGTCCGCCCCAAACGCACATCTCTTAAGATTATTGCTGATTTTG
AGTGAATGGCTCTTGGTTACAGTCAGGGGGTCCGTCATGGGCAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAATCAGAATCTTCCAGGACCATTTGATAC
TCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTCAATGACAAGCTTGATCTTGTTGCACTCTCCG
GTAATTATTAATTGCTTCTACATCCTTTTAGTTACTTGAGTAAAGTTAT
GAGAGTAAACTTTTAGGAGTCAAAACTGCCTGCTACTAGTAACTCATACTCAAAAGTTAATTCACGAAATGAGTGTTGGTGCCTTAAATTTATATTTACTTAACTCCAAATTTAAATAAT
ATCCCTAACAATAAAATTATCATTATTGTTCCTCGTATGTGAATTCAGTAAAAATAACAAAGATTTGGTCATGCATGTTTTTCAGGAGCACACACGTTCGGAAGGGCTCAGTGCCAATTT
TTCAGGGGCAGATTATACGATTTTAACAACACTGGCAAGCCAGACCCAACCCTAGACGCAACCTTCTTACAACAACTGAGGAAACTATGCCCACAAGGTGGAAACGGCGGCGTTCTTGCT
AATTTTGATGTCACGACACCTGATGTTTTCGACAACAAATACTTCTCCAATCTTAGAGGCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTGTTTTCGACTCCTGGTGCCGATACCGCT
GCCATTGTCGAGGACTTTGGGAGGAACCAGAATGCTTTCTTTAAAAACTTTGTGACCTCAATGATAAGAATGGGAAATTTGAAACCACTGACAGGAAATCAAGGGGAGATTAGATTGAAC
TGCAGGAGGGTCAATGGAAACAGTAATATTGCAACAAGATCATCATCATCAGAGGGTGATTTGGTCAGCTCTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTCGCAGCAGCTCTTCTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACACTATCGAGGATGTGCTTAAGAAAGCTTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GGGTGTGATGCATCGATTTTGCTG
GACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAACAATTCGGCGAGGGGTTTTGAAGTTATTGATAACATGAAAGCTGCCGTTGAAAGGGCATGTCCAAGGGTTGTT
TCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
TCAGGGGGTCCGTCATGGGCAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAAT
CAGAATCTTCCAGGACCATTTGATACTCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTCAATGACAAGCTTGATCTTGTTGCACTCTCCG
GAGCACACACGTTCGGAAGGGCT
CAGTGCCAATTTTTCAGGGGCAGATTATACGATTTTAACAACACTGGCAAGCCAGACCCAACCCTAGACGCAACCTTCTTACAACAACTGAGGAAACTATGCCCACAAGGTGGAAACGGC
GGCGTTCTTGCTAATTTTGATGTCACGACACCTGATGTTTTCGACAACAAATACTTCTCCAATCTTAGAGGCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTGTTTTCGACTCCTGGT
GCCGATACCGCTGCCATTGTCGAGGACTTTGGGAGGAACCAGAATGCTTTCTTTAAAAACTTTGTGACCTCAATGATAAGAATGGGAAATTTGAAACCACTGACAGGAAATCAAGGGGAG
ATTAGATTGAACTGCAGGAGGGTCAATGGAAACAGTAATATTGCAACAAGATCATCATCATCAGAGGGTGATTTGGTCAGCTCTTTCTAA

Retrieve as FASTA