Entry information : CsPrx53 (orange1.1g018855m)
Entry ID 1378
Creation 2007-09-04 (Christophe Dunand)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx53 (orange1.1g018855m)
Name (synonym) CsPrx53 (orange1.1g018855m)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue types Callus
Flowers
Fruits
Ovaries
Roots
Seedlings
Shoot meristems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx53
start..stop
S start..stop
CclPrx20 709 0 1..349 1..349
CppPrx03 668 0 12..349 1..337
CppPrx02 645 0 10..349 1..340
CsPrx62 635 0 16..349 16..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16351..16566 216 N° 2 17232..17423 192 N° 3 18133..18301 169 N° 4 18556..19028 473
join(16351..16566,17232..17423,18133..18301,18556..19028)


exon

Literature and cross-references CsPrx53 (orange1.1g018855m)
Literature Sputnik team.
Bausher,M., et al., An expressed sequence tag (EST) set from Citrus sinensis L. Osbeck whole seedlings and the implications of further perennial source investigations Plant Sci. 165, 415-422 (2003).
DNA ref. Phytozome 12:   scaffold00043 (16351..19028)
EST ref. GenBank:   CX673104 [5' end]   CX673103 [3' end]
Cluster/Prediction ref. UniGene:   Csi.5050
Protein sequence: CsPrx53 (orange1.1g018855m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (324)
PWM (Da):   %s   37777.18 (35218.8)  
PI (pH):   %s   8.39 (8.40) Peptide Signal:   %s   cut: 26 range:26-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRYLLAAALVVAFVLEGSPSQAQLSPSFYSSTCPNVLNIIEDVLKKAFSSDIRIGASLIRLHFHDCFVDGCDASILLDSTNTIDSEKFAAPNNNSARGFEVIDNMKAAVEKACRRVVSCADILTIAAERSVALSGGPSWAVPLGRRDSRTANRALANQNLPGPSNSLDELKSSFRNVGLNDKFDLVALSGAHTFGRAQCKFFSDRLYDFNKTGKPDPTVDRTLLKQLRELCPQGGNGAVLANFDVKTPDAFDNKYFSNLRLRKGLLQSDQELFSTPGADTAAIVEDFGRNQTAFFKNFVISMIRMGNLKPLTGNQGEIRLNCRRVNGNNNIATRSSSSEGDLVSSF

Retrieve as FASTA  
Remarks Complete sequence from genomic and 44 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTTGCAGCAGCTCTTGTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACATTATCGAGGATGTGCTTAAGAAAGCGTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GTAAGCAATCTCTGCTCTCTCATT
TTTCATCTTCTTTACTTTATCAAGCTCTCTGTCTATGTACTTACTGATATAACATAGTTTCAAGTATATCAATGAACAGTATCTTTATAATTTTTATGGCATTAAACAAAATATAGAGTT
TTCAGTAAGAGTTTGAATATATCATTTTAATTTCAACAACTTCCAAAACCATTTTTATTTATCTTTTTTCTTTCTCTTTACAACAAATTTTTCCTCTCTAATTCGATGTACCGAGGACCA
TGTAATTCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCATGTACTAGAAATTTAAATCTAGCAAAGATTTGGTACAAAACAGGAAATAAAATCCACCTCATGGCCTCATCCCTGCT
GAGTTCTTTTAATGATCATGGGTCCAATATTAATGGTGTATGGTTGAAAAAAAATCACACTTGTTTTATATTCTTCCAACTGAGAAATTTAAATCAACTGGAAATCCTAGTCTTAAAAAC
ATATGTAATAATAAGACAATTTAAATAAGAAGAGTTTGCATTATTTATATAATTTTTTTGAATTCCTGTCCATAAGATAAGAAGGAATCTATCTACTTGAAAAAGTAATAATACAATGGA
CTGTTAACATAGCAAGTTGTTAATTAATATTATTTTTTCAGGGGTGTGATGCTTCGATTTTGCTGGACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAATAATTCGG
CGAGGGGTTTTGAAGTTATTGATAACATGAAAGCTGCCGTTGAAAAGGCATGTCGAAGGGTTGTTTCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
GTAATGA
ATTTCTATTACCAACTCCTCTTCCCAGTAAATATTTTACGCTTAGAAGTAAATTAATATGGGTATCAGAATAAGCGAACAGAATAATGATAAATCTTTGTAGTATTAATGTAGTGTTTAA
CTATTTTTTTAATTAATAATAACCCATATAAATTTAACGTGTTTTTATATTATTTTTTTCAGTTAATTAAATATCCCGTAAGTTCAACTTTATCCTTAGAAGAATATATTAATTAAATAA
TTATTCACATAGAACAATGTGCAAGATCTGAGTCCACATGTTTAGCCTTTGCTAGTTATTGCATCTGCTATTCAACGACAAAATTGCCCCACCATGTGGAAATTGATTTAAGTGAAGGGA
TTCATCGTTGGACCGATCATTTTTAGATTCGGACGACGTGGTGGACTCCATTATTTAAAAGGGGTGACTTATTGACTATGGTGCATCAGCTACACTGTATGGTACCAAAATTGCTACAAG
TATGTCAATATAGTGATTATCAACGGATAAATTGTTACCGACAGTGAGACACTTTTTACTGCGCTGGTGTATCGTAGCAAGGCCTTAGTTTTAAAATTAAAAGTTTTCTTCTTTTGTTAT
ACGACAAAGTTTGATTCAACGGCTAGCAAATTAAATAGTCCGCCCCAAACACACATCTCTTAAGATTATTGCTGATTTTGAGTGAATGGCTTTTGGTTACAGTCAGGGGGTCCGTCATGG
GCAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAATCAGAATCTTCCAGGACCATCTAATTCTCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTC
AATGACAAGTTTGATCTTGTTGCACTCTCCG
GTAATTATTAATTGCTTCTACATCCTTTTAGTTACTTGAGTAAAGTTACGAGAGTAAACTTTTAGGAGTCAAAACTGCCTGCTAATAGT
AACTCATACTCAAAAATTAATTTAAGAAATGAGTGTTGGTGCCTTAAATTTATATTTACTTAACTCAAAATTTAAATAATATCCCTAACAATAAAATTATCATTATTGTTCCTCGTATGT
GAATTCAGTAAAAATAACAAAGGTTTGGTCATGCATGTTTTTCAGGAGCTCACACGTTTGGAAGGGCTCAGTGCAAATTTTTCAGTGACAGATTATACGATTTCAACAAAACTGGCAAGC
CAGACCCAACAGTGGACAGAACCCTCTTAAAGCAACTGAGGGAACTATGCCCACAGGGTGGAAACGGCGCCGTTCTTGCTAATTTTGATGTCAAAACACCTGATGCTTTCGACAACAAAT
ACTTCTCCAATCTTAGACTCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTGTTTTCGACTCCTGGTGCCGATACCGCTGCCATTGTCGAGGACTTTGGGAGGAACCAGACTGCTTTCT
TTAAAAACTTTGTGATCTCAATGATAAGAATGGGCAATTTGAAACCACTGACAGGAAATCAAGGGGAGATTAGATTGAACTGCAGGAGGGTCAATGGAAACAATAATATTGCAACAAGAT
CATCATCATCGGAGGGTGATTTGGTCAGCTCTTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTCGTTATCTTCTTGCAGCAGCTCTTGTTGTTGCTTTTGTGCTTGAGGGATCACCATCTCAAGCTCAACTTTCTCCATCTTTTTATTCTTCCACATGCCCTAATGTATTG
AACATTATCGAGGATGTGCTTAAGAAAGCGTTCTCGTCCGATATCCGGATCGGTGCCAGCCTCATCAGGCTTCATTTCCATGACTGTTTTGTTGAT
GGGTGTGATGCTTCGATTTTGCTG
GACAGCACTAACACCATAGACAGCGAGAAATTTGCTGCGCCAAATAATAATTCGGCGAGGGGTTTTGAAGTTATTGATAACATGAAAGCTGCCGTTGAAAAGGCATGTCGAAGGGTTGTT
TCCTGCGCTGATATTCTTACTATTGCGGCTGAACGATCCGTTGCTTTG
TCAGGGGGTCCGTCATGGGCAGTTCCATTGGGAAGAAGAGACAGCAGAACGGCAAACAGAGCTCTTGCAAAT
CAGAATCTTCCAGGACCATCTAATTCTCTTGATGAGCTCAAATCTAGTTTTAGAAATGTTGGCCTCAATGACAAGTTTGATCTTGTTGCACTCTCCG
GAGCTCACACGTTTGGAAGGGCT
CAGTGCAAATTTTTCAGTGACAGATTATACGATTTCAACAAAACTGGCAAGCCAGACCCAACAGTGGACAGAACCCTCTTAAAGCAACTGAGGGAACTATGCCCACAGGGTGGAAACGGC
GCCGTTCTTGCTAATTTTGATGTCAAAACACCTGATGCTTTCGACAACAAATACTTCTCCAATCTTAGACTCCGCAAAGGCCTTCTGCAGAGTGATCAAGAGTTGTTTTCGACTCCTGGT
GCCGATACCGCTGCCATTGTCGAGGACTTTGGGAGGAACCAGACTGCTTTCTTTAAAAACTTTGTGATCTCAATGATAAGAATGGGCAATTTGAAACCACTGACAGGAAATCAAGGGGAG
ATTAGATTGAACTGCAGGAGGGTCAATGGAAACAATAATATTGCAACAAGATCATCATCATCGGAGGGTGATTTGGTCAGCTCTTTCTAA

Retrieve as FASTA