Entry information : KflMDAR02 (kfl00196_0050)
Entry ID 13874
Creation 2016-08-25 (Christophe Dunand)
Last sequence changes 2016-08-25 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-08-25 (Christophe Dunand)
Peroxidase information: KflMDAR02 (kfl00196_0050)
Name (synonym) KflMDAR02 (kfl00196_0050)
Class Monodhydroascorbate Reductase    [Orthogroup: MDAR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflMDAR02
start..stop
S start..stop
HaMDAR03 526 0 3..434 6..435
PpaMDAR02 520 0 21..434 44..455
LeMDAR03 515 0 3..434 5..433
PpaMDAR03 509 2e-180 21..434 23..434
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49908..49952 45 N° 2 51117..51188 72 N° 3 51701..51833 133 N° 4 52744..52862 119
N° 5 53337..53450 114 N° 6 54009..54114 106 N° 7 54813..54937 125 N° 8 55368..55493 126
N° 9 56178..56399 222 N° 10 57118..57360 243  
join(49908..49952,51117..51188,51701..51833,52744..52862,53337..53450,54009..541 14,54813..54937,55368..55493,56178..56399,57118..57360)


exon

Literature and cross-references KflMDAR02 (kfl00196_0050)
Protein sequence: KflMDAR02 (kfl00196_0050)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   434
PWM (Da):   %s   47335.34  
PI (pH):   %s   5.81
Sequence 475
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSFKYVIVGGGVAGGYGAWEFTKHGLQPGELAIISKEKVAPYERPALSKGYLFPENPARLPGFHTCVGGGGPKGLPEWYKENGIELKLDTEVVKADLKSKTLTTDKGETIKYEKLIIATGAGVINLKDFKMPGADADGIYYIREEEDAAKLYEAMQKHKGAKVIVVGGGYIGCEVGAGLSLNGLDVTIVYPEPHLMPRLFTPEIASFYEGYYEAKGIKVFRGRLAAAIVQHDGQPNKIQCVRMKDGEELPADFLVVGIGARPRVGLFEGQLEMAKGGFKVDGNFKTSEPDVYAVGDVAAFPLKMKDGELTRVEHVDNARKSVMQAVQAIKAEEKGESIPEYDYLPYFYSRVFKLSWVFYGENVGDVVVWGREEAIKEGGKFGAYWVNDKKVVGAFLESGTPDDNKLMSEVARKRPSVESQEELKSGLAFAAKI

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCCTCCTTCAAGTATGTCATCGTCGGAGGCGGTGTTGCAGGCGTAAGCTCAACTTTCTTATGGTTTGCAGAATTTTGCATAAGTTGCTTGCAAGGGTTGCGAATGGTCGCAATTTTGA
TTCTGAACGTCTGCTAAATGTAAGGATCTAAAGCAGTAAAATGACTCTCTCTAAGAACTCTGTTGCTGCAAAACAGGTTTTCTCTGGCTCAGATCTTTGTTGAGAGCTAATAACGGCAGG
GAGTTTGATGTCCGAAGTGGTTTTCTGTCCAGGACGTTTTCATTGCTTTGAGTTGGTGATGTCACTTTCGCTCATATGATCCTTGAAAGGAGACTGAATGTAGCTTTTGTCTATCCTGCT
GCCTGTACATTTGGTGCGCAAGATTGGACTTCTATATTCACTAGTGGAAGGAAGAAAGTCATAGACGCTTTGTTGGGCTTGTTGATCTCGTTGCTGCAAACATATGTCTGACACTGTTCT
CTGGGGAAGCAGTCAGCAATTGAAGGGCTTGAATGTTTAGAAGTGTCAGGTTTTGCAGGATGTCTTTTTGAAACCTCGAATGCGCAGTCAGAGTTGAGAACTTTCTCATTGTGAGTGTGC
AAGGAGTTATACAGGGCTTTAAAGTGTGCGACGAGTCATGCTGTCTCGTCGCACCTGTACACCCCTCCAAAAAGTTGTTAGCACGGAGGCAAGTCAGTGAAAGGGCAAAAACACACAAGT
CATCAGACAATGGAAAAGACGGCAGCAGAATCTGTGACCACGAATGGGGGATGGCAAGCCTTTGAGTGGTTTCCCTAATTGTCGACGAAAGCGACAGAGTTTTGCAATGACTTACGATTC
CAAGTCCAAGCGACAAAAAGTGACCTTTGTGTGACTGAGTTGGAAAGTACAGAATCTGAATGCCCTCCTGTTCAGATTTCTTGACTGTATATGATGCGCAACATGATCAACATCTTTGAT
GATTGGTGGTCACGTTAGGACGGGCGATCTGGCGCTGTCTCAAAAGTATCCCCCCTCGTATTGAGGGTCTTTGAAGGATGCCGAAGAATCTCCAGTTGTCACCACTGTCAAGAAGCTGAA
CTGCCCGCTCGCACCCTCTCCGAGCAGGCAGGTCGGTAGCCTAACACATCCTGGCAATGGCCTTTCCTACTCTTAAGCCGCCCTTTTCTAGTTTCTTGCACTGACTATGTGCTTGGCTCT
GTATGCAGGGGTATGGTGCTTGGGAATTTACCAAACATGGACTGCAGCCTGGGGAGTTGGCTATCATCTCCAAGGAGAAGGTATCAGTCAATTGTTTCCTCTTCTTGGGTCTGATTCTAT
TTGAGAGGCCTGGTTTGGACCTCTCCTTGAGCTGGCGCGGAATGGCAGAGGGTCGCATCTCAACAGTATCACAGGAGCTAAGCCTCAAGAGTGTCTGCACAGTTTTGCTCCTAAGCAATC
TCTAAGGGCAGTGGTAATTCTGTTACATCCATTTGTCGGGGATTCGTTCATATGCGCCATTTTGCAGACAGAGCAGTTCTTTTGGCTTATATTTTGAACGCCCGCTGCCTCCTTGTTGCT
TTCTGAAGGGGATGTATGTAGACTTTTCCTTCACACATACCCCGCTTTCCTGAAACTAAGGTTAGCGGTCTTCCAATAAATACCAGGTATAGAGTGCAGGCTGTCGCAAAACTCGATTTG
GTCTTTTCGTGACAGTGGATTACATGGATACAATCTTACCACTTGAGGTTTAATCCTCTTGCCGGGGGAAATATGTTGAGCCTTTCGCGCACTGAAGAATATGTGTTTGCAGGTCGCCCC
CTACGAGCGCCCCGCTTTGAGCAAGGGCTACCTCTTCCCCGAGAACCCGGCCAGACTGCCTGGTTTTCATACGTGCGTTGGGGGGGGCGGTCCCAAGGGGTTGCCAGAATGGTACAAGGA
GAACG
GTGAGCGGGAAGTGAGCCTTAGTGTTGTTATGTGTTTTCCGTTACGTTTCGAGCTCCAGTGACTTTGATTGAGTAGTAGGTGACTCCTCTGCATTTCAGCGCCTTCAGGATATCC
TTTGAAGGAGCCGCGCATGCTTGCATGGTTTCGTAGCCGAAGTAGTAGTTGATTGCAAGGGAACTACTGAGGCTTATGGTATGTGTTGAGGAGTATGGTACTTTTTGAGGATTACGGTAT
TTTTCGAGGAATATGGATCCCGCTTTGCCCGCACCATGGTGATTGCACCCCAGATTGACAGTCCGAGTACTCCTCCTTTGAAAAGTCGCAAACTAGTACTGAGTCGAGGGTTCGACAGAG
CGTACTGGCGAAATCTCGTCCATGTTCGGAAAGCCGCAGTGTCTTCTTGTATTGCATCGTGACAGGAACTCAGCTGAGCCATGGTCCGGAGTGGATAAGATGGGCAACTAAAGCGAGCAG
ATTTGAGTCTGCATCACGATCTGGAGTTTGCATCTTTCCTTTGCTTAGAAGAGGCTTTTTACTTGATAGGCCACGCTGTATTGCAGCGCTTTTCTTTTTCTTTGTGTTGTGTATACGACT
CGAGCGCAGCTTTCAAGCGGCGGGTTCCATGGGGCTGTGCAACGGCCGTGAACCTCTCTAGATTTTTTGCACGTCTTCATGCGTTTTCAATAAAAAGCAGTTCTTGGAGTAGAAGCGCCC
CAGGAAGCGCTCCGTCATCTTCTTAACTTCACCAACAATGAAGCCTTTTGTATGGCCTCAAGCGTTGACGATGCAGCCCAGTTCCTGGAGAAGAGTCGCCCCCGGAAGCGCTTCGTCGAC
TACGCAAGCGCACCAACTTTCAAGCCTTTGCACAGGCGATAAGATGTTCTCATCCGTTACATGCGCTTTCGCCAGGTATTGAGCTGAAGTTGGATACGGAGGTCGTCAAGGCGGACCTCA
AGAGCAAGACGCTGACGACCGACAAGGGCGAGACGATCAAGTACGAGAAGCTGATCATTGCAACCGGAGCCGGA
GTGAGGGTCGCCACCATTTGTCAGAAATGCTCACTTTATTCTGCGT
CACTCGCGGAAGCAGGGGGCTATCCCCTTTTTTCCAGAGTCTTCCTGATATTCCCCCCCGCGCTCAGGGTGACGACTTGGTACCGTCGAGATGTGGCTGCTGCTGAGACAACAATTTTCT
CAAGGAGGCGAATGCGCTTGTGGGGCCGCCTTGTGCTTCTTCTGAAGATCACTTCTGCTTCTACTCTGTCCTTCATGTTTCCATGTCATTATTTGAGACGCTTGCTCAGCCCCTGAAAAA
AGCGACTTCAAGTCGGTGACCAGCTCTCCTTCAAGTCGGTGACCAGCTCTCAATGGCTTTTGATGGTTTGTGCTGTGTACTCACACAAGCTTGTCAACCTGAGCTAATTTTGCTGCTGAT
ATTACTTCGCGTTCGGCTGAAGATCTCATATTGGCTCTCCGGCTCATGGTCTGTCCGTTTTGGTACAGGTCATCAACCTGAAAGACTTCAAGATGCCTGGCGCTGACGCCGACGGCATCT
ATTACATCCGGGAGGAGGAGGACGCGGCAAAGCTCTACGAGGCCATGCAGAAGCATAAGGGG
GTGCGTGGCGCCGCTTTTGCTCACATTGCGCGTTCATTCCGAGTCTTCGTTGTCTCAT
GCGGAGCGTGTTGTCAGTCACATTCTTCGTTGGCAGATACGATCGATCGGCGGTTCTTGTCTGCTTTGTGTCTACGATCTTCTTTTCCAAATGCCCTCGTATTGTCGGACGAAGTTTGGG
TTGCGTCATTCGCCATTGAGGAATTGATTTTCACAAGCAGTGTCTAAAACTTGAGCCGCCTCTTGAAATTGCTCGTAGTTTATCATTAACACCGACTGAGCAGAAGGTATATGTCCGAAG
ATGCGAAAAAAAGGACTTTATTGAGTCTACTCGCTTCCTCCGGTTGCTGTGCATCGATTCTGCGACCCTGCATGGAGGCGGGCAGCAAACGGTCGTTCCATCAGCTGGTTTTGTGACCGC
ACGTTCATTCAGCTGCTCACGTCATTCGTGCGGTCCATGTAGCGTGCCAGCGAGTCCGGTGCGCTTGCAAGGATGACAATTCTCAAGCAAACAGCACTTTACGGACGGTTTTTCTGAATC
TTCTCTCCGCTTTCATGCAGGCTAAGGTTATTGTGGTGGGCGGAGGTTACATTGGTTGCGAGGTGGGAGCGGGACTCAGCCTGAACGGATTGGACGTCACGATCGTGTACCCCGAGCCGC
ATTTGA
GTAAGCATCTTACTCTTCTTGCACGTGGGCTCAATCAGCCTGTCGTCCAGTTGTCATCAAATATTTGTGTGGTATTGTGTTGTCTTTCGGGGCGTCTATGTTCCTATATGTTAT
CTTCCTGACAACTCCGTGCTTCTTGTGTTGTGAACTTTTTCGACCACTGCATCCTTTTTGAGTGGCGTCTCTTCCGGAACAAGTCTGTGCTTCGTGTACTGTGACTCCTTTCGACCACTG
TATCGTTTCTGAGGACCCAACGTTCAAAAATTCTTCTGGCAAGAAGTCGATGCGCAGCAGGTATTAGCGTATGAGCGTATAAAGAACTCGAGAGAGGGTCAGCAGTCGTTCCAGCCCACG
AGGCGGCGTTCAAGCAAGCAGTCGACTTTCAAGATGGAAAGCGACAATAACGTTCTGTAGTGACTTGAGGTTGACGGTTTCAGCAGCTCGTCCTCATACCGACGACTTCCTCAGGATTGA
GGCAACCCTTTTAAGGATACTTCTGAGAAAGACATTGGGGCGTGGGCCTTTTACCAACGCCTCACTTACTCGCCTCTTCGTCTATGTCGACCGCTAACATCCTTCCTACTTTCCGTGAGC
GACGAAGCCGTAATAACACTGGTGTGCGTCTGAGGATGAGTCGGGTTGAAAAGTGGGTAAGTCAGGAAAGAAAAGCTGACTGGAATTCTGTGGAGTCTTCGCAGTGCCCCGCCTGTTCAC
ACCAGAGATTGCGTCCTTCTACGAGGGCTACTACGAGGCCAAGGGCATCAAGGTGTTCAGGGGCCGGCTCGCAGCCGCCATCGTCCAACACGATGGACAGCCAAATAAG
GTGCCGCCAAC
CTGGCTTCCTACATTGGGCTCTTGGTTGGCGCGTTGTTTGCTTTCGTATCCTGTTTCAGTCGCAAGTGCAACTGCGCTCATACGCCTTTGCTGTCACTTTTCATCTTCGGTCATTTGTGC
AACTCAGCTTCGTCGCTTCGTTGTACTGATCCATTCCGCAGCCCTTCTTGTACTTGTCGTCTTTTCTCCATTTACAATCAGTTATGCATCTCCGCTCGCCGGTTGATTTGCAGATTCAGG
GCGTGCATACGTGCAGTAGGGTTTTAGGGTCTCAGGGCTTTAGGATTTTAGGGGTTTAGAGATTAGGGTTCTAGGGAATGATCGCGGGCGGCCTCTGCACAGACCCGGTCAAAGATAGGT
CTAACCGCTTCTTCCGTCGTTAACACTTGTTCACTTCCGGTCGCCCCTTTCTCGTGCAGATCCAGTGCGTGCGGATGAAGGACGGGGAGGAGTTGCCGGCCGACTTTCTCGTGGTGGGCA
TCGGGGCGCGCCCCAGAGTGGGGCTTTTCGAGGGCCAGCTCGAAATGGCCAAGGGCGGCTTCAAG
GTCAGCACTTCGGTAATTGCCGTACTTCGGAGTTAGGATCTCGCATTTGCGAAGC
TGAGCACTTGGGTTACGAACGTGCTATGGCGTTGGCAGAACTGATTGTCAGAAGCGAGAGGACTTTTGACATTTCTCGTCCGTTTTCACTCATGGCAAACTAATCTCAGAAAAGGAGACG
AGCGATTATTTCGTCAGAATAGGAAAAGCAGTAGGTGACGTCGGCGAAACAGGCAGGGATAGGGGATCTTATGAGAGGACCGAGCAGCAGAGGCTCACGCTGCTTGAAATTTACCTTTTA
CGTTTTCTGAGACCTTATCGGTGGTTGTCTGCACTAAAGGTCTGAACAGCTGCGACGGATGCTAAAAAGAAATTGCGGATGGTAGCATGCATTAACCATTGCGAGGTGTCCAGCAACTAG
TCTTCAGTCCTTAGCATACCACACTTTCATGACCCGCTCAACCTTTCGGGAAGGACTCTGTCTTACCTTTATTACGAGGAGCACGTTTCTCCGGAGTAGCGAGGCGTACAAGGAGATCAC
AATCCCCTTCTGCTGGAGATCTAGGCACCTCCCAAAAGGCAAGTCTTTGCAGATTGTCCGCTTTGTTAAGTTTAACAAACTTCAGTCGGTATTTAGAAGCGGAGACCTTCCACCCATTAC
CATCTCCTTACGTCCTGTTTATCATTCAGGTGGACGGCAATTTCAAGACGAGCGAGCCAGACGTCTACGCGGTGGGTGACGTGGCGGCGTTCCCGCTGAAGATGAAGGACGGCGAGCTGA
CACGTGTCGAGCACGTGGACAACGCGCGGAAGAGCGTGATGCAGGCGGTGCAGGCCATCAAGGCGGAGGAGAAGGGCGAGAGCATCCCCGAGTATGACTACCTGCCGTACTTCTACTCCC
GCGTCTTCAAG
GTACGGGTTGTATATTAAAGACGGATGTGTTTCTAGGTCCGAAAATCTTTGGTTCCTTTGCACATTTTTTTGGTGCAAAAAGACAAAAAGAGTCGCACATCTTCAGAAC
GTCAGTCGTTGCTCGCGTACGACTCCCTGGCGTAATAGATTCTGCTCCCGCGCGCGTAAGGTATGGATCACGTTCCAAAGATTTTTAAAGTTCTGCGTGTCTCTGAAACTCTAGGTTCCT
ATCGTGGTTCAAATAACCTGTTAAGGACGGCAGAAGGACAGGCGTAGGGAACTTCGGTCGCCCGACGAGTCCGATTTATCTTTCGACTCCTTGTCAAGACTCACTAGAAGAAAACAGTGG
GATCGCAAGCGCAAGTATCGAATACTCTTGCTTCGTTTTCACTCCTGCGGTCGTAGCATGTTTTCAACAGCAGTCTGGGAAGGGGAGTCGATTTGTCATGCAGTCTTCATCCAGACCTTG
GATCGTGCAGTTTAGAACTTACCCAGATCAGTGCTTTATGGTCGGAAGACTGGTTGCGCTTTGAGACAGAGTGTTCCTAAGGTCTTCTTTCAGCCTTCCAGCCCCTTCCAGATCAAAGAA
TTGCATTGCAGAGACCACACCGTCTAGAAAGCTTCTTCGCTTGCCGGCTTGCACTTACGGTCTGCCTTCATTCTTAATTCAAGCGGAAGCAAATTTCTTATAAACGTAAACTCGGTGGCT
CGCGTGCAGTTGAGCTGGGTGTTTTACGGCGAGAACGTGGGCGACGTCGTTGTGTGGGGCCGCGAGGAGGCGATCAAGGAGGGCGGCAAGTTTGGCGCCTACTGGGTCAACGACAAAAAG
GTGGTCGGGGCCTTCCTCGAGAGCGGGACGCCGGACGATAACAAGCTGATGTCCGAAGTTGCGCGGAAGCGACCGAGCGTTGAGTCTCAGGAGGAGCTCAAGTCGGGGCTAGCGTTTGCG
GCTAAAATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTCCTCCTTCAAGTATGTCATCGTCGGAGGCGGTGTTGCAGGCGGGTATGGTGCTTGGGAATTTACCAAACATGGACTGCAGCCTGGGGAGTTGGCTATCATCTCCAAGGAGAAGGTCG
CCCCCTACGAGCGCCCCGCTTTGAGCAAGGGCTACCTCTTCCCCGAGAACCCGGCCAGACTGCCTGGTTTTCATACGTGCGTTGGGGGGGGCGGTCCCAAGGGGTTGCCAGAATGGTACA
AGGAGAACG
GTATTGAGCTGAAGTTGGATACGGAGGTCGTCAAGGCGGACCTCAAGAGCAAGACGCTGACGACCGACAAGGGCGAGACGATCAAGTACGAGAAGCTGATCATTGCAACCG
GAGCCGGA
GTCATCAACCTGAAAGACTTCAAGATGCCTGGCGCTGACGCCGACGGCATCTATTACATCCGGGAGGAGGAGGACGCGGCAAAGCTCTACGAGGCCATGCAGAAGCATAAGG
GG
GCTAAGGTTATTGTGGTGGGCGGAGGTTACATTGGTTGCGAGGTGGGAGCGGGACTCAGCCTGAACGGATTGGACGTCACGATCGTGTACCCCGAGCCGCATTTGATGCCCCGCCTGT
TCACACCAGAGATTGCGTCCTTCTACGAGGGCTACTACGAGGCCAAGGGCATCAAGGTGTTCAGGGGCCGGCTCGCAGCCGCCATCGTCCAACACGATGGACAGCCAAATAAG
ATCCAGT
GCGTGCGGATGAAGGACGGGGAGGAGTTGCCGGCCGACTTTCTCGTGGTGGGCATCGGGGCGCGCCCCAGAGTGGGGCTTTTCGAGGGCCAGCTCGAAATGGCCAAGGGCGGCTTCAAG
G
TGGACGGCAATTTCAAGACGAGCGAGCCAGACGTCTACGCGGTGGGTGACGTGGCGGCGTTCCCGCTGAAGATGAAGGACGGCGAGCTGACACGTGTCGAGCACGTGGACAACGCGCGGA
AGAGCGTGATGCAGGCGGTGCAGGCCATCAAGGCGGAGGAGAAGGGCGAGAGCATCCCCGAGTATGACTACCTGCCGTACTTCTACTCCCGCGTCTTCAAG
TTGAGCTGGGTGTTTTACG
GCGAGAACGTGGGCGACGTCGTTGTGTGGGGCCGCGAGGAGGCGATCAAGGAGGGCGGCAAGTTTGGCGCCTACTGGGTCAACGACAAAAAGGTGGTCGGGGCCTTCCTCGAGAGCGGGA
CGCCGGACGATAACAAGCTGATGTCCGAAGTTGCGCGGAAGCGACCGAGCGTTGAGTCTCAGGAGGAGCTCAAGTCGGGGCTAGCGTTTGCGGCTAAAATCTGA

Retrieve as FASTA