Entry information : PpaGOX03 (Pp3c18_20200)
Entry ID 13909
Creation 2016-10-14 (Christophe Dunand)
Last sequence changes 2016-10-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-14 (Christophe Dunand)
Peroxidase information: PpaGOX03 (Pp3c18_20200)
Name (synonym) PpaGOX03 (Pp3c18_20200)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaGOX03
start..stop
S start..stop
PpaGOX02 698 0 1..368 1..368
PpaGOX01 694 0 1..368 1..368
MpalGOX01 638 0 2..364 4..366
MpGOX01 637 0 2..364 4..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..146 146 N° 2 316..440 125 N° 3 542..588 47 N° 4 776..978 203
N° 5 1121..1187 67 N° 6 1347..1409 63 N° 7 1519..1588 70 N° 8 1721..1821 101
N° 9 1964..2068 105 N° 10 2190..2369 180  
join(1..146,316..440,542..588,776..978,1121..1187,1347..1409,1519..1588,1721..18 21,1964..2068,2190..2369)


exon

Literature and cross-references PpaGOX03 (Pp3c18_20200)
Cluster/Prediction ref. Genebank:   5921851
Protein sequence: PpaGOX03 (Pp3c18_20200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368
PWM (Da):   %s   40248.07  
PI (pH):   %s   8.22
Sequence 410
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPSTEIVNVSEYEELARQKLPKMVYDYYASGAEDQWTLKENRSAFERIRFRPRILIDVTKVDLSTNVLGFNISMPIMVAPTAMQRMAHPDGELATARATAKAGTIMTLSSWSTSSVEEVASVGPGIRFFQLYVYKDRNVVAQLVRRAERAGFNAIALTVDTPRLGRRESDIKNRFALPKHLTLANFEGLDLGQMDKTQDSGLASYVAGQIDRSLSWKDVKWLQSITELPILVKGVITAEDTKLAIQNGAAGIIVSNHGARQLDHVSATISALEEVVQAAAGRLPVFLDGGVRRGTDVLKALALGASGVFIGRPVVFGLACDGQQGVEKVLQMLRDEFELAMALAGCTKVSDISRAHVQTEVERFHAKL*

Retrieve as FASTA  
Remarks (Chromo 18, 9 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCGTCTACCGAGATCGTGAACGTGTCCGAGTATGAGGAACTAGCGCGACAGAAGCTGCCAAAGATGGTGTACGATTATTACGCCTCCGGCGCTGAGGACCAATGGACTTTGAAGGAGA
ATCGTAGCGCTTTCGAGCGCATCAG
GTGAGTTGCAATTCACTTGCATGCTCTCTCTCTCTCTCTCTCTCTCTCGCTCTCTCTCTCCCCCCCCCCCCCCTCGATTGCAATGCTTGAGTAGC
AATCAAAATTCGCATGAAGGCACGGAAGAACTTTCGCTAATTTGAGAAGGTTTCGCTTTTGTTGTGCCATTCAGATTTCGTCCCCGCATTCTTATCGATGTCACCAAAGTCGATCTGAGC
ACCAATGTCTTGGGGTTCAACATCTCTATGCCCATCATGGTTGCTCCCACTGCCATGCAAAGGATGGCTCACCCCGACG
GTAGCTGCTCTTCTCCCCTCCGCTGCAAATTCTGAATTGCA
TCAACGACGTCTTTCTCTTCGAATTTTGTGAGTTAATATGATAATGTGATTGAGGTGCAGGCGAATTGGCTACTGCCAGGGCCACCGCTAAGGCCGGCACAATCATGGTAAGATTATCTG
TACAATCAGAAATCATTCTGCATGGCGCTTCTAATGATTTTTTTTGGACCAAAAAAGGATACCAGAAAAAAGAAAACAGGCACAAAAACAAACAAACAAACGAAGAAAACCGAGGCAACG
AAGAAGAAAAAACGTGCTTACGAATTTAGTGATGGATTTGTTAACTTGTTGCAGACGCTCTCCTCATGGTCTACCAGCAGCGTGGAAGAGGTTGCCTCCGTCGGCCCCGGCATCCGCTTC
TTCCAGCTCTACGTCTACAAGGACAGGAATGTTGTGGCCCAGCTTGTGCGCCGTGCCGAGAGGGCGGGCTTCAATGCCATAGCGCTCACAGTCGACACTCCTCGTCTCGGACGCCGAGAG
TCTGACATCAAGAACAG
GTATTGTCATGCACTCACCCTCGCCATGCATTGCCCTCATACAGCAATCAAAATTCGTGTATAGAAAAACTCTCAATTCTGATTTCTCAGCACGATCACTTAA
GGGCATTATGCCTCCAACATCTTTCCCATCATCCTGCAGATTCGCCTTGCCGAAACACCTCACCCTCGCCAACTTTGAGGGGCTGGACCTTGGACAGATGGACAAGGTAGGATCATTTGG
ATCGATGCCTATTTGCCATCTCCTCTCTTCTTACTGCAACGTGTGGACCTTTCTTCTGACGTTTCTCGAATGTTACAGCCTCTGACTTCTCGCCACCACACGCACTTACCTCTGTATGCG
GTGGGTTTGTATTGCAATCACACAGACCCAGGATTCCGGATTGGCTTCCTACGTCGCCGGTCAAATCGACAGGTCTCTGAGCTGGAAGGTGCGTAGCTCAACATGCTATCCCTTATCAAC
GGCATTGCATATTATGCAAAAAGAAATAAAGCAGTGTTTTCTTCTTCTCTGAAAATGCTTTTCTCGTTCTTTCGCAGGACGTGAAATGGTTGCAATCGATCACCGAGCTCCCTATCCTCG
TCAAGGGAGTCATCACCGCCGAAGACA
GTACGTGTCCTCTCCGCAAGCTAACTCTTCCGCAGAATATTTGCAATCAACTATCCTCCAATGCAAGGACGCTTTCATTGTGTAGTGACGCCT
CTTACTGACTCATCCATGGCTCGTTGGTGATGTCCACAGCCAAGCTTGCAATTCAAAACGGCGCAGCCGGCATCATAGTGTCAAATCACGGAGCCAGACAGCTCGATCACGTCTCGGCAA
CGATCTCAGCTCTTGAGGAG
GTTACTCACTCACTCACTCACTCACTCACCATCAGTTCATTCATGTGCAGCACTCAAACCCATTTCTCGCAAGAAAAATTCTATATCCACTACGCAAAAA
CCTGCAGAATGTGTTCCCAGCTTTCCATCCATTGTGTGCCAGGTCGTGCAAGCCGCAGCCGGTAGATTACCCGTGTTTCTGGACGGAGGCGTGCGTCGCGGGACCGACGTACTCAAGGCG
CTCGCTCTCGGCGCATCTGGCGTTTTC
GTGAGTAACCCTAATCCAAATTCCACCTTCTCCAGTAAAGAATTTCACGGCATGGGAGTAGGATTCCAGTCTTGAATCGCGCCCCTCCAGCTC
TTTCTCTGATTGTTTTTCGCTTGCACAGATTGGAAGGCCCGTAGTATTTGGGCTCGCATGCGACGGCCAGCAAGGAGTCGAGAAGGTCCTGCAGATGCTACGAGACGAATTTGAGTTGGC
CATGGCGCTCGCGGGCTGCACGAAGGTCTCAGACATCAGCCGAGCTCACGTTCAGACCGAGGTGGAGAGGTTTCACGCAAAGCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCCGTCTACCGAGATCGTGAACGTGTCCGAGTATGAGGAACTAGCGCGACAGAAGCTGCCAAAGATGGTGTACGATTATTACGCCTCCGGCGCTGAGGACCAATGGACTTTGAAGGAGA
ATCGTAGCGCTTTCGAGCGCATCAG
ATTTCGTCCCCGCATTCTTATCGATGTCACCAAAGTCGATCTGAGCACCAATGTCTTGGGGTTCAACATCTCTATGCCCATCATGGTTGCTCCCA
CTGCCATGCAAAGGATGGCTCACCCCGACG
GCGAATTGGCTACTGCCAGGGCCACCGCTAAGGCCGGCACAATCATGACGCTCTCCTCATGGTCTACCAGCAGCGTGGAAGAGGTTGCCT
CCGTCGGCCCCGGCATCCGCTTCTTCCAGCTCTACGTCTACAAGGACAGGAATGTTGTGGCCCAGCTTGTGCGCCGTGCCGAGAGGGCGGGCTTCAATGCCATAGCGCTCACAGTCGACA
CTCCTCGTCTCGGACGCCGAGAGTCTGACATCAAGAACAG
ATTCGCCTTGCCGAAACACCTCACCCTCGCCAACTTTGAGGGGCTGGACCTTGGACAGATGGACAAGACCCAGGATTCCG
GATTGGCTTCCTACGTCGCCGGTCAAATCGACAGGTCTCTGAGCTGGAAG
GACGTGAAATGGTTGCAATCGATCACCGAGCTCCCTATCCTCGTCAAGGGAGTCATCACCGCCGAAGACA
CCAAGCTTGCAATTCAAAACGGCGCAGCCGGCATCATAGTGTCAAATCACGGAGCCAGACAGCTCGATCACGTCTCGGCAACGATCTCAGCTCTTGAGGAGGTCGTGCAAGCCGCAGCCG
GTAGATTACCCGTGTTTCTGGACGGAGGCGTGCGTCGCGGGACCGACGTACTCAAGGCGCTCGCTCTCGGCGCATCTGGCGTTTTC
ATTGGAAGGCCCGTAGTATTTGGGCTCGCATGCG
ACGGCCAGCAAGGAGTCGAGAAGGTCCTGCAGATGCTACGAGACGAATTTGAGTTGGCCATGGCGCTCGCGGGCTGCACGAAGGTCTCAGACATCAGCCGAGCTCACGTTCAGACCGAGG
TGGAGAGGTTTCACGCAAAGCTGTGA

Retrieve as FASTA