Entry information : CbraGrxS01 (g22937/CHBRA273g00240)
Entry ID 13984
Creation 2016-10-24 (Christophe Dunand)
Last sequence changes 2016-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-04-19 (Christophe Dunand)
Peroxidase information: CbraGrxS01 (g22937/CHBRA273g00240)
Name (synonym) CbraGrxS01 (g22937/CHBRA273g00240)
Class CGFS Grx    [Orthogroup: GrxS004]
Taxonomy Eukaryota Viridiplantae Streptophyta Charophyceae Characeae Chara
Organism Chara braunii    [TaxId: 69332 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CbraGrxS01
start..stop
S start..stop
PpaGrxS04 290 8e-98 158..371 28..241
MpalGrxS01 286 2e-95 158..371 95..308
MpGrxS01 283 4e-94 158..371 95..308
ThasGrxS13 261 9e-86 143..371 59..290
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2020741..2021187 447 N° 2 2019963..2020646 684  
complement(join(2019963..2020646,2020741..2021187))


exon

Literature and cross-references CbraGrxS01 (g22937/CHBRA273g00240)
Protein sequence: CbraGrxS01 (g22937/CHBRA273g00240)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377
PWM (Da):   %s   39998.38  
PI (pH):   %s   9.4
Sequence 418
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSAGAACAAGGPFATVQTRRTSATTGCSLDGDSSSRCFLAVTRASCRTLWQSSVSRCETCPGLATSSGRSGGVTFASAAAVCRFRSPTAAFSLSFSRRLCSYSNGDDYDNEEDDRMHGRRLYKKKTVFLSDGISTTVGRRVGSGRKKVLGEGGKLSDKIPPAPGVYAIYDKNGALQYVGLSRKVSFSLANHAARLPDLVATVKIAIVDGPDRDALQAGWKSWVEEHVSAGGAVPPGNMQGNNTWKESSRRPPKADLRLTPGAHVPLTVPMETLIGAAIKGTPVIAFIKGTRSSPQCGFSHRVLMALNKEGVDYETVNVLDEEFNPGVREAIKAYSKWPTIPQVFINGELIGGADLLEESVEKGEFKQLLAAIKK*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCGCGGGAGCTGCTTGCGCTGCCGGTGGGCCATTCGCCACTGTGCAGACGCGAAGAACAAGTGCAACGACCGGTTGTTCACTTGACGGCGATTCGAGCTCGAGATGCTTC
CTGGCAGTCACGAGAGCGAGTTGTAGGACACTCTGGCAGTCGTCTGTCAGTCGGTGTGAGACGTGTCCAGGGCTAGCGACGAGTAGCGGGCGGAGCGGCGGAGTGACATTCGCGTCGGCG
GCGGCGGTGTGCAGATTCAGATCTCCTACTGCCGCTTTCTCGCTTTCTTTCTCTCGTCGGCTCTGTTCCTACAGTAATGGTGATGATTATGATAATGAGGAGGATGATAGAATGCATGGC
CGCCGTCTGTACAAGAAGAAGACGGTATTCCTTTCCGATGGGATATCGACGACAGTGGGAAGGCGGGTGGGGAGTGGTAGAAAAAAG
GTAGGTGGTCGCGGTGGCGGCGCGAGGTGGGGT
GTAGCAAGGGCGGCGGGGGGGGGAGGCAATCAAGCCGCTAGCAGAGACCGAGGCGGTGGAGGTATTGGGAGAGGGAGGTAAACTGTCAGACAAGATCCCGCCGGCGCCGGGTGTGTATGC
CATATATGACAAAAACGGCGCGCTGCAGTACGTCGGCCTTTCCCGCAAGGTGTCATTTAGCCTGGCCAATCACGCGGCGAGGCTACCAGATCTAGTGGCCACGGTGAAGATCGCGATCGT
TGACGGTCCGGATCGGGACGCGCTTCAGGCCGGCTGGAAATCCTGGGTGGAGGAACACGTGTCGGCCGGCGGAGCTGTCCCACCCGGTAACATGCAGGGCAATAACACGTGGAAGGAGTC
GTCGCGCCGCCCTCCGAAAGCCGATCTGCGGCTGACACCCGGCGCCCACGTGCCGCTCACTGTTCCCATGGAAACCCTAATCGGTGCGGCAATCAAGGGTACGCCCGTGATCGCCTTCAT
CAAAGGAACACGCAGCTCCCCCCAGTGCGGCTTCTCCCATCGGGTGTTGATGGCCCTGAACAAGGAGGGCGTTGACTACGAGACGGTCAACGTGCTTGATGAGGAGTTCAATCCGGGGGT
CAGGGAGGCAATCAAGGCCTATTCCAAATGGCCAACCATCCCACAAGTCTTTATAAATGGGGAGCTGATTGGAGGTGCTGATCTTCTGGAAGAGAGCGTCGAGAAGGGAGAGTTCAAGCA
ACTGCTGGCGGCAATCAAGAAATG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTCCGCGGGAGCTGCTTGCGCTGCCGGTGGGCCATTCGCCACTGTGCAGACGCGAAGAACAAGTGCAACGACCGGTTGTTCACTTGACGGCGATTCGAGCTCGAGATGCTTC
CTGGCAGTCACGAGAGCGAGTTGTAGGACACTCTGGCAGTCGTCTGTCAGTCGGTGTGAGACGTGTCCAGGGCTAGCGACGAGTAGCGGGCGGAGCGGCGGAGTGACATTCGCGTCGGCG
GCGGCGGTGTGCAGATTCAGATCTCCTACTGCCGCTTTCTCGCTTTCTTTCTCTCGTCGGCTCTGTTCCTACAGTAATGGTGATGATTATGATAATGAGGAGGATGATAGAATGCATGGC
CGCCGTCTGTACAAGAAGAAGACGGTATTCCTTTCCGATGGGATATCGACGACAGTGGGAAGGCGGGTGGGGAGTGGTAGAAAAAAG
GTATTGGGAGAGGGAGGTAAACTGTCAGACAAG
ATCCCGCCGGCGCCGGGTGTGTATGCCATATATGACAAAAACGGCGCGCTGCAGTACGTCGGCCTTTCCCGCAAGGTGTCATTTAGCCTGGCCAATCACGCGGCGAGGCTACCAGATCTA
GTGGCCACGGTGAAGATCGCGATCGTTGACGGTCCGGATCGGGACGCGCTTCAGGCCGGCTGGAAATCCTGGGTGGAGGAACACGTGTCGGCCGGCGGAGCTGTCCCACCCGGTAACATG
CAGGGCAATAACACGTGGAAGGAGTCGTCGCGCCGCCCTCCGAAAGCCGATCTGCGGCTGACACCCGGCGCCCACGTGCCGCTCACTGTTCCCATGGAAACCCTAATCGGTGCGGCAATC
AAGGGTACGCCCGTGATCGCCTTCATCAAAGGAACACGCAGCTCCCCCCAGTGCGGCTTCTCCCATCGGGTGTTGATGGCCCTGAACAAGGAGGGCGTTGACTACGAGACGGTCAACGTG
CTTGATGAGGAGTTCAATCCGGGGGTCAGGGAGGCAATCAAGGCCTATTCCAAATGGCCAACCATCCCACAAGTCTTTATAAATGGGGAGCTGATTGGAGGTGCTGATCTTCTGGAAGAG
AGCGTCGAGAAGGGAGAGTTCAAGCAACTGCTGGCGGCAATCAAGAAATG

Retrieve as FASTA