Entry information : HaRboh09 (HanXRQChr08g0228981)
Entry ID 13786
Creation 2016-06-01 (Christophe Dunand)
Last sequence changes 2016-06-01 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaRboh09 (HanXRQChr08g0228981)
Name (synonym) HaRboh09 (HanXRQChr08g0228981)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaRboh09
start..stop
S start..stop
HaRboh01 1090 0 14..862 7..917
HaRboh10 1072 0 1..862 6..928
HaRboh04 1014 0 4..862 57..930
NtRboh04_BelW3 991 0 71..862 123..938
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 96777260..96777665 406 N° 2 96778252..96778414 163 N° 3 96778509..96778557 49 N° 4 96779758..96779871 114
N° 5 96779953..96780333 381 N° 6 96781135..96781584 450 N° 7 96781702..96781797 96 N° 8 96782264..96782385 122
N° 9 96782477..96782579 103 N° 10 96782669..96782730 62 N° 11 96783375..96783910 536 N° 12 96784437..96784543 107
join(96777260..96777665,96778252..96778414,96778509..96778557,96779758..96779871 ,96779953..96780333,96781135..96781584,96781702..96781797,96782264..96782385,967 82477..96782579,96782669..96782730,96783375..96783910,96784437..96784543)


exon

Literature and cross-references HaRboh09 (HanXRQChr08g0228981)
DNA ref. HanXRQ genome:   HanXRQChr08 (96777260..96784543)
Cluster/Prediction ref. HanXRQ:   HanXRQChr08g0228981
Protein sequence: HaRboh09 (HanXRQChr08g0228981)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   862
PWM (Da):   %s   97565.41 Transmb domain:   %s   i288-307o367-389i427-446o491-513i
PI (pH):   %s   9.03
Sequence 903
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDADDGRSVLPENNNHDHHHSDKAAVGSGPVNKTGGWKTVQLSVLGGAKAGSSSEGVTKTVNVAEVGKRLSRIQDVAKKLMYLNASSKQPILNGFNFSGKNNDPEAAWIALEKRFDELTMKTGGLLPSSSFGKCIGMNTDSDKFAEDLFKSLCQRRGITSDPINKTLFKEFWEEISNQSFDSRLKIYLAMIDKDNDGKITEEEIMEIIKASASANKLPTIEKDAEKYAAFIKEKLDPEKLGYIMIDKLEKLLKDAATRNDIGETHDSSESSRQQFKLTQFLHDNWKRCWVVVLWIGIMVGLFTWKYIQYKHRAVYDVLGPCVCIAKGAAETLKLNMAIMLLPVCRNTITWLRNKTKLGAVVPFDDNINFHQVIAVAIAIGVGLHAISHLACDFPRLIHATEEEYKPMQQYFGDQAENYWHFVKEVEGYTGIIMLVLMIIAFTLAWLRKGLKLPSLTRFKAFKNSKSYNSIVKKLTGPIAAINKLTGFNIFWYSHHLFVIVYALLIVHGIKLYLTKEWYKKTTWMYLAVPILLYACERLKRTFRSRFDPAKILKVAAYPGRDGVLALRMRKPENFNYKSGEYMFVKCDAVSPFEWHPFSITSAPSDDYLSVHIRALGDWTKKINKIYSEACLPDEGSEIRKADFPEQIPNNLRVLKIDGPYGAPAQDYKDYEVVLLVGLGIGATPMVSVVKDIVNNIKAKEEKQNALEDGTISQKNKLSPTREHEFKTKRAYFYWSTKGQNTLGWFKDVMDEVAEIGKNDVIQIHNYCTSVYEEADARSSLITMLQSLYYDEKGVDIVSGTRVKTHFARPNWQKVYKRIADTHKGSKIGVFYCGSPVVIKELKELALEFTDSSTTFEFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATGCCGATGATGGAAGAAGTGTGTTACCTGAAAATAACAACCATGATCATCACCACTCCGACAAAGCGGCTGTTGGAAGTGGTCCAGTGAACAAAACCGGTGGCTGGAAAACTGTCC
AGCTTAGTGTTCTTGGAGGCGCTAAGGCCGGAAGTAGCAGCGAAGGTGTGACCAAGACGGTCAATGTAGCTGAAGTAGGGAAGAGATTATCGAGAATCCAAGATGTGGCGAAAAAGTTGA
TGTATTTGAATGCCTCCTCAAAACAACCCATACTCAATGGATTCAACTTTAGTGGCAAGAACAACGATCCGGAAGCAGCGTGGATCGCCTTGGAAAAGCGATTTGATGAACTCACTATGA
AAACTGGTGGCTTACTTCCAAGTTCAAGCTTCGGTAAATGCATAG
GTAACACAAAATTCATAGCTTGTTCTTTATTTTCTTGATTCATAATAACAATGGGTTTTGTCCTCTTAAAAACTT
CTTAAACATTTTGGGCACTATTTCCTTATACCAATAATGATCCTTTAAATGGAAGACAATAGTTTGGTTCAATTAATTCTAATAAATTGTATGGACATTTTACCTTAAAAATAAAAGAAA
TATCAGCTCACCAACGCCTCTTATCGATCTGGTCTCTCACTCGCGGTCACTTCTCCCCCCTCCCTCTTCCTTCAACGCCACCAGGTTTGAGAGGGGCGTCAAAACCATGGTTTTTAGCGG
AAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGGAGGAAGAGGAGGAGGAGGTACGGAGAAAGAATATAGGGATAATATTTTTAATCTCTTAATATAAAAGAGTTAATGTTACTTTTT
TTTCTTACAACAATTTGTTACACCTATATTCCACCTAATGTTGCATTTGAAAGAACACTAGCAAAACCACATGAACATTACTCTTTTTGTAAGTTTGGATTACAATAATTTTACTAATGA
GTTTCATTGTTTTATTTTTTGAATTTGATAGGAATGAACACAGATTCAGACAAGTTCGCAGAAGATTTGTTTAAATCACTTTGCCAACGTAGAGGTATAACCAGTGATCCGATTAACAAA
ACACTATTTAAGGAATTTTGGGAAGAAATTTCTAATCAGAGCTTTGATTCAAGGCTAAAGATTTACCTGGCAAT
GTGAGTATATTAAAATTTTTTGTTTAATAATCATAGTTAATTCATA
TTTTTTTTTTTTGAGGGAAATTTACGTTGAGAAATATAATAAATACAGGATTGATAAAGATAACGACGGTAAGATCACAGAAGAAGAAATCATGGAGGTATGTATTAGGAAATAAATATT
TATTTTATAGGTGTTTCGGAATACAAGAAAGTTGGTTGTAAGAAAACGTGTTTGAGAAGTTGTTCAAAGTTTTCAAAGTTTTGATTAATAAGTTATTGTTTAAGGTTTTGAAAAAATCTA
AGTAGTTGATTATTTACATGTAAAATAACCTAATATGTAATAAAAAAATTAAATTCCACATATTTAAAAATGTTAATATCAGATTAGGTACGATGGGCCAAGAAGTGCTTAAAGAGTGGT
TATGATACGGACATAAAGTATTACATAACATGGTAATTTTGAATATAATTTGAAATTAGGGGGAGATTCATTTGAGAAGAATCTTCTTATAAAAAGAAAAATAAATTAATTTAGGCCATT
TATTTTTTTGATCAATGGTTTTGAATCAAGATATAATTATTGTGAACTTTTAATTAATGATTTAATTAATAAGGGCAGGGTAGACATTTTGACTTAGAATATTAATTTTTTTTTTGAACA
ACAAATTTGGAATTTAGAATATTAATAAATGTTATAAAGAGTTACTCAATTATTATTAATGCCATAATAATTTTCTCTTTCACTACTATTAATGTGTTGGTCCTACACCAATTAGAAGTG
ACAAAATTTTTTAAAAGTGTTGTGTTCTACACATATTTTATTTTATTATGAGTCAACAAATTATTTAAAAGTGTTGGGGTCCTACACATTCTCTACCTTACACCAAAACATTGTTTTTAT
GGTGTAGTAAACGTTGAATATGTAAGAACATGTATATGATTGTTTTTATTGTGTAAGGTGCAAAATTATTTTATAGGATGACTTATTAAATGATTAAGGTTCATTAATTTGAATAACAAA
AATAAATGATAAGCTTATTAAATGATTTGTTCTAATTACCTTTGTATCCTTTATTCTTTTTATTCTTAATTTATAATTTCTTTTTATTTGAACTCTCCACTTTGAAATTATTTTTTTAAA
GGGTACATTTCAGAATTCTAGTAATACATAAAGGACAAAAAGTGTAATTTACTCTATTTATATACTACAGTATTAATCAACTATATGTGTTAAAGTATATGAGAATAACTACAAACAAAA
ACCAAGTTAAATCATATCTCGTAAGTATAATAAAGATTATTATAATACATTTTTTTAATGCTAACAATTATTCACAATTGATGCACATGTGATGCAGATTATCAAGGCAAGTGCATCAGC
CAACAAGTTACCAACTATTGAAAAGGATGCAGAAAAATATGCAGCATTCATCAAGGAAAAGTTAGACCCGGAAAAACTCGGTTATATCATG
GTACAACTTTAGATTACACAACACCACTG
GTTATAGTTTGGTAGGAAATATATTAGTGATCAAAGCTTAATGTTTAAACAGATTGACAAGTTGGAGAAGTTATTAAAAGATGCAGCAACACGTAACGATATAGGAGAAACACATGACTC
AAGCGAATCGTCTAGACAACAGTTCAAACTAACACAATTTTTACATGATAATTGGAAGAGATGTTGGGTGGTTGTACTTTGGATAGGAATAATGGTTGGTTTGTTTACGTGGAAGTACAT
TCAATACAAACACCGAGCTGTATATGATGTGTTAGGGCCGTGTGTATGTATAGCGAAAGGTGCAGCTGAGACTTTAAAACTAAACATGGCGATTATGTTATTACCTGTTTGTCGGAACAC
AATTACTTGGTTGAGGAACAAGACTAAGTTGGGTGCCGTGGTTCCGTTCGATGACAATATTAATTTCCACCAA
GTAAGTCAATATTATCACATTTGAAACATGTCTTGCTTAATTAGTTC
TAAACGAGCTGGACCTTCACTAAATTGTTCGGCGAGAACTTCTTTATATTTTTTTTCTTTAGTAAACGAACAAACACGAACAACCTTTTTTTGTTTAGTTAACTACATGAACAAAAATAA
ACATATGTCTTTTGTTTAGTTCGTTCATTTATTTTCATTTACGTTTATTTGTTACTTAATTGATCGATTGTACATTAGCCCATTAGCTCATGAACCTAATCAAATTTTGAACCTAGCTTT
AAGGAATAAAGTGTTCAGCTTTAGGTTGGTTTTGTTTTCTTTTTGCATTAGTAAGTGAATATTGGTATAGAGTTTAACTTATTGGATATTGTTTGCTTAATTTAAAATGTTGCATATTGT
GGAACCATATGATGATGATTGTATTCATACTTGAAAATTGATAATATTGTTTATCTTTAAATTGTGATCGTCTTTCTTCATTTGTGTTTGTGAACCATTCAAAATATGCCCGTTCTAATG
TCCGTGTCGTGTTTACTTGGAATATCTACGAACTAACATAAAGGTACACAACCACGTTCATTTTTTTCTTGACGAACGAACAGTAAAAAAATATTTGTTCATTTATGTGTTTGTTCATTT
ATTGTTTGTTCGGTTAATGAACGTGAACAAGCTCAGGCTTGTGTTCATTTGGTTTGTCTATAGGTCTAATGTTGGTTACTAAATTTGGAAAGTTTAAAATGTTTTATTGTAATTTCAAGT
CAAATATACGTTTTTTGTTGTTACTATGTTATAGGTGATTGCAGTGGCGATCGCGATTGGAGTTGGGTTACACGCGATTTCCCATTTAGCATGCGACTTTCCCCGATTAATCCACGCAAC
TGAGGAAGAGTATAAACCGATGCAACAATATTTTGGGGATCAAGCGGAAAATTATTGGCATTTTGTAAAGGAAGTAGAAGGGTACACGGGAATAATAATGCTAGTACTAATGATTATAGC
TTTTACACTAGCATGGCTAAGAAAAGGCCTCAAACTACCCTCATTAACAAGATTTAAGGCATTCAAGAACTCAAAGTCGTATAATTCCATCGTAAAGAAATTAACAGGACCTATTGCTGC
TATTAACAAATTAACGGGATTTAATATCTTTTGGTACTCCCACCACCTCTTTGTTATCGTCTACGCACTGCTTATAGTTCACGGGATTAAACTTTATCTCACCAAGGAATGGTACAAGAA
AACG
GTTAGTTCCTTTATGTTATCTCATTTTATAATACCTTTTTTTATATATTAGCTTGATGTAATGTCTTAGTACTAGGTATTCGTAATCTTTAAAGTAAATTATGCCTTACGGATGCA
GACTTGGATGTATTTGGCGGTTCCAATCTTGCTCTACGCTTGCGAGAGACTGAAAAGGACATTTCGATCTCGTTTTGATCCAGCCAAGATACTTAAGGTATAATGTTTATTTTTTTCTAA
GCGGTCTAGCAAAGTCATTGGCGTTTTCATAAGGTTTCTGAACTTGTTTTGGTTTCAAGGGAGTTTGCTACTTAAAACCGTAGACTTAATTTGAGTCAACTAGTCAAAGGAGTAGACTTT
TTTTTTTTTTTTTTTTGAGATTTGACAAGTCAACATATTCACATGAATATCGGGTGTTAGATTTTTTTTTTAAAAAGTAGAAACCAAAACACTTACATAAGCCTCCTAGAAATAGAAAGG
TCTATACTATTATATGCACATGATCTTTTTTAGTAGAAAAATAAACACTTCCACAAAACCTCCTAGAAATAGACAGGTCTCCAATCTTACACACACATGCGTTTTGGACATCTTACTTTA
GCATACGTACGGGTCCATTTAGTTGTGTTTTATCATTGACACATAAGATAAAGACATATCTTAAGATATCGGTTCTGTTAAAGGTGGCTGCTTATCCTGGTCGTGACGGGGTATTGGCAC
TTCGAATGAGGAAGCCTGAAAACTTTAATTACAAGAGTGGAGAATACATGTTTGTCAAGTGTGATGCTGTCTCCCCATTTGAATG
GTTTGTTTACATTAAAAGAATTGAAAACAATATAT
AAATTATGTAATAGTACAATTAAGTAACTTAACACTTGATACATGTTAATTAACAGGCACCCATTTTCCATTACATCTGCCCCAAGTGATGACTACCTGAGTGTGCATATCCGGGCTCTT
GGTGATTGGACTAAAAAAATTAACAAAATCTATTCAGAG
GTATATATGCAACCATTGTTTACTGCTTATAGTCCATGTTGTTAGTTAATTATTATATCACTTAACATGTGAATTTTCATC
TTCGGTAGGCCTGTTTGCCTGATGAAGGAAGTGAGATTCGTAAAGCTGATTTTCCGGAACAAATTCCGAAGTAAGTAGAGTATGTCTGTTTCTAGATTCACATCATATAGTAAGAAGGAT
GGTTTGAGCAACAAACCAAAATGAGCTTGGGATTGTCATCTTTTTCGTTCGGGTAAAAATAGTCGATCACGCCAATCCTAAAAACGCTTTTGTCTCGTTTAAGGCAACTAACTTGTTACT
AATGGTTAAACACAATACTATCTCAATATATTATATATTAAAAACTTATTTATTCCCTAAACTGCAAACATATATCTAACATGCAAAATGTTTTATATTCTAAATTCATGTATTTAAAAC
ATATTAAGAACTTTATATTTTAAGAGAATTGAATATGATTCTTTTGCACGTTTAGAGCCGGGGATACGAAATTCACGTTTAGAATCTTTAAGTGCATTTGGGTTAAAAGTAAAGAATTGA
GTGTGTTAAACGCATACAATCTCTTAAATCATTTTAATTGATGATAGTAATTAGTGGTTGGTTATTCATAAACATAACAAACCCTTTCGAAATCTAGAAAAAAGTTTAAGATGAATGAAG
CAAAGATGTTTGCGGGTCAATTCTAAGAATATAACTTGTTTCAACCCGAATCCATTTTGATCCAAAGATTTAAACATATATGTATTTGAATAACTTGATCAATCTTTTTTACAGTAACCT
AAGAGTTCTAAAAATTGACGGTCCATACGGTGCACCCGCACAAGACTACAAAGATTACGAAGTGGTGTTGCTAGTGGGCTTAGGCATTGGAGCAACTCCAATGGTCAGTGTTGTGAAAGA
TATTGTGAATAACATTAAAGCCAAAGAAGAAAAACAAAATGCATTGGAAGATGGTACAATATCACAAAAGAACAAACTTAGTCCAACAAGAGAACATGAGTTTAAAACAAAAAGGGCTTA
CTTCTATTGGTCCACTAAGGGACAGAATACGTTGGGTTGGTTTAAAGATGTTATGGATGAGGTTGCTGAGATAGGCAAAAATGATGTCATACAGATTCACAATTATTGCACAAGTGTTTA
CGAGGAAGCAGATGCGCGATCGTCTTTAATTACTATGCTTCAGTCACTCTATTATGATGAAAAGGGTGTTGATATTGTATCTGGTACCCGTGTGAAGACTCATTTTGCTAGACCGAATTG
GCAGAAAGTTTACAAAAGAATTGCGGATACTCACAAAGGTTCCAAAATAG
GTTAGTCCTGCTAACTCGTTCTAACTTTAATTCTTTTCGTTATACTTGAATATTCATATAAAGCATAGCT
GGCACAACGGACGGGTTCGGTTAAAACATGTCGCGAGTAATGCATACGGATCATGATGAGCTCGGTTAGGCTGGCATGGTTTCAATTAATTCTTTTGTCAGTTTTAAAGTTTTATAATGC
CCTAAATGTTATTACAAAAACAATAATCTTTGAATAAAAAATTTGATTTAGTTGGAAATTGTATTGGTTAATATTTACATTCAAAACTTTAGATATAAGTTAACTACAGTATCCGTTCTC
ATTAGCTCATCAAGTAACATGTTTTAGTTGCGTTTTGTCGCAAATTGTTATAATACTATAAAATAATGAAAAACCGAGTTATTTTAATTGTGTCATGAATACGCGTTAACGACCTATGGC
TGGTGATGGCTCTAAAGGGGTGGTTTTGCTAGAACAGGTGATATATAATGTCGATCATGTGATGTTTTCTAACTTTCATATCATTATAATTCGCAGGGGTTTTCTATTGTGGATCACCAG
TAGTAATAAAAGAGCTAAAAGAATTAGCTTTAGAATTCACTGATTCATCAACCACGTTTGAGTTTCACAAAGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATGCCGATGATGGAAGAAGTGTGTTACCTGAAAATAACAACCATGATCATCACCACTCCGACAAAGCGGCTGTTGGAAGTGGTCCAGTGAACAAAACCGGTGGCTGGAAAACTGTCC
AGCTTAGTGTTCTTGGAGGCGCTAAGGCCGGAAGTAGCAGCGAAGGTGTGACCAAGACGGTCAATGTAGCTGAAGTAGGGAAGAGATTATCGAGAATCCAAGATGTGGCGAAAAAGTTGA
TGTATTTGAATGCCTCCTCAAAACAACCCATACTCAATGGATTCAACTTTAGTGGCAAGAACAACGATCCGGAAGCAGCGTGGATCGCCTTGGAAAAGCGATTTGATGAACTCACTATGA
AAACTGGTGGCTTACTTCCAAGTTCAAGCTTCGGTAAATGCATAG
GAATGAACACAGATTCAGACAAGTTCGCAGAAGATTTGTTTAAATCACTTTGCCAACGTAGAGGTATAACCAGTG
ATCCGATTAACAAAACACTATTTAAGGAATTTTGGGAAGAAATTTCTAATCAGAGCTTTGATTCAAGGCTAAAGATTTACCTGGCAAT
GATTGATAAAGATAACGACGGTAAGATCACAG
AAGAAGAAATCATGGAG
ATTATCAAGGCAAGTGCATCAGCCAACAAGTTACCAACTATTGAAAAGGATGCAGAAAAATATGCAGCATTCATCAAGGAAAAGTTAGACCCGGAAAAACTCG
GTTATATCATG
ATTGACAAGTTGGAGAAGTTATTAAAAGATGCAGCAACACGTAACGATATAGGAGAAACACATGACTCAAGCGAATCGTCTAGACAACAGTTCAAACTAACACAATTTT
TACATGATAATTGGAAGAGATGTTGGGTGGTTGTACTTTGGATAGGAATAATGGTTGGTTTGTTTACGTGGAAGTACATTCAATACAAACACCGAGCTGTATATGATGTGTTAGGGCCGT
GTGTATGTATAGCGAAAGGTGCAGCTGAGACTTTAAAACTAAACATGGCGATTATGTTATTACCTGTTTGTCGGAACACAATTACTTGGTTGAGGAACAAGACTAAGTTGGGTGCCGTGG
TTCCGTTCGATGACAATATTAATTTCCACCAA
GTGATTGCAGTGGCGATCGCGATTGGAGTTGGGTTACACGCGATTTCCCATTTAGCATGCGACTTTCCCCGATTAATCCACGCAACTG
AGGAAGAGTATAAACCGATGCAACAATATTTTGGGGATCAAGCGGAAAATTATTGGCATTTTGTAAAGGAAGTAGAAGGGTACACGGGAATAATAATGCTAGTACTAATGATTATAGCTT
TTACACTAGCATGGCTAAGAAAAGGCCTCAAACTACCCTCATTAACAAGATTTAAGGCATTCAAGAACTCAAAGTCGTATAATTCCATCGTAAAGAAATTAACAGGACCTATTGCTGCTA
TTAACAAATTAACGGGATTTAATATCTTTTGGTACTCCCACCACCTCTTTGTTATCGTCTACGCACTGCTTATAGTTCACGGGATTAAACTTTATCTCACCAAGGAATGGTACAAGAAAA
CG
ACTTGGATGTATTTGGCGGTTCCAATCTTGCTCTACGCTTGCGAGAGACTGAAAAGGACATTTCGATCTCGTTTTGATCCAGCCAAGATACTTAAGGTGGCTGCTTATCCTGGTCGTG
ACGGGGTATTGGCACTTCGAATGAGGAAGCCTGAAAACTTTAATTACAAGAGTGGAGAATACATGTTTGTCAAGTGTGATGCTGTCTCCCCATTTGAATG
GCACCCATTTTCCATTACAT
CTGCCCCAAGTGATGACTACCTGAGTGTGCATATCCGGGCTCTTGGTGATTGGACTAAAAAAATTAACAAAATCTATTCAGAG
GCCTGTTTGCCTGATGAAGGAAGTGAGATTCGTAAAG
CTGATTTTCCGGAACAAATTCCGAA
TAACCTAAGAGTTCTAAAAATTGACGGTCCATACGGTGCACCCGCACAAGACTACAAAGATTACGAAGTGGTGTTGCTAGTGGGCTTAGGCATTG
GAGCAACTCCAATGGTCAGTGTTGTGAAAGATATTGTGAATAACATTAAAGCCAAAGAAGAAAAACAAAATGCATTGGAAGATGGTACAATATCACAAAAGAACAAACTTAGTCCAACAA
GAGAACATGAGTTTAAAACAAAAAGGGCTTACTTCTATTGGTCCACTAAGGGACAGAATACGTTGGGTTGGTTTAAAGATGTTATGGATGAGGTTGCTGAGATAGGCAAAAATGATGTCA
TACAGATTCACAATTATTGCACAAGTGTTTACGAGGAAGCAGATGCGCGATCGTCTTTAATTACTATGCTTCAGTCACTCTATTATGATGAAAAGGGTGTTGATATTGTATCTGGTACCC
GTGTGAAGACTCATTTTGCTAGACCGAATTGGCAGAAAGTTTACAAAAGAATTGCGGATACTCACAAAGGTTCCAAAATAG
GGGTTTTCTATTGTGGATCACCAGTAGTAATAAAAGAGC
TAAAAGAATTAGCTTTAGAATTCACTGATTCATCAACCACGTTTGAGTTTCACAAAGAGAATTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCGTTGACT TGCTTAATCC TAATGAGCTT TCACACTCCA TATAAGTGGG TGCCTTCTCT ATATAATTCC ACCATTGTTC TTCACATTTT TTTAAAAAAC ATCCACCCTT TCTTAAAATA  AAATTCAGTT CATTTGGTTG GTTAGTTTTG GGTGAAAAGG CATAAGATGG ATGCCGATGA TGGAAGAAGT GTGTTACCTG AAAATAACAA CCATGATCAT CACCACTCCG ACAAAGCGGC  TGTTGGAAGT GGTCCAGTGA ACAAAACCGG TGGCTGGAAA ACTGTCCAGC TTAGTGTTCT TGGAGGCGCT AAGGCCGGAA GTAGCAGCGA AGGTGTGACC AAGACGGTCA ATGTAGCTGA  AGTAGGGAAG AGATTATCGA GAATCCAAGA TGTGGCGAAA AAGTTGATGT ATTTGAATGC CTCCTCAAAA CAACCCATAC TCAATGGATT CAACTTTAGT GGCAAGAACA ACGATCCGGA  AGCAGCGTGG ATCGCCTTGG AAAAGCGATT TGATGAACTC ACTATGAAAA CTGGTGGCTT ACTTCCAAGT TCAAGCTTCG GTAAATGCAT AGGAATGAAC ACAGATTCAG ACAAGTTCGC  AGAAGATTTG TTTAAATCAC TTTGCCAACG TAGAGGTATA ACCAGTGATC CGATTAACAA AACACTATTT AAGGAATTTT GGGAAGAAAT TTCTAATCAG AGCTTTGATT CAAGGCTAAA  GATTTACCTG GCAATGATTG ATAAAGATAA CGACGGTAAG ATCACAGAAG AAGAAATCAT GGAGATTATC AAGGCAAGTG CATCAGCCAA CAAGTTACCA ACTATTGAAA AGGATGCAGA  AAAATATGCA GCATTCATCA AGGAAAAGTT AGACCCGGAA AAACTCGGTT ATATCATGAT TGACAAGTTG GAGAAGTTAT TAAAAGATGC AGCAACACGT AACGATATAG GAGAAACACA  TGACTCAAGC GAATCGTCTA GACAACAGTT CAAACTAACA CAATTTTTAC ATGATAATTG GAAGAGATGT TGGGTGGTTG TACTTTGGAT AGGAATAATG GTTGGTTTGT TTACGTGGAA  GTACATTCAA TACAAACACC GAGCTGTATA TGATGTGTTA GGGCCGTGTG TATGTATAGC GAAAGGTGCA GCTGAGACTT TAAAACTAAA CATGGCGATT ATGTTATTAC CTGTTTGTCG  GAACACAATT ACTTGGTTGA GGAACAAGAC TAAGTTGGGT GCCGTGGTTC CGTTCGATGA CAATATTAAT TTCCACCAAG TGATTGCAGT GGCGATCGCG ATTGGAGTTG GGTTACACGC  GATTTCCCAT TTAGCATGCG ACTTTCCCCG ATTAATCCAC GCAACTGAGG AAGAGTATAA ACCGATGCAA CAATATTTTG GGGATCAAGC GGAAAATTAT TGGCATTTTG TAAAGGAAGT  AGAAGGGTAC ACGGGAATAA TAATGCTAGT ACTAATGATT ATAGCTTTTA CACTAGCATG GCTAAGAAAA GGCCTCAAAC TACCCTCATT AACAAGATTT AAGGCATTCA AGAACTCAAA  GTCGTATAAT TCCATCGTAA AGAAATTAAC AGGACCTATT GCTGCTATTA ACAAATTAAC GGGATTTAAT ATCTTTTGGT ACTCCCACCA CCTCTTTGTT ATCGTCTACG CACTGCTTAT  AGTTCACGGG ATTAAACTTT ATCTCACCAA GGAATGGTAC AAGAAAACGA CTTGGATGTA TTTGGCGGTT CCAATCTTGC TCTACGCTTG CGAGAGACTG AAAAGGACAT TTCGATCTCG  TTTTGATCCA GCCAAGATAC TTAAGGTGGC TGCTTATCCT GGTCGTGACG GGGTATTGGC ACTTCGAATG AGGAAGCCTG AAAACTTTAA TTACAAGAGT GGAGAATACA TGTTTGTCAA  GTGTGATGCT GTCTCCCCAT TTGAATGGCA CCCATTTTCC ATTACATCTG CCCCAAGTGA TGACTACCTG AGTGTGCATA TCCGGGCTCT TGGTGATTGG ACTAAAAAAA TTAACAAAAT  CTATTCAGAG GCCTGTTTGC CTGATGAAGG AAGTGAGATT CGTAAAGCTG ATTTTCCGGA ACAAATTCCG AATAACCTAA GAGTTCTAAA AATTGACGGT CCATACGGTG CACCCGCACA  AGACTACAAA GATTACGAAG TGGTGTTGCT AGTGGGCTTA GGCATTGGAG CAACTCCAAT GGTCAGTGTT GTGAAAGATA TTGTGAATAA CATTAAAGCC AAAGAAGAAA AACAAAATGC  ATTGGAAGAT GGTACAATAT CACAAAAGAA CAAACTTAGT CCAACAAGAG AACATGAGTT TAAAACAAAA AGGGCTTACT TCTATTGGTC CACTAAGGGA CAGAATACGT TGGGTTGGTT  TAAAGATGTT ATGGATGAGG TTGCTGAGAT AGGCAAAAAT GATGTCATAC AGATTCACAA TTATTGCACA AGTGTTTACG AGGAAGCAGA TGCGCGATCG TCTTTAATTA CTATGCTTCA  GTCACTCTAT TATGATGAAA AGGGTGTTGA TATTGTATCT GGTACCCGTG TGAAGACTCA TTTTGCTAGA CCGAATTGGC AGAAAGTTTA CAAAAGAATT GCGGATACTC ACAAAGGTTC  CAAAATAGGG GTTTTCTATT GTGGATCACC AGTAGTAATA AAAGAGCTAA AAGAATTAGC TTTAGAATTC ACTGATTCAT CAACCACGTT TGAGTTTCAC AAAGAGAATT TCTAAGAAAA  CTTTCCTTTC TGCCCTTCAA GAAAGAATTT CTAATATTTT ATGTTTTGTG TTTTTTATGC ATATATCCTT ATATAGTATC AGAGTTGTAA ATTAATGATT GAAGACATCC ATGATTGTTG  TCATCCCTCA ATCATGCTGG TTAGTTTGTT GTAAAATTAA GTAAATTTAA TTTATTCAAT TAAACCTTAA TTTCTTGTTG AAAAATGTTT ATGATCTTTT ATACACGTGG GTGACAAGTA  CATTTCTTTT AAAATTTTGA AATGCAGATG CATTCATTGT ATGCAAACAG GGGATGAGAA ACCATTCGAA AGTAGGCAAT TCTAATCAAA GTAGGCCATT CGAAACCAAA AGTCACATAA 
AAA 

Retrieve as FASTA