Entry information : AtAPR02 (AT1G62180|APR2/APSR/ATAPR2/PRH/PRH43)
Entry ID 14105
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-10-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-27 (Christophe Dunand)
Peroxidase information: AtAPR02 (AT1G62180|APR2/APSR/ATAPR2/PRH/PRH43)
Name (synonym) AtAPR02 (AT1G62180|APR2/APSR/ATAPR2/PRH/PRH43)
Class Thioredoxin Type APR    [Orthogroup: APR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtAPR02
start..stop
S start..stop
ThasAPR01 749 0 1..447 1..458
ThasAPR02 746 0 1..447 1..465
ThasAPR03 705 0 17..447 21..466
AtAPR03 697 0 27..447 26..458
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 161..242 82 N° 2 375..512 138 N° 3 618..726 109 N° 4 818..1832 1015
join(161..242,375..512,618..726,818..1832)


exon

Literature and cross-references AtAPR02 (AT1G62180|APR2/APSR/ATAPR2/PRH/PRH43)
Omic ref. AtProteome:   At1g62180 ATTED-II:   At1g62180 e-FP Browser:   At1g62180 ePlant:   At1g62180 TAIR:   At1g62180
Protein sequence: AtAPR02 (AT1G62180|APR2/APSR/ATAPR2/PRH/PRH43)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   448
PWM (Da):   %s   49895.59  
PI (pH):   %s   7.13
Sequence 489
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALAVTSSSTAISGSSFSRSGASSESKALQICSIRLSDRTHLSQRRYSMKPLNAESHSRSESWVTRASTLIAPEVEDFEQLAKKLEDASPLEIMDKALERFGDQIAIAFSGAEDVALIEYARLTGKPFRVFSLDTGRLNPETYRLFDAVEKQYGIRIEYMFPDAVEVQALVRNKGLFSFYEDGHQECCRVRKVRPLRRALKGLKAWITGQRKDQSPGTRSEIPIVQVDPVFEGLDGGVGSLVKWNPLANVEGADVWNFLRTMDVPVNALHAQGYVSIGCEPCTRPVLPGQHEREGRWWWEDAKAKECGLHKGNIKEEDGAADSKPAAVQEIFESNNVVALSKGGVENLLKLENRKEAWLVVLYAPWCPFCQAMEASYIELAEKLAGKGVKVAKFRADGEQKEFAKQELQLGSFPTILLFPKRAPRAIKYPSEHRDVDSLMSFVNLLR*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTTAGCTGTTACTTCTTCTTCAACTGCAATCTCTGGATCGAGTTTCTCTCGTTCTGGAGCTTCTTCTGAATCTAAAGGTACTAACTTTCTCTTTCATTTTCTCTGGAAAATACCCA
AAATCGAATCTTTGATTGTTCATTGTTATACCCATTTGCTGGATTGTGTTGAATCTAACCAGAAATTTTGAAATCTGGTGTCTTTTTTTGCAGCTCTTCAAATATGTTCGATTAGGTTAT
CTGATCGAACCCATTTGTCTCAGAGACGTTACTCTATGAAACCTTTAAACGCTGAGTCACATTCACGAAGCGAATCTTGGGTTACTCGTGCTTCAACTCTAATTGCTCCTG
GTTCGTGCT
TGTCACTATTCTCAGATTTCGAATTTCATTTTCTGATTGATTTTGCTGATTTTCGATTTTGATGGATTGTAACAGAAGTTGAAGAGAAAGGAGGAGAAGTTGAAGACTTTGAGCAACTTG
CTAAAAAGCTTGAAGATGCTTCTCCACTTGAAATCATGGATAAAGCTCTTGAGAGATTCGGAGACCAAATCGCAATTGCTTTTAG
GTATCATTGATTATACATCATTGAGCAATTGATTC
AGTTAGGATAAAAAATAAAACTTTAGTTGACTTATGAATCTGGTTTTGATTTGCAGTGGAGCTGAAGATGTTGCATTGATTGAATATGCACGTTTAACTGGAAAGCCATTTAGGGTTTTT
AGTTTAGATACAGGGAGATTAAACCCTGAAACGTACAGGCTCTTTGACGCAGTCGAGAAGCAGTACGGGATTCGAATTGAGTACATGTTTCCTGATGCAGTTGAGGTTCAAGCTTTAGTG
AGGAACAAGGGTTTGTTCTCATTCTATGAAGATGGTCATCAAGAGTGTTGCCGTGTGAGGAAAGTTAGACCTTTGCGTCGTGCTCTTAAGGGTCTTAAAGCTTGGATTACAGGACAGAGG
AAAGACCAATCTCCGGGTACGAGATCTGAGATCCCTATTGTTCAGGTTGATCCAGTGTTTGAAGGGTTAGATGGCGGTGTTGGAAGTCTTGTGAAGTGGAATCCTTTGGCTAATGTTGAA
GGAGCTGATGTGTGGAACTTTCTGAGAACTATGGATGTTCCGGTGAATGCATTGCACGCACAAGGGTATGTGTCAATCGGGTGTGAGCCGTGTACTAGGCCGGTGCTTCCAGGCCAACAT
GAGAGAGAAGGAAGGTGGTGGTGGGAAGATGCTAAAGCTAAAGAATGTGGTCTACACAAAGGGAACATCAAGGAGGAAGATGGTGCTGCAGACTCAAAGCCTGCTGCTGTGCAAGAGATA
TTTGAAAGCAACAATGTGGTTGCATTGAGCAAAGGAGGGGTTGAGAATCTTTTGAAGCTAGAGAACCGTAAAGAGGCGTGGTTGGTCGTACTTTACGCTCCTTGGTGCCCTTTCTGCCAG
GCGATGGAAGCATCGTACATCGAATTGGCTGAGAAACTTGCGGGAAAAGGAGTTAAAGTGGCGAAATTCCGAGCTGACGGTGAGCAGAAGGAGTTTGCTAAGCAAGAGCTTCAGTTAGGG
AGCTTCCCGACGATACTTCTCTTTCCGAAAAGAGCTCCACGGGCTATTAAGTACCCTTCAGAGCATAGAGATGTTGATTCACTCATGTCGTTTGTGAATCTTCTTCGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTTAGCTGTTACTTCTTCTTCAACTGCAATCTCTGGATCGAGTTTCTCTCGTTCTGGAGCTTCTTCTGAATCTAAAGCTCTTCAAATATGTTCGATTAGGTTATCTGATCGAACCC
ATTTGTCTCAGAGACGTTACTCTATGAAACCTTTAAACGCTGAGTCACATTCACGAAGCGAATCTTGGGTTACTCGTGCTTCAACTCTAATTGCTCCTG
AAGTTGAAGACTTTGAGCAAC
TTGCTAAAAAGCTTGAAGATGCTTCTCCACTTGAAATCATGGATAAAGCTCTTGAGAGATTCGGAGACCAAATCGCAATTGCTTTTAG
TGGAGCTGAAGATGTTGCATTGATTGAATATG
CACGTTTAACTGGAAAGCCATTTAGGGTTTTTAGTTTAGATACAGGGAGATTAAACCCTGAAACGTACAGGCTCTTTGACGCAGTCGAGAAGCAGTACGGGATTCGAATTGAGTACATGT
TTCCTGATGCAGTTGAGGTTCAAGCTTTAGTGAGGAACAAGGGTTTGTTCTCATTCTATGAAGATGGTCATCAAGAGTGTTGCCGTGTGAGGAAAGTTAGACCTTTGCGTCGTGCTCTTA
AGGGTCTTAAAGCTTGGATTACAGGACAGAGGAAAGACCAATCTCCGGGTACGAGATCTGAGATCCCTATTGTTCAGGTTGATCCAGTGTTTGAAGGGTTAGATGGCGGTGTTGGAAGTC
TTGTGAAGTGGAATCCTTTGGCTAATGTTGAAGGAGCTGATGTGTGGAACTTTCTGAGAACTATGGATGTTCCGGTGAATGCATTGCACGCACAAGGGTATGTGTCAATCGGGTGTGAGC
CGTGTACTAGGCCGGTGCTTCCAGGCCAACATGAGAGAGAAGGAAGGTGGTGGTGGGAAGATGCTAAAGCTAAAGAATGTGGTCTACACAAAGGGAACATCAAGGAGGAAGATGGTGCTG
CAGACTCAAAGCCTGCTGCTGTGCAAGAGATATTTGAAAGCAACAATGTGGTTGCATTGAGCAAAGGAGGGGTTGAGAATCTTTTGAAGCTAGAGAACCGTAAAGAGGCGTGGTTGGTCG
TACTTTACGCTCCTTGGTGCCCTTTCTGCCAGGCGATGGAAGCATCGTACATCGAATTGGCTGAGAAACTTGCGGGAAAAGGAGTTAAAGTGGCGAAATTCCGAGCTGACGGTGAGCAGA
AGGAGTTTGCTAAGCAAGAGCTTCAGTTAGGGAGCTTCCCGACGATACTTCTCTTTCCGAAAAGAGCTCCACGGGCTATTAAGTACCCTTCAGAGCATAGAGATGTTGATTCACTCATGT
CGTTTGTGAATCTTCTTCGGTGA

Retrieve as FASTA