Entry information : KflLilium01 (KFL_002790060)
Entry ID 14178
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-11-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-11-09 (Christophe Dunand)
Peroxidase information: KflLilium01 (KFL_002790060)
Name (synonym) KflLilium01 (KFL_002790060)
Class Thioredoxin Type Lilium    [Orthogroup: Lilium001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflLilium01
start..stop
S start..stop
PpaLilium02 219 4e-72 41..232 26..221
PpaLilium01 219 4e-72 41..232 26..221
CbraLilium01 211 3e-67 85..229 109..252
HaLilium04 198 6e-64 86..247 60..220
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33309..33755 447 N° 2 34468..34632 165 N° 3 35305..35457 153  
join(33309..33755,34468..34632,35305..35457)


exon

Literature and cross-references KflLilium01 (KFL_002790060)
Protein sequence: KflLilium01 (KFL_002790060)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   254
PWM (Da):   %s   26999.7  
PI (pH):   %s   8.28
Sequence 295
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEAVLWRDSCQCGLLGARRKGPQPPVVSCKSAVPLLGEHSLHNRAAPASGSSLPRHLSSCCREALPPTTRLSGHTLFDPRPQGKRQGHVVAAAPGDSTARWWEREGGPNVRDVHSIGDFVEELAGAGESLVVVEFYASWCGSCRALLPKLLKIAAEHPDVTFLKVNFDECKAMCKSLNIKVLPFFHFYRGADGRLDAFSASISKLAKLREAIEVHNTERCSLGPAIGVGPDFDWEAAARANAAAAAAAKAAAAH

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGGCGGTGCTTTGGCGTGACAGTTGCCAATGTGGCCTTCTCGGCGCACGCAGGAAGGGGCCACAGCCCCCGGTTGTCAGCTGCAAGTCTGCCGTGCCGTTGCTAGGAGAGCACTCGT
TGCACAATCGGGCTGCGCCTGCATCAGGCTCTAGTTTGCCCAGGCACCTTTCGAGTTGCTGCAGAGAAGCGCTTCCACCCACAACACGGTTGAGTGGGCACACGTTGTTTGATCCGCGCC
CTCAGGGGAAGAGGCAGGGTCATGTGGTGGCAGCTGCCCCGGGCGACAGCACTGCGCGGTGGTGGGAGCGAGAAGGGGGCCCCAACGTGCGTGACGTGCACAGCATTGGGGACTTTGTTG
AGGAGCTGGCAGGCGCAGGAGAGAGCCTGGTGGTGGTTGAGTTCTACGCCAGCTGGTGCGGCTCGTGCAGGGCACTGCTGCCCAAG
GTGAGCAAGCAGGCTGCGGCGCCCGGCCGGTGTG
AAGGGCCTAGACTGAGGGACGCCGCTGTCACCCTTTTACATGCTTGGAGTGGTTCCTGCGGTCTTCAAAAGCTTGGAAAAGCACTTGGTCAAGACAGGTCATGCACGGCCCAACATTTGG
GTGCAACAGAACTACTGTTATCCGGATGTTTGCCGGGGCCAGGAGCGCAGGGGGCCCCTCGTGGAAGAGTCACCTCGGGATCACTTCGATCCCCGGCCTATACAAGCTCTATGCAGAATA
GCTAATGAAACTTATCAATTGGCTGAGCCATGCGAGCCAAAGTTCGACTTCGGCCCAGTGATAGTTGGCTCTGCTGCAAGGCCCCAGGGCCGCTTCAGGGCATGCGACCAAACTTGGAGC
ACCCGCCATCCCGTTTTGGTTGGAGTTTGGGGTAGCCCACATTGTCCGCTCTAGCTTTGCTGTTTTGCAGCAGATTTAAGCGTGCGCTGTGCGCATGGTGCAACATGACTTCTCAAAGAT
CAGTATGTGCAGGTTCATCAGGAAGGGCTGCTGCCGGCGTTAATGTTCTTCGACATCTGTTGAGAGTGCATTCTCAACGTAATAATTAGCGTCATGCAAGTTTGCCCCGTTGCCAAGGCA
CCAATTCGCAATTCTGGACCGGAGTTGGAGGTGTGTCGTCTCGCTAAATCCTTTCGTGTCCCTATTTTGTGTGCGCAGCTGCTCAAAATTGCGGCGGAGCACCCCGACGTGACCTTCCTC
AAGGTCAACTTCGATGAGTGTAAGGCCATGTGCAAGAGCCTGAACATCAAGGTCCTCCCTTTCTTCCACTTTTACCGTGGCGCAGATGGCCGCCTGGACGCCTTCTCCGCCTCCATCTCC
AAG
GTAAGGCCATCGCTCGCGGGTGTGCATGTCCTGACAGCGGCCACCAGGCTTCAGCTAAGGTTGGCGGCCTTCCATTTCGTTGGTCTCCAGCTGAGCATCGGTTTAGAAGTCACAGAT
TGAGGCTGGATGTGCTGATGGTGGAGGCACATACGTTCAAATAACATAGTTTCCACCTTTAGTTGTGATGAGTATGTAAGGAACAATCATTCCTGAGGACTCCTTGAGATCATCTTCCAA
ATATGATCGTTTGGCATCGTTCATCGCTGGCAGGATGACCCTCTGTATTGCTTGATGAGGAGTTCTGTAAGATGGGGATGCGCAAAAAAGCTCTTTGCATCCTACTGCACTTTTTTAAAC
GTCTTCATTTGATCGCACTTTCATGTCCGATCACTACTAGCATTGAGAACACATTGGACGGATACATACTTGATTTCGTTCTTCAAAGGTGGTTGGTTATCATGCGGACAGTCACTGTGA
CTCATCAAATTGTGCACGTAGAAGCATCCATATATTAGCAGAGCTCTGAGAGTTAATTTTCTTGCTCTTAGGCTCAAGCCTGTTTCTCCTTCCCACAGCTGTGGTGTTCTATGCTACATT
CTCTGCGTTAGAGGGGAGCATGAATCCAACTGGAAGTGTCGGATTTTCCTGCTGATTGTGGTGTTGTTGATGCAGTTGGCAAAGCTTCGAGAGGCTATTGAGGTGCACAACACCGAAAGG
TGTAGCTTGGGACCTGCAATTGGGGTGGGCCCCGACTTCGATTGGGAAGCTGCAGCGCGAGCGAATGCTGCAGCCGCGGCTGCCGCAAAAGCCGCTGCCGCGCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGGCGGTGCTTTGGCGTGACAGTTGCCAATGTGGCCTTCTCGGCGCACGCAGGAAGGGGCCACAGCCCCCGGTTGTCAGCTGCAAGTCTGCCGTGCCGTTGCTAGGAGAGCACTCGT
TGCACAATCGGGCTGCGCCTGCATCAGGCTCTAGTTTGCCCAGGCACCTTTCGAGTTGCTGCAGAGAAGCGCTTCCACCCACAACACGGTTGAGTGGGCACACGTTGTTTGATCCGCGCC
CTCAGGGGAAGAGGCAGGGTCATGTGGTGGCAGCTGCCCCGGGCGACAGCACTGCGCGGTGGTGGGAGCGAGAAGGGGGCCCCAACGTGCGTGACGTGCACAGCATTGGGGACTTTGTTG
AGGAGCTGGCAGGCGCAGGAGAGAGCCTGGTGGTGGTTGAGTTCTACGCCAGCTGGTGCGGCTCGTGCAGGGCACTGCTGCCCAAG
CTGCTCAAAATTGCGGCGGAGCACCCCGACGTGA
CCTTCCTCAAGGTCAACTTCGATGAGTGTAAGGCCATGTGCAAGAGCCTGAACATCAAGGTCCTCCCTTTCTTCCACTTTTACCGTGGCGCAGATGGCCGCCTGGACGCCTTCTCCGCCT
CCATCTCCAAG
TTGGCAAAGCTTCGAGAGGCTATTGAGGTGCACAACACCGAAAGGTGTAGCTTGGGACCTGCAATTGGGGTGGGCCCCGACTTCGATTGGGAAGCTGCAGCGCGAGCGA
ATGCTGCAGCCGCGGCTGCCGCAAAAGCCGCTGCCGCGCACTGA

Retrieve as FASTA