Entry information : AtAPR03 (AT4G21990|APR3/ATAPR3/PRH-26/PRH26)
Entry ID 14123
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-10-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-10-27 (Christophe Dunand)
Peroxidase information: AtAPR03 (AT4G21990|APR3/ATAPR3/PRH-26/PRH26)
Name (synonym) AtAPR03 (AT4G21990|APR3/ATAPR3/PRH-26/PRH26)
Class Thioredoxin Type APR    [Orthogroup: APR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtAPR03
start..stop
S start..stop
ThasAPR03 766 0 23..458 28..466
AtAPR01 759 0 22..458 23..465
ThasAPR01 744 0 1..458 1..458
HaAPR01 731 0 1..458 1..463
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 195..273 79 N° 2 416..550 135 N° 3 637..772 136 N° 4 858..1880 1023
N° 5 1977..1980 4  
join(195..273,416..550,637..772,858..1880,1977..1980)


exon

Literature and cross-references AtAPR03 (AT4G21990|APR3/ATAPR3/PRH-26/PRH26)
Omic ref. AtProteome:   At4g21990 ATTED-II:   At4g21990 e-FP Browser:   At4g21990 ePlant:   At4g21990 TAIR:   At4g21990
Protein sequence: AtAPR03 (AT4G21990|APR3/ATAPR3/PRH-26/PRH26)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   459
PWM (Da):   %s   50662.99  
PI (pH):   %s   6.78
Sequence 500
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALAINVSSSSSSAISSSSFPSSDLKVTKIGSLRLLNRTNVSAASLSLSGKRSSVKALNVQSITKESIVASEVTEKLDVVEVEDFEELAKRLENASPLEIMDKALEKFGNDIAIAFSGAEDVALIEYAHLTGRPYRVFSLDTGRLNPETYRLFDTVEKHYGIRIEYMFPDAVEVQALVRNKGLFSFYEDGHQECCRIRKVRPLRRALKGLRAWITGQRKDQSPGTRSEIPVVQVDPVFEGLDGGVGSLVKWNPVANVEGNDVWNFLRTMDVPVNTLHAAGYVSIGCEPCTRAVLPGQHEREGRWWWEDAKAKECGLHKGNIKENTNGNATANVNGTASVADIFNSENVVNLSRQGIENLMKLENRKEAWIVVLYAPWCPFCQAMEASFDELADKLGGSGVKVAKFRADGDQKDFAKKELQLGSFPTILVFPKNSSRPIKYPSEKRDVDSLTSFLNLVR*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCACTAGCAATCAACGTTTCTTCATCTTCTTCTTCTGCGATCTCAAGCTCTAGCTTCCCTTCTTCAGATCTCAAAGGTAATTTATTTCATTTTCAATACCAAATTCGTGGAGAATCTT
AGAAATGCCTTGATTGGTCATTGTGTTTTGGTTTTAAATTCGTTCAAATTCGATCAATGTCGAATCTTATTCAATTTGTTTGTTTGATTCTTCAATACAGTAACAAAAATCGGATCATTG
AGGTTATTGAATCGTACCAATGTCTCTGCGGCTTCTCTGAGTTTGTCCGGGAAGAGATCCTCCGTGAAAGCTCTTAATGTGCAATCAATTACAAAGGAATCCATTGTTGCTTCTG
GTAAG
TTCTGGTTTGATTTTTCAATTGATCATTGGTTAATTTGATTAAGGTTTATGCTAATGATCTTGTGCTTCATTACAAAACAGAGGTTACAGAGAAGCTAGATGTGGTGGAAGTTGAAGACT
TTGAGGAACTAGCAAAGAGATTAGAGAATGCTTCTCCTCTTGAGATCATGGATAAAGCTCTTGAGAAGTTTGGGAATGACATTGCTATTGCCTTTAG
GTAATGAATTGAATCATGAGAAT
ACAATAAAGGAATGTTTTTGTTTTCCTTTAGTTTGCTGATTTGTTGTTTTGTTTGGTTTCAGTGGAGCTGAAGATGTTGCTCTGATTGAGTATGCTCATTTAACTGGAAGACCTTATAGG
GTATTCAGTTTGGATACAGGGAGATTGAATCCAGAAACATATAGACTCTTCGATACCGTGGAGAAACATTACGGTATTCGGATTGAGTATATGTTTCCTGATGCTGTTGAGGTTCAAGCT
TTAGTTAGGAACAAGGGTTTGTTCTCTTTCTATGAAGATGGTCACCAGGAGTGTTGCCGTATTAGAAAGGTGAGACCTTTGAGGCGTGCGTTGAAGGGTTTACGTGCTTGGATCACTGGT
CAGAGGAAAGATCAATCACCCGGGACAAGATCGGAGATTCCTGTTGTTCAGGTTGATCCAGTGTTTGAAGGATTAGATGGTGGAGTTGGTAGTTTGGTGAAGTGGAATCCGGTTGCTAAT
GTTGAAGGGAATGATGTTTGGAATTTCTTGAGGACGATGGATGTTCCTGTCAACACGCTTCACGCTGCGGGTTATGTTTCAATCGGATGTGAGCCATGCACGAGAGCGGTTTTGCCGGGT
CAGCATGAGAGAGAAGGGAGATGGTGGTGGGAAGATGCTAAGGCTAAAGAGTGTGGCCTTCACAAAGGGAATATCAAGGAGAATACCAATGGAAACGCAACCGCTAATGTCAACGGGACA
GCCTCAGTCGCGGATATCTTCAATAGCGAGAATGTTGTGAACTTGAGCAGGCAAGGGATTGAGAATTTGATGAAGTTAGAGAACCGGAAAGAGGCTTGGATCGTTGTGCTTTATGCACCG
TGGTGCCCGTTTTGTCAGGCAATGGAAGCTTCATTCGATGAATTGGCGGATAAGCTGGGAGGAAGTGGTGTGAAGGTTGCTAAGTTTAGAGCTGATGGTGACCAGAAGGACTTTGCCAAA
AAGGAGTTGCAGCTTGGAAGCTTTCCAACAATACTTGTGTTCCCAAAGAACTCTTCAAGACCAATCAAGTATCCATCAGAGAAGAGAGATGTTGATTCTTTGACATCTTTCTTGAATCTT
GTTCG
GTAAATCCGCAATAAAATCCGCCGACTCTACGATGACGAAGAGATCAATAATAGACCATCCAGTCTCGTTCCAGATTGCTAGAACAGATGAAGAAGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCACTAGCAATCAACGTTTCTTCATCTTCTTCTTCTGCGATCTCAAGCTCTAGCTTCCCTTCTTCAGATCTCAAAGTAACAAAAATCGGATCATTGAGGTTATTGAATCGTACCAATG
TCTCTGCGGCTTCTCTGAGTTTGTCCGGGAAGAGATCCTCCGTGAAAGCTCTTAATGTGCAATCAATTACAAAGGAATCCATTGTTGCTTCTG
AGGTTACAGAGAAGCTAGATGTGGTGG
AAGTTGAAGACTTTGAGGAACTAGCAAAGAGATTAGAGAATGCTTCTCCTCTTGAGATCATGGATAAAGCTCTTGAGAAGTTTGGGAATGACATTGCTATTGCCTTTAG
TGGAGCTGAAG
ATGTTGCTCTGATTGAGTATGCTCATTTAACTGGAAGACCTTATAGGGTATTCAGTTTGGATACAGGGAGATTGAATCCAGAAACATATAGACTCTTCGATACCGTGGAGAAACATTACG
GTATTCGGATTGAGTATATGTTTCCTGATGCTGTTGAGGTTCAAGCTTTAGTTAGGAACAAGGGTTTGTTCTCTTTCTATGAAGATGGTCACCAGGAGTGTTGCCGTATTAGAAAGGTGA
GACCTTTGAGGCGTGCGTTGAAGGGTTTACGTGCTTGGATCACTGGTCAGAGGAAAGATCAATCACCCGGGACAAGATCGGAGATTCCTGTTGTTCAGGTTGATCCAGTGTTTGAAGGAT
TAGATGGTGGAGTTGGTAGTTTGGTGAAGTGGAATCCGGTTGCTAATGTTGAAGGGAATGATGTTTGGAATTTCTTGAGGACGATGGATGTTCCTGTCAACACGCTTCACGCTGCGGGTT
ATGTTTCAATCGGATGTGAGCCATGCACGAGAGCGGTTTTGCCGGGTCAGCATGAGAGAGAAGGGAGATGGTGGTGGGAAGATGCTAAGGCTAAAGAGTGTGGCCTTCACAAAGGGAATA
TCAAGGAGAATACCAATGGAAACGCAACCGCTAATGTCAACGGGACAGCCTCAGTCGCGGATATCTTCAATAGCGAGAATGTTGTGAACTTGAGCAGGCAAGGGATTGAGAATTTGATGA
AGTTAGAGAACCGGAAAGAGGCTTGGATCGTTGTGCTTTATGCACCGTGGTGCCCGTTTTGTCAGGCAATGGAAGCTTCATTCGATGAATTGGCGGATAAGCTGGGAGGAAGTGGTGTGA
AGGTTGCTAAGTTTAGAGCTGATGGTGACCAGAAGGACTTTGCCAAAAAGGAGTTGCAGCTTGGAAGCTTTCCAACAATACTTGTGTTCCCAAAGAACTCTTCAAGACCAATCAAGTATC
CATCAGAGAAGAGAGATGTTGATTCTTTGACATCTTTCTTGAATCTTGTTCG
GTGA

Retrieve as FASTA