Entry information : KflGPx01 (kfl00030_0370)
Entry ID 13855
Creation 2016-08-23 (Christophe Dunand)
Last sequence changes 2016-08-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-08-23 (Christophe Dunand)
Peroxidase information: KflGPx01 (kfl00030_0370)
Name (synonym) KflGPx01 (kfl00030_0370)
Class Plant glutathione peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflGPx01
start..stop
S start..stop
HaGPx02 161 4e-50 26..189 40..206
StGPx02 150 2e-46 26..184 3..164
SmGPx02-2_57 150 3e-46 29..184 7..166
LuGPx220 152 3e-46 26..184 74..235
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 259736..259894 159 N° 2 260219..260274 56 N° 3 260892..260992 101 N° 4 261408..261508 101
N° 5 262085..262129 45 N° 6 262709..262924 216  
join(259736..259894,260219..260274,260892..260992,261408..261508,262085..262129, 262709..262924)


exon

Literature and cross-references KflGPx01 (kfl00030_0370)
Protein sequence: KflGPx01 (kfl00030_0370)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   225
PWM (Da):   %s   25294.72  
PI (pH):   %s   9.4
Sequence 266
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTAMGCSASTAAASQPAPRSPKRKLEKLPKSFHALKVPDIRGNVIDFATFKGKVVLVINVASRCGHAMKNYREMVGLYKRYGGPEFEIIAVPCNQFFNQEPGSNEDIEDFVRKQGGEFMVAGKCNVNGQNMSPLYRYLKKYCKDHGAVGWNFTKYLISKSGEIVERYGYKIYPYSFERDIVRLLDGDYSNRPPLPRYDDEPLCVNNILFNRPTMQQILTAGPSNF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACCGCCATGGGGTGCAGTGCGAGCACAGCGGCGGCATCGCAGCCGGCACCTCGGTCTCCCAAGAGGAAGCTAGAAAAGCTTCCAAAATCGTTTCATGCCCTCAAAGTTCCTGACATCC
GTGGGAATGTCATTGACTTTGCAACTTTCAAGGGGAAG
GTAAGTCGGGTCGCTAGAAACGACATCCCGTGCTTGAGTTGATGATGCCACTATGGTGGATGAATGTGCAAGCTAGTGTGAG
TTACCTGCGCTTCGGTATATGTTCTGAATTTGGCTACGTTCTTGGCATCCATAGGAATGCGACTTTCCGCACTGCGGGATTGGATCATGTCAGAGACGACAACGTTACAACGTAAAACCA
CACTGTATGTGGTCAGATTTGAGGGTACCACTCCAGTTGTTTCAGCGGCTGCTCTGAATGACAGCATCTGCTTGATTGTGGAGGATAAAGGCTGTCTGTGACCTGGCTTGATGCAACTGC
AGGTCGTCCTGGTCATCAATGTGGCAAGTCGATGTGGCCACGCGATGAAGAATTACAGGTAAGTCAACAGCACCTCAATAGACGTACGAAGCCTAGCTGACGCTTGTAAAGTGTTTGCAG
TTCGTTACTCTCGTAACAGCTTTGGAAGAACAACTGAAACAATGGCTTTAATCTCAATAGTGATCTCATTCAAACTTACTAGTGCTTCATTTGTCAATCCTCGTATGTGCAGTGGCTTGC
ATTGTTGCTCTCATTATCTAAGTACACTCTCCATTTGTTGTGAATTCTGATTAGTTCTGGTAAGAGTTGCTCTTCCTCAATCTCGTTCCCTAGCTTGAGTCCACGAAGCAGTAAAGGTTG
TGTCAGGTTAGCTATGGATAGGATTTAGCTCAAAAAAGAAAGAACATTCTGATATGGCAACTCCCAAAACCTGCCACGTTGCAACCTTCTGATCGACCGCTGGGACCCGATTCAAACGCA
CATGATTTTCAAGAAAGATCATAGGTAGCCACGATAATAATAAACTCCGACTAATACTAAAACCCTAACTCAAAAAGTTACCTGCTCCGCACCCATACCCACCATAACCACCAAACTAAC
CTACCCGTCCCAGTGCGGTTACCTTACTATTACCTCGGCTTATTTATAATCTATTTTGAGAATTATCAAACGCAGGGAGATGGTCGGGCTGTACAAGCGGTATGGCGGGCCCGAGTTCGA
GATCATTGCAGTGCCGTGCAACCAGTTTTTCAACCAAGAGCCGGGCTCAAACGAAG
GTCGGTCACCTTGACAGCTTCTAACGCTTACTCACATGCTCAATCATGATCGATTGAAAGTCGC
ACCGTAAGAGATCTACGATTTCAGTTTATCTGGATCTGCTGGTCCGAGGACTCCGTTTCGTTACCAATTCCTCATTGTTCCAAGAGTAAGTCAAGTGGCCAATACTTTTGAATAGCGCGG
TCTCCACTCTGAGCAGCAAAAAGACGAAACGGAAGCCGGCTTTGACAAAATTCAGCTAAAGAACGAAACGCTTGTGAAAGGGTCAGTTGTTTGATTGCTGACCATGAGCCTTAGTGAACG
GCGGCTTTCTCCTGTGGAAGTCCCTCGCAACCTACGATGCTTTGTCCACTGGAAAACCGACAGCTTATGTTTTGGTCTGTTCATTAAGCACTTCCTTCCTCTGAAATGCAGATATTGAGG
ATTTTGTACGAAAGCAAGGGGGAGAGTTCATGGTCGCAGGGAAGTGCAACGTCAATGGTCAGAACATGAGCCCCCTGTACCGGTACTTGAAG
GTACGTACCAGGAAGAGGGACCCCGCTG
CATCAGTTTATTGCTTGGCTTTCGACTCCCATCTTTAGCTTTGGAATAAGATTAGTGGCTCGAAGAAATCTTACTGGATGAATTACGGAGGCTGGCAGCAAAGCTGGACTTTGCTCGATC
AGCCTCTGCGCTCTAGGTTTGACTTACGAAGTTGGGCGCCTCGCTCGACAACCCGTTGTGAGCCCCCAGGAAGCATCTTCTTTACCTCGGAAGCTCGTAGCCTACGCCAAATTGTAGATT
GAGGATTCAGTGGGACCCTTCGAAGCATTATCTGTGATTGCATTGTTTCAAGGGCACAAAAGACAACCACAAGCATTGGAAGCTCCGCTTCATTTTGAGCATCATTCTTGACGGGCCTTC
AGCGCATCTCATGTGCTTCCAAGAACCGCGATCTGAGCATCGTCCGCCGGGCTCAACTGTCAATTTGAAAGGACAGTCCTCATCTCTAGTCCTTACACATTGGCTGCTGGCTAATAAGTC
TTCCAAAAAGGACCAACGGAGCTGTCTCGAAAGGGATTGACGTTTCTTCTGGTCCTTCCGCTGTGCAGAAATACTGCAAAGACCATGGGGCGGTCGGCTGGAACTTCACCAAGGTGAGAC
TGGCAACTTGTGGCTCCCAGTTTCTTTGTTCCGGCCATGCTTGAATGAATGCCTGCTCAACCAGACTGGAGTCGCTTTCTCACAAGGCTCCCAGCCAAGGGCCACGGGAGTTTCGTTGGT
GGCAACTACGAGCAGGGGCTAGGAGTTGCCTCCGTTGAATGCCGCTTCGTCTGCTCCGCCCTCCTCAGCCAGCTCCAGGGCCATAGTTTCTGAGTTTATCTGATCGAAGATGGAAATTTA
GCACGTGCTTATTGAAGGGCCTAGGAGGATTGGTTCCTCCAAGTCAGGGAGCGAGGATCTGCGCACGAAGTGTTCATAAGCCCTCTGCCAGACGCGATCGGCAAGCCTAACAGGCCCGCG
GGACAGCTCCCCCCCTTAGTCCGACTGTGATACAGGATTCCCTGAAGCCTTCAACAAAAGTTTCTTCCGATCCTTGATAACTCCAATCCGCCTGTCTGGGGTCGAAGCCATAAGAAAATG
ATTTTGCCTGTTCGTGACCTCCAAAACCAAGCGGCTCAGAGCATCCCGAGCAAACCTCTTCTTAACCATGAATTTGCCTCATTCTCTTCCAGTACCTCATCTCCAAATCCGGCGAGATCG
TTGAACGCTACGGGTACAAAATCTACCCGTACTCGTTCGAGCGCGACATCGTGCGGCTGCTCGACGGGGACTACTCGAACCGACCCCCACTCCCCAGATACGACGACGAGCCGCTGTGCG
TCAACAATATTCTCTTCAACAGGCCCACCATGCAGCAGATCCTGACGGCAGGCCCCTCCAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACCGCCATGGGGTGCAGTGCGAGCACAGCGGCGGCATCGCAGCCGGCACCTCGGTCTCCCAAGAGGAAGCTAGAAAAGCTTCCAAAATCGTTTCATGCCCTCAAAGTTCCTGACATCC
GTGGGAATGTCATTGACTTTGCAACTTTCAAGGGGAAG
GTCGTCCTGGTCATCAATGTGGCAAGTCGATGTGGCCACGCGATGAAGAATTACAGGGAGATGGTCGGGCTGTACAAGCGGT
ATGGCGGGCCCGAGTTCGAGATCATTGCAGTGCCGTGCAACCAGTTTTTCAACCAAGAGCCGGGCTCAAACGAAG
ATATTGAGGATTTTGTACGAAAGCAAGGGGGAGAGTTCATGGTCG
CAGGGAAGTGCAACGTCAATGGTCAGAACATGAGCCCCCTGTACCGGTACTTGAAG
AAATACTGCAAAGACCATGGGGCGGTCGGCTGGAACTTCACCAAGTACCTCATCTCCAAATCCG
GCGAGATCGTTGAACGCTACGGGTACAAAATCTACCCGTACTCGTTCGAGCGCGACATCGTGCGGCTGCTCGACGGGGACTACTCGAACCGACCCCCACTCCCCAGATACGACGACGAGC
CGCTGTGCGTCAACAATATTCTCTTCAACAGGCCCACCATGCAGCAGATCCTGACGGCAGGCCCCTCCAACTTCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGCCA TGGGGTGCAG TGCGAGCACA GCGGCGGCAT CGCAGCCGGC ACCTCGGTCT CCCAAGAGGA AGCTAGAAAA GCTTCCAAAA TCGTTTCATG CCCTCAAAGT TCCTGACATC  CGTGGGAATG TCATTGACTT TGCAACTTTC AAGGGGAAGG TCGTCCTGGT CATCAATGTG GCAAGTCGAT GTGGCCACGC GATGAAGAAT TACAGGGAGA TGGTCGGGCT GTACAAGCGG  TATGGCGGGC CCGAGTTCGA GATCATTGCA GTGCCGTGCA ACCAGTTTTT CAACCAAGAG CCGGGCTCAA ACGAAGATAT TGAGGATTTT GTACGAAAGC AAGGGGGAGA GTTCATGGTC  GCAGGGAAGT GCAACGTCAA TGGTCAGAAC ATGAGCCCCC TGTACCGGTA CTTGAAGAAA TACTGCAAAG ACCATGGGGC GGTCGGCTGG AACTTCACCA AGTACCTCAT CTCCAAATCC  GGCGAGATCG TTGAACGCTA CGGGTACAAA ATCTACCCGT ACTCGTTCGA GCGCGACATC GTGCGGCTGC TCGACGGGGA CTACTCGAAC CGACCCCCAC TCCCCAGATA CGACGACGAG 
CCGCTGTGCG TCAACAATAT TCTCTTCAAC AGGCCCACCA TGCAGCAGAT CCTGACGGCA GGCCCCTCCA ACTTCTGA 

Retrieve as FASTA