Entry information : KflGR01 (kfl00214_0050)
Entry ID 13871
Creation 2016-08-25 (Christophe Dunand)
Last sequence changes 2016-08-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-08-25 (Christophe Dunand)
Peroxidase information: KflGR01 (kfl00214_0050)
Name (synonym) KflGR01 (kfl00214_0050)
Class Glutathione Reductase    [Orthogroup: GR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflGR01
start..stop
S start..stop
PpaGR02 602 0 22..492 24..494
ThasGR01 583 0 22..494 18..492
HaGR03 578 0 9..486 3..480
MpGR02 572 0 19..488 13..485
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33225..33368 144 N° 2 34089..34153 65 N° 3 34702..34771 70 N° 4 35200..35271 72
N° 5 35995..36195 201 N° 6 36653..36898 246 N° 7 38473..38557 85 N° 8 39151..39224 74
N° 9 39662..39769 108 N° 10 40196..40260 65 N° 11 40832..40945 114 N° 12 41513..41666 154
N° 13 42104..42208 105  
join(33225..33368,34089..34153,34702..34771,35200..35271,35995..36195,36653..368 98,38473..38557,39151..39224,39662..39769,40196..40260,40832..40945,41513..41666 ,42104..42208)


exon

Literature and cross-references KflGR01 (kfl00214_0050)
Protein sequence: KflGR01 (kfl00214_0050)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   500
PWM (Da):   %s   54407.12  
PI (pH):   %s   7
Sequence 542
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPREGPFQVDGKEEKKECGKAYDYDFFVIGIGSGGVRAARMAASYGAKVAAAELPFNPVSSETEGGVGGTCVLRGCVPKKILMYGSAFSAEMQEARGFGWGIPEDIQCNWEHLLKEKTREITRLNAVYKKLLTNVKTFEGRASLLDKHTVQVEDVSSGEKQSVTSKYVLVATGARAVFIDIPGKEYGITSDEALSLAELPKKAVVIGGGYIAVEFAGIWSGLGLEVDLIYRQPHPLRGFDMEMRETVSRNLKNRGIRLHGDTNPTKIEKLGHERYVVHTDKGDKIETGVVLFATGRLPKTHGLGLDKLGVELGKKGEVIVDEYSKSSVDNIYAVGDVTNRIALTPVALMEGHAVAKTLFNNEPTPGDHRNVASAVFCQPPLSVVGLSEDEAVEKCENEVLVFTSTFNPMKYTISGRQEKALMKLIVDEKTDKILGAGMVGPDAAEIIQGIAIAIKAGATKKHFDTTIGIHPSTAEEFVTMRTPTRRHPPKHERNKDDAQK*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCGCGCGAAGGCCCCTTCCAGGTCGATGGGAAAGAGGAGAAGAAAGAATGTGGAAAAGCGTATGATTATGACTTTTTTGTCATTGGCATAGGCAGCGGCGGTGTGAGAGCTGCAAGGA
TGGCCGCAAGCTATGGAGCGAAG
GTGTGTCTATTATATATTGGTTTTGCCTGCTCTTTTGTATCGCCTTTTCCTTGTCACTGATCCTTTCGATAATGCCGCAGGTCGATTTTCCAATGCT
GTAAAGTTGATTTCCAGTTCTCCATTTTCTGACGTGTGCCCCGAATGACCAGTGCTTACAGGCGATGCTGAGTTTCCGGTTGCTGATGTTGGGAAAGTGGTACAGCAGCGTGTCATTCTT
TCCTATATATTCTGCGCAACTCAATCGGCAATTCACCACTTGTTTTTATCAACAACGATCATGCTTGGGGGCTTATTCACTGTCTCTTTCTCGAGAACATTGTCTTTCAATCCTGTATGT
TCCAATGTCTTATCTTCACTTGGTGGTGTTTCATTCTAGATCAGACCAAAACTCTTTCTTCCATGTTGCTGTCTGCTAAACCCGTACAGGCAGAGTGGAAGCCCAGTATCTGATTGAGCC
ATTTGAATGGTTTGAGATCATTCATCCAAATCACCTCAACACATTGCCAGGACTTGTTTGAGGTCTTTCATGTAAGAAGAAACCCCGCCCGCTCATTACAGGGTGGTCTCTCGAGCATTG
ATGCTAAACTTGCAAGTGATGATCATCATTTTCTTCCCTCTTCTCGCGAGTCATGTAACTTTGGGCTTTCCTCCACTGACTAGTTCTGGATGATCAACACGTGATTATCTTTTGCTGACC
TGAAACTGTTGGCTTGTATGCAGGTCGCTGCTGCAGAATTGCCGTTCAACCCCGTTAGTTCCGAGACTGAAGGCGGCGTTGGTGGCACGTAAGGGTCGCTTCCATGAAATGTTCTGGTTT
TTGCTACAGGAGTTTTTAGTAGCTTCGTCCCAGACTTCTTTTCTGTGCGAGTGTTGCAGTGAGGGTCACGCAATACAGTTCTTGCAGCCCCGTTTCTTGAGTTGAATCAACTTAGTGGGA
ACAACGAGCAGGAATTAACTTAGTGGGAACAAATCGCAGGGAGAAAAAGTGACCCTTTCTTTCATTTTTGATTGGAACGTGAAGCCTTCCATGCAAATCAATTGATGGGCGAGTTACATT
GGCCGCAGTATGAGCAATGTGCCAGCACAGGGTAGCTGGATAACGAATACTGATCCTGGACGTTCCACCTTCGATCATGCCCCTAAAGTAGTCCTCCCCTACAGTAATTGTGAAGAATTA
TAGAAATGCACACAACCAACCATAGGTTGTTACATTCTTCTTCCTACTTAAGTAGTTGTGGTGTTTAGCCACATTCCCGAAACGCACTTCAAAAGTCAAAGATGGTTGTACTACTGGTCT
ACTCTTTTCAAAGTCAACCCTATCTTACTTTTGCAGATGCGTGCTGCGTGGATGCGTGCCTAAGAAGATTCTGATGTATGGGTCGGCCTTCAGCGCAGAAATGCAGGTTAGCAGGTTGTG
CCCTGCTTCGTTCTGGATTCATTGTCAACGAAAAATATTTGTGCGAGTGTTTGAAGAGCGTAGCAATCGCTAAACATGACTTGTGTTTTCAAAAAGAAGTGTGCATCGCTCAACCATCAA
TCTAAGCATTACTTACTTAACAGTTTCAGGATGTGGCTGCCATGGTTTCCTAGTCCTGGCTCTTCAAAACACGAAACTCAGTCAGATGCACAAAGTGCTGACAACCAGCTCTGCTCTACC
AAACAAGCTCCAAGTATGATCCGTTTCAGTTCTGGAAACACAGGGTTGCCTCTTGTTTCGCGTTTGTAGCATAATGGAAGTCCCTGCCAACACTTGCAAGCACCGCGACCTTAAAAGGGT
GCCAATACCTGTATTTGGTTGATTTCAATCTCTTGAAGCACATGTCACGTGCAGGAGGCGCGTGGTTTTGGCTGGGGCATCCCAGAGGATATCCAGTGCAACTGGGAGCATCTTCTGAAA
GAAAAG
GTAGGGGCTCTTTGAATGCACTTTATTCTGCTCGTGACCTTGTTGGAAGGGGCACTGGCGCGACAAGGTCCTGAATGTTTGGGTTGTCTAGTTTCTCTTTGTCCGATCATTGCG
AAGTCTGTAGAAAGACGGACAGTATTTCATCTTTGCGACTTCGTAAAAGTGTCCTGACCTGACGGTGGAGTTTCAACATCTACGAAAATACAAATTATCTGTTGATCAACTGCTGTCCTT
CACTGCTTCTACTCCATTGCCGGATTTGGACCAAGCCTTATCAGTACTTTCAAGTGGCACAGCTGCTTGCCGGCCTCTGCAGGCTCTGCATCATTGCGACTTACCCATCATCTAATGGTC
CTCTGCAAACGAGCCTATCAAAGCTTTCATATAGACTCTTTTTCTCCTCTGTCTCTTGGTGTGGGGAGAAGATCCCCATCCTGGAACCCGTGCAAAAGATGCTGCTGGGCGCTTTCCCAG
ACCTAGATGGTTTCTAGGAAACACATTTTTGCTGATCGATTGTTGAACCCTTTCAGCCGACCCTTCCTCCAAATCCTGCTTCCACAGACATGTGTATTTTACCCGTCTCGCCGCTGAACA
GAAAGAGAACGCTCTCTGAAATTGCCGGTAATTGATCAGATGTTGCCCTCAACTACCTTCTCCTTTACTACCATGAGACGAACCCTGTTCCTAACCGGCTCTTAACGCGCTTCTAATCCC
GCTTACCAGACCCGGGAGATTACCCGGCTGAACGCCGTCTACAAGAAGCTCCTAACCAATGTAAAGACGTTCGAGGGGCGGGCGAGCCTACTCGACAAGCACACCGTTCAAGTGGAGGAC
GTTTCCTCAGGGGAGAAGCAGTCTGTGACTTCCAAGTACGTCCTGGTGGCCACGGGGGCCCGCGCCGTCTTTATCGACATTCCGGGCAAG
GTGCGTCAACCGTCTGATTGAACTCTTGAA
AGTTTTTAAGAAGCTGAGACCTTCAGGTCTGGATTGTAGGAACGTCTCAAAGATCTGTAGGCTGGAAAAAGGTGTCTTTGGAGGAGCTTGGGAATTTTGTGAGCCTTTCTTAGTACACGG
TCGAATCGCCCCCGACTCTTAAAAGTGAACCGACCAAAGCGACAAGATGGCGTGTCTCCATATGTGGTGGGCTCGCGGTCTCAGTTAAAGGGTATACTTTCCTTTGGTTCATAACCTCAT
TCACACTGGCCGTTGTGGTCATCAGAAGACGATCCGAGAACCCTCGATCAGGAAAATTTCGAAACCCTTGATTAATATTCTGGTTCGATTTTCTGGACTAACATTTTACAAAAATTCTGT
TCGCTTTCGCTGCTGAACCCAAACGCTTCCGACCTTGCTCAATGAAATCCGCGTCCCGCCCCGGCAGGAATACGGCATCACTTCTGACGAGGCGCTGAGCCTGGCGGAACTCCCGAAGAA
GGCGGTCGTCATCGGGGGAGGTTACATCGCGGTGGAATTCGCGGGCATCTGGAGCGGCTTAGGGTTAGAGGTGGACCTCATTTACCGGCAGCCGCACCCGCTGCGCGGCTTCGACATGGA
GATGCGCGAGACGGTGTCAAGGAACCTGAAGAACAGGGGGATCCGGCTGCACGGGGACACGAACCCAACGAAG
GTGAGCGGGTAGCGGCAACTGAATTTTGTTGTTATTTTCTGCTCATC
GGAGTGGTGCCATTCATCTTTTTCTGGGATTGTGTGAGACGGTGTCGAGGAACCTGAAGAACCGGGGGATTCGGCTGCACGGGGACACGAACACGAAGGTGAGAAGGTAGCGGCAACTGA
TTCTTCCGTGCCTTTTCGTGATCGGAGTTGGGCACAGAGATGCGTAAACCGGTGTTGAAGAACCGGAAGAACCGGGGGTTCCGGCTGCGCCCGGACACCCACGAAGGTACGAGGGTATCG
TCCGTCCATTTCTCCTCGTTCCTTTATACTTACTTCTTTTTCCCCTTACTTGTATGAATGATGTGTTTTGTCGAAGAAGCGTGAGACGGTGTCGAGGAACCTGAAGAATTGGGGGAGCCG
TCTGATCCGGACGCGAACCCCACGAAGGTATGAGGGTAGCGTCAGCTCATCTTTTCCCATTGACTGATTGAAATATGATGACGTGTTGAAGAAGCACGAGACGGTGTTAAGGTATCTGAA
GAACCGAGGGATCCGGCTGCACCCGGAATACGAACTCCCACGAAGGTGAGCGGGTAGCGGCAACCGGTTTTTTTGTGCCCCTTATGCGTTTTTCTTTGGAGATGCGTTCTCATGGAGATG
TGATGAGACGGGCATTGAGGTATCGGAAGGATTTGGGGATCCATATTGAAACCTGAGACGAACCTTACGAAGGTGAGAGGGTGACGGCAGTATCCCCTTCTTGAGTTTTTGGTTTGTTCT
GAATGCGCTTACGTCAGAGATGTGTGAAACAGCGTTGCGAAGGCTGCAAAACCGAGGAGCTCGTCTGCAAACGGGCAGGATCTCAGGAAGGTGAGCATTTGCGGCAGCAGTCCCCCTCAT
GTTTGTTTTGCAGAATCTTAAAGCGAAGGCCACATTGGCACCTGGACACGAAGTGAACAAAGATAGCGAGGTTAATGTAGGTGTCTGTATATCCTCCTTCTATTTGTTGGCAGGAGGTGA
GCCCTCCTGAGATTCGAGAGATGGTCTCGCGGCGTTTCATGGACCGGGAGAGGGGGGGGGTTGTGGGATCCAAAAAGCAACCACGAGAGCGGCCTGGTCTTTGCCTGCCGCACACGCTAC
CTGCTTGTTTTCTTGGAGTTTCAAACCTTCATCTTCGTGTTTCAGCAGGGACCGAGGCTATCTGCTCGAATCGTGGTACAACGGCAGATTGCAGCGTTTGCACCTTTTTCATACTACCAG
TTCACCGCCAAGACTTGGTCACGAAATATTGAGGGAATGGCCGTCAAGACGTACGCCTGCTATGTATGCGCTTTCTGTCTGACAAACTTTATCCGTCTATTTTCAGCTTTTGACATTGCA
TTTCTCCCCTCTGACAGTTGGCCTTTCCGTCTATTTTCAGCTTTTGAAATTGCATTTCTCCCCTCTGACAGTTGGCCTCTGTATGAGGCCTTTACCAATTCATTCCTCTTCACGTCTCCA
ATGATCATCGCTGCCAGGAGCCTGTTTCTGGCTTCACCAAATCAGGTTTCCGGTTTAACACTTCTGACAAACGCCATCTTCGTGCAGATTGAGAAGCTGGGCCACGAGCGTTACGTAGTG
CATACGGACAAGGGCGACAAGATCGAGACGGGCGTCGTGCTGTTCGCTACAG
GTGAGCCGTTTAGCAGAATGCGCAACTTCGCTTGCTCGAAATTGGTCTTCAATGTAGGTCTTGAGCGT
CCAGACTATCTAGTCGATGCTGAGTACTGCAGTTTAGCGGGGTCGGGGTCCCATCTGCTCTCTTTTCGTTGACGGATGTAGGCGAGTTCGGCGAAGCACTGGGGACTAACAATCAAAGGG
TTTGGAAATGTCTTTCGAGTTCCGCTGTCGAGCTCAAGTCCTTGTCTAACGTTGATAGCTGGCTGAAAATTGCTCATGGACTTGAGAGTGCGCATGGATCATTCAACCCGACGATCTTTC
TCGAATCCGCAGGCGGGCATCTGTGTCGCTCTCTCTCGTCGGCTCCTTCCATTTAATAGCCGATTGTCCTTTCCCAGTCATGCTTAAGCTGACCGTTTCATCTATTTCTTTCTCTTCTTA
TTGTACAGAGACCAGTCATCTGTCTTTCTCCTTATGTCGTACAGTTGATCATCTTTTCTTTTCCCTTTTCATTCGTGAGCTGAGCGATGCCTCTGCCTTCGTTGAACATCCCAGTCCGAG
CATAACCTTCCGCGAGTAAACTTACAGAGTCTTCTTCATCCGCAGGACGTCTGCCCAAGACGCACGGGCTTGGCCTAGACAAGCTAGGGGTTGAGCTGGGCAAGAAGGGCGAGGTCATCG
TAAGGGCCAACTCTTGGATTCAAAACTTTTGATTTGTTGCATTTCTGATTGCCTCTGCCGACTACCCCGGAAAGATACTGGCCGCTTCGTCTAAGGTGCTTCGCTTTTGTGCACGAACGA
TTGCTTTTCTGCTATTTTATCCCCCCCCTTCGACCATTCGACACTATCCTTCGGAGCTTGGTTGTTTGAGAGCTATGAGTCCGGGACTGTGATTTTTCAACTGACGAGATGAAAGTTGCT
TTGAGAAGGCCAGAATGCACTCTATGTAATTCATTCGAAAACGCTTCGCTCTGATGCAAATATGTCTGCATATCACAACCCTTGATTCATTATTCCCTCAATTGTTTTCCATATCTGGGG
GGTATGAGGTGTTGGTAGGAAGTGGAGACTTATGAGGGTGTCACTCCTGGTGCAAATGCTCCCCCCCAAACCGCAGGTCGACGAGTACTCCAAGTCGAGCGTGGATAACATCTACGCCGT
TGGTGACGTCACGAACAGGATCGCCCTGACACCTGTCGCGCTCATGGAGGGACACGCGGTCGCG
GTGAGATGCTCTCGTCTGTCGCACCAGTTTTCAAAGGACTGGGTCTCCGCTATGAT
TGTAACAATACCTTCGTTTGCCCGGTTGGGGACTATGCGGTTAATCCACGCTTCGTTCTCGACAAAATCAAGGGGACTAGGCGCACAGTCAAGTTGAGCTGACTTCCTTCGGACGGTGCA
GACACTGCACCGCATCGTCCTTATGCGGAGTCAGAAAGTTGATTTTTCCGCTGGCTTTGCCAGGAAGCTGTCGTCTTTCCTCGTCAGCTCCAGCGCAATCCGGTCCAGTCCTCGATAATG
ATCGTCATATTAAAGCATTCGATGAAGCCAATCAGCCAACGCGATCACCACTCTGACAAACGCTCTCAGTTGGCTTCATCAGTCCAATCACGATTCCAAGAGCACGTTCTGATTCCACTC
TCCCTCGCAGAAAACGCTGTTCAACAACGAGCCGACGCCTGGCGACCACAGGAACGTTGCATCCGCGGTCTTCTGGTGAGCGCCCCTTTCTTGCTGCTCCATCTTTGCAATTCGAAGCTG
GCTAGTCTATCAAGTTCTCCCTGAATCTCTGGAAGTATTCTGGTGATTGGCTGCAAGAGACGCTGCCGAGAAAAGCCCAATTGCAGTTTGTGACACGAAGGCATGGATGGTCTTTGTTGC
AAGAGGATGTGAAGTGTGATGAATTTTGTGCTGCAAAGAAATTCCTGCCAGCTATCACTTCCAAAGGCGATAAGTGGAAGCGTGTGCATAGTCATGCCTCGATGCAAAAGAAGATTCGTA
GAAGACGGAGATGAGGAATTCACGGATTCAAAGCACGGTACGACGTCAATAACCAGTTCGCAAAGTCAATCTTGTGCCAAACGTTCAATTCATAGCAGAACGGAAGAGCAGGTGCGTCTC
AGGAAATGACCAGAAAATTCACGAAGGTCGCTCCCATTACATCCGAAACCTACAAACCTGACTGATTCTCTCATCAGGATGCTGCTAAGCACAAAACGTTTGTTGACGCTTATTTCGCGT
TTGCATCGGAGAAGCCCCTCTGAACGTTCCGTTACCGCCCGTGCAGCCAACCGCCGCTGTCGGTGGTGGGTCTTTCCGAGGACGAGGCGGTGGAGAAGTGCGAGAACGAGGTCCTCGTGT
TCACGTCCACCTTCAATCCCATGAAGTACACCATCTCCGG
GTGAGTGACCAGCGCTTTGTTTTCGAATCTGCTTCTTCTAAGAGGGTCCTTAAGGCAAAGTGGGCGAAAACTCCAGTTAC
TGAGCGGTCTGCTCTTTAGCAACTTGCGACCTAGTTGTTAACTCGTCCTCAGCTCTGGTGTCATCGTAATTCTGTTGTTTCCTTGTGTTGAAAAGACCAGGTACTAAGGAGCTATATCTA
GCTGGCTCTCGCCAGCTGCAAGGAACTGAAGTCCGAAACCCGCAGTTCCTCACCGGCTCTGGACCCGGAACTCGTTCACTCCGACCTATAAAATCTTCTACAGGGCCTCTGAACCGGGAA
CTCGTTCACTCCAAAATAGCAAGTTCTTGGAAGTATACAAGGGCTTCTATTGTTGCTTCACAGGCGCCAGGAGAAGGCCCCCATGAAACTGTCTCTGGAATCATCCGTACGCATGGAGTC
TCTGGCACTGTATAGCAACTTGTCTCATCGAAACGCAGGTGTCAGCAGAAGGCCCTGATTCAGCTGACATTAGAACCACTCATACGTTTGGAGTTTCTGAGATCGTACATCGGGTTCTTT
CTTGCAGGCGGCAGGAGAAGGCCTTGATGAAGCTGATTGTGGACGAGAAGACGGACAAGATCCTGGGCGCCGGGATGGTCGGGCCGGACGCCGCTGAGATCATCCAGGGGATCGCAATCG
CGATAAAGGCGGGGGCGACCAAGAAGCACTTCGATACAACG
GTGAGGATGTTTTGTAGAATTCATTAGTTGTCTTCGTGTCGATATTTCATGGGTCCCCTTCTTCCATCTTCCATGTAGA
CTGTCATAAAACAACCGGTTTAAAGTCCCGGGCCCGATTTCGGGACAACCTCGCATCGATGAATCCGGTGAACCGAGGAATCAGGTTGTCGCCGAATCCGTTTGACGGGTTCACAATCGT
TCATCGTCAGAGGATTTGGCTGGCGCTGCCCTTTCGTCCAGGAGATTCGGTGGTGCTCCCTAGGAGTTGCTACTTCAACCGGCTGTCATTTCGGACTCCCTTTCTCGGTGGTCGTTCGTC
ATCCGTGACGGAAGGATTGTCTGGCTGTGCAAAACGTCTAAATGTCGCACTTCGTCTAAATGTGTAAGGTCAAAGCTGTCACTCAGCTGAAGCTGAAGCCTTCTTCTTGTCCATCCAGAT
TGGGATTCACCCCTCTACTGCGGAGGAGTTCGTGACAATGCGGACGCCTACGCGCCGACACCCGCCCAAGCATGAGAGGAATAAAGATGACGCACAGAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCGCGCGAAGGCCCCTTCCAGGTCGATGGGAAAGAGGAGAAGAAAGAATGTGGAAAAGCGTATGATTATGACTTTTTTGTCATTGGCATAGGCAGCGGCGGTGTGAGAGCTGCAAGGA
TGGCCGCAAGCTATGGAGCGAAG
GTCGCTGCTGCAGAATTGCCGTTCAACCCCGTTAGTTCCGAGACTGAAGGCGGCGTTGGTGGCACATGCGTGCTGCGTGGATGCGTGCCTAAGAAGA
TTCTGATGTATGGGTCGGCCTTCAGCGCAGAAATGCAG
GAGGCGCGTGGTTTTGGCTGGGGCATCCCAGAGGATATCCAGTGCAACTGGGAGCATCTTCTGAAAGAAAAGACCCGGGAGA
TTACCCGGCTGAACGCCGTCTACAAGAAGCTCCTAACCAATGTAAAGACGTTCGAGGGGCGGGCGAGCCTACTCGACAAGCACACCGTTCAAGTGGAGGACGTTTCCTCAGGGGAGAAGC
AGTCTGTGACTTCCAAGTACGTCCTGGTGGCCACGGGGGCCCGCGCCGTCTTTATCGACATTCCGGGCAAG
GAATACGGCATCACTTCTGACGAGGCGCTGAGCCTGGCGGAACTCCCGA
AGAAGGCGGTCGTCATCGGGGGAGGTTACATCGCGGTGGAATTCGCGGGCATCTGGAGCGGCTTAGGGTTAGAGGTGGACCTCATTTACCGGCAGCCGCACCCGCTGCGCGGCTTCGACA
TGGAGATGCGCGAGACGGTGTCAAGGAACCTGAAGAACAGGGGGATCCGGCTGCACGGGGACACGAACCCAACGAAG
ATTGAGAAGCTGGGCCACGAGCGTTACGTAGTGCATACGGACA
AGGGCGACAAGATCGAGACGGGCGTCGTGCTGTTCGCTACAG
GACGTCTGCCCAAGACGCACGGGCTTGGCCTAGACAAGCTAGGGGTTGAGCTGGGCAAGAAGGGCGAGGTCATCGTCG
ACGAGTACTCCAAGTCGAGCGTGGATAACATCTACGCCGTTGGTGACGTCACGAACAGGATCGCCCTGACACCTGTCGCGCTCATGGAGGGACACGCGGTCGCG
AAAACGCTGTTCAACA
ACGAGCCGACGCCTGGCGACCACAGGAACGTTGCATCCGCGGTCTTCTG
CCAACCGCCGCTGTCGGTGGTGGGTCTTTCCGAGGACGAGGCGGTGGAGAAGTGCGAGAACGAGGTCCTCG
TGTTCACGTCCACCTTCAATCCCATGAAGTACACCATCTCCGG
GCGGCAGGAGAAGGCCTTGATGAAGCTGATTGTGGACGAGAAGACGGACAAGATCCTGGGCGCCGGGATGGTCGGGC
CGGACGCCGCTGAGATCATCCAGGGGATCGCAATCGCGATAAAGGCGGGGGCGACCAAGAAGCACTTCGATACAACG
ATTGGGATTCACCCCTCTACTGCGGAGGAGTTCGTGACAATGC
GGACGCCTACGCGCCGACACCCGCCCAAGCATGAGAGGAATAAAGATGACGCACAGAAATGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CGAAAGCCAC GTAGAAAGTT CTCAAGGGGA AAAGTGCAAG GTTTTCAGCC TTTCCAGGAG GGCGTTGTCA AAATCTTAGT GACACAAGCG TGATCGCACT TTGTATGTAG CTCAGCGCTG  TGGTCTACCT CTGTTGGGAA ATCGCAGCAT TGCATTTGCC TTCCCTTCCA TGAAAGCAAC CTTGCTTGCT CGTCTCGCCA GCAGCAAGAT CCTGTCCACC CGGAGTTTCT GTCAAGCAGG  CCCGTGCCCA AGCTTTTTTG CTTTCTGGCA GAGCGAAGTC CGGCCTTTGT CTGTGGCTGC AAGCATGCCG CGCGAAGGCC CCTTCCAGGT CGATGGGAAA GAGGAGAAGA AAGAATGTGG  AAAAGCGTAT GATTATGACT TTTTTGTCAT TGGCATAGGC AGCGGCGGTG TGAGAGCTGC AAGGATGGCC GCAAGCTATG GAGCGAAGGT CGCTGCTGCA GAATTGCCGT TCAACCCCGT  TAGTTCCGAG ACTGAAGGCG GCGTTGGTGG CACATGCGTG CTGCGTGGAT GCGTGCCTAA GAAGATTCTG ATGTATGGGT CGGCCTTCAG CGCAGAAATG CAGGAGGCGC GTGGTTTTGG  CTGGGGCATC CCAGAGGATA TCCAGTGCAA CTGGGAGCAT CTTCTGAAAG AAAAGACCCG GGAGATTACC CGGCTGAACG CCGTCTACAA GAAGCTCCTA ACCAATGTAA AGACGTTCGA  GGGGCGGGCG AGCCTACTCG ACAAGCACAC CGTTCAAGTG GAGGACGTTT CCTCAGGGGA GAAGCAGTCT GTGACTTCCA AGTACGTCCT GGTGGCCACG GGGGCCCGCG CCGTCTTTAT  CGACATTCCG GGCAAGGAAT ACGGCATCAC TTCTGACGAG GCGCTGAGCC TGGCGGAACT CCCGAAGAAG GCGGTCGTCA TCGGGGGAGG TTACATCGCG GTGGAATTCG CGGGCATCTG  GAGCGGCTTA GGGTTAGAGG TGGACCTCAT TTACCGGCAG CCGCACCCGC TGCGCGGCTT CGACATGGAG ATGCGCGAGA CGGTGTCAAG GAACCTGAAG AACAGGGGGA TCCGGCTGCA  CGGGGACACG AACCCAACGA AGATTGAGAA GCTGGGCCAC GAGCGTTACG TAGTGCATAC GGACAAGGGC GACAAGATCG AGACGGGCGT CGTGCTGTTC GCTACAGGAC GTCTGCCCAA  GACGCACGGG CTTGGCCTAG ACAAGCTAGG GGTTGAGCTG GGCAAGAAGG GCGAGGTCAT CGTCGACGAG TACTCCAAGT CGAGCGTGGA TAACATCTAC GCCGTTGGTG ACGTCACGAA  CAGGATCGCC CTGACACCTG TCGCGCTCAT GGAGGGACAC GCGGTCGCGA AAACGCTGTT CAACAACGAG CCGACGCCTG GCGACCACAG GAACGTTGCA TCCGCGGTCT TCTGCCAACC  GCCGCTGTCG GTGGTGGGTC TTTCCGAGGA CGAGGCGGTG GAGAAGTGCG AGAACGAGGT CCTCGTGTTC ACGTCCACCT TCAATCCCAT GAAGTACACC ATCTCCGGGC GGCAGGAGAA  GGCCTTGATG AAGCTGATTG TGGACGAGAA GACGGACAAG ATCCTGGGCG CCGGGATGGT CGGGCCGGAC GCCGCTGAGA TCATCCAGGG GATCGCAATC GCGATAAAGG CGGGGGCGAC  CAAGAAGCAC TTCGATACAA CGATTGGGAT TCACCCCTCT ACTGCGGAGG AGTTCGTGAC AATGCGGACG CCTACGCGCC GACACCCGCC CAAGCATGAG AGGAATAAAG ATGACGCACA  GAAATGAAAA GGCGAGCAAG ATTGAGGCTG GAGTCTTTGG GGATGGCAGA TTGCATTTCT TAAAAGGGAT GTAGCACTTG CTTAGGATCT TACAGAGCAG ATTTCAGTTT CTCCAATTCA  AGAATTGATT CAATGAAAGG ACGGACACCT GTAGACCTTG TACAGCTAAA TTGCTGGCCG CACCTGGACC GCATGACCAT ATGCTAAGAA CGGGCGGCTC AATCTGTACG TACTAGTTCT  GGAAAGCCGG TTGTTTCAAT CCGATGCCGG CATTAGTTTG TCTTTGAATC ACGCGTTACG CGGTGAACTC AATTACATTG TGGCACTCAT CCAGATTTAC TATCTTACAA AATGCTGCCT 
AAAATTACCG TACACGGACA CAGC 

Retrieve as FASTA