Entry information : KflTDX02 (Kfl_000160290)
Entry ID 14180
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-11-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-11-09 (Christophe Dunand)
Peroxidase information: KflTDX02 (Kfl_000160290)
Name (synonym) KflTDX02 (Kfl_000160290)
Class Thioredoxin Type TDX    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflTDX02
start..stop
S start..stop
CbraTDX01 103 5e-26 415..494 98..177
KflTrxH03 95 8e-24 395..497 6..110
HaTDX01 99 6e-23 251..496 87..361
AtTDX01 91 3e-20 221..497 111..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 195496..195594 99 N° 2 196006..196173 168 N° 3 196571..196717 147 N° 4 197479..197703 225
N° 5 198202..198554 353 N° 6 198837..199108 272 N° 7 199472..199628 157 N° 8 200275..200371 97
join(195496..195594,196006..196173,196571..196717,197479..197703,198202..198554, 198837..199108,199472..199628,200275..200371)


exon

Literature and cross-references KflTDX02 (Kfl_000160290)
Protein sequence: KflTDX02 (Kfl_000160290)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   505
PWM (Da):   %s   54324.64  
PI (pH):   %s   7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGGGDKCTPSSEDDAHDVNGGHEKQQGSKEAEELKNQGNELYQAGRVKDALSKFDEAVSKSPDVAVYRANKAAALSSLGRLGEAMLESKKAVELDDNYARAHERLANLCLRLGRFKEAKKHFEKAGEGGKDGQKRADQLDQHAKAALCARDKGEWEKALREADATIQGGADADCTLLGVKAEALQNLGRSDEAEKARAQAEKAAADAGTPAIRDPVISMLRAKIAASTGNFDGAVAAAERAVKLDPDNCAAIQTLKQVRALANARTRGNDLFKAGDFGGAEKAYSEGLETPLGKENAFLLSNRAAARSKQGHWEEALADADKATRAYPNYSKAKLRRAHAYRNLGRHEEAVRDLEELAAAAPYDADLGRELWEANRELAQSRGEDVSGWKFTPPGGLVDVTSDQQYRERVNGPGLVVGYFATWCGPCRQIAPVIKKLPEKYPGLSIMKVDIDSHQQLAAAEGVASVPTFKVYKNGRKVNEITGANAPLLDQVISQNLQDILKKV

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGGCGGCGACAAATGTACTCCTTCATCTGAAGATGATGCTCACGACGTCAATGGAGGACATGAGAAGCAGCAGGGGAGCAAAGAAGCCGAAGAGGTACATTGTCCTGCAGGAAAT
TGACTCTGGTTCTTGTGCATTTTCTTTAGTTTTGGGACTTGTGCTTTGATGCAATGCCACATCACGGCCTGAAAGTGCCATGCATACAATTCAATGTCTGCTGAACTTGATCGTGCAATG
CTGTCAATGCACAGTTCAGTGTAACAAGTGGGGAGAAATAAGTGGTCGATGCTTGAATCTTGCTAAAACGCCAATGATGCTGTTCAGTCAAAACAGGCAATCATGCCAACTTTTGATCAA
GCAAGGAGCAAGAGCCTTTTGCGATTGAGCAACCGCTAGGAAACTTGAGAGCGGGTGGTGTTATTCGAAATGAGAACATCGAAATGAAACAACTGAACCTTGGAGCGGAAAACTCTCTCT
CAGACTCGCTTCCACGTGCTCCCTCTGCAGCTCAAGAACCAGGGGAATGAGCTGTATCAAGCTGGGAGGGTCAAAGATGCACTATCCAAATTTGACGAGGCCGTCTCAAAGTCCCCCGAT
GTGGCTGTCTACCGAGCCAACAAAGCAGCAGCTCTGTCCAGCCTGGGCAGGCTGGGGGAGGCAATGCTGGAAAGCAAG
GTGGGCCTGCTTAACGACTTCGGCGGCGGGAACGTTCTGAAG
AGGCGTCTTTCATGGATATATCATTCATCTGAGCTTGGAAAGATTGCCTTTGTGCTCAATTGAGTGTGTAGCGTCACCCACATGGATTTTGACCATTGATGTCATTCTTGCTTGGCTTAA
GGCCTTCTCTAAGTTCCAAATCTATAAGACCTGGAATTTGTAGCGCATCTTTAGAGTGCATGTGTTTAGCGATTCTGTGGAGGCCTTTGTCTAGTGTCCAAGGCAAGCTTTTTGGTTGAG
CCTTTTGACACAAGATACCTCAGAAGAAGAAGGCCATCTTGTTGCTTCTCAATACACTTCACATAAACTGATTGCATATGCATGACAACCAAAACAAAGCTTCTGTCTGCTGCAGAAAGC
AGTAGAGCTAGACGACAACTATGCACGAGCCCATGAACGGCTGGCAAACCTGTGCCTGAGGCTTGGAAGGTTCAAGGAGGCGAAGAAACACTTCGAAAAGGCTGGCGAGGGAGGAAAGGA
TGGTCAAAAGCGGGCTGACCAG
GTGAGGGATGTCAAACCTGGTGTGCCTCAATCAGGCTGCTAGTACGTATGAATGGGTGTGAGAGCGGGAATGAATCAGATGTGCATGAGACGGACTTA
GCTTAACCTTGAGGCGTTGATCTTGTTTTGTTTCGAAGGCTGAGGTGTCTGCTAAACACGGGGCACCTTGGGCAAGCAATAGAGCTGGACCTGCATACCGCAAATTCAGTCAAGGGTCGA
TCCGAGGAGAATCTTTCTCGATTACACCAGTCAACTTCTCCTAGATCAATATAGAATCATTGTCAAGGATTAATGAACATAGAGCAGAGGTCAGTGCAATTCTTGCACCTAAAGCTCTTG
TATGTGACTGGAAGACAGACGAGAGGCTTCAGGGGTAAGTCGTATTGACTCTCTAGTTCGCCCTTTGTTCCGCAGACTAGATGTTATCTATAGCTAGAGCATCTTCGCTCGGACCAGTCG
CTACCCTCTTGGAACTCCCAATCTCATGGCACTACATCGTTATGTCATTACCATTTTCCATCAGCTCACTGCAAATCCGGTCAAACCTGGCCGCCTGACCTGAGTCCGGTTTGAGCCTGT
CGCAAAACTGTACCCAATGCGCACAATCCGGACCCTTTGATGTCCTGGATGCTAAGGAACGGACGGCCGAAGTTCTGCATCTTTGGCCGGGATTTTGCAAAAACATCAACATAGTGATTG
GGTCAGGCCAGGTTTGACCAAACTCGCAGTATCATCGGATCAACAGCCGCCCTCTGTCTCCAGCTGGATCAGCACGCCAAGGCCGCCTTGTGTGCGCGTGACAAGGGTGAGTGGGAGAAG
GCACTGCGAGAAGCGGACGCCACAATTCAGGGGGGCGCCGACGCTGACTGCACCCTGCTGGGAGTGAAGGCAGAGGCACTCCAGAATCTGGGCCGGAGCGACGAAGCGGAGAAGGCGCGT
GCGCAAGCGGAGAAAGCGGCAGCGGATGCAGGGACACCGGCCATCAGG
GTGAGCAACGGACAAGGAGGGTCTGCTGTAGGCCTGTGTAAGTTTGTCTAATGGGGAACCCTTCTCTGAAAA
TTTCGATGTCGGTGGAAAATGTGGGGGAGTTTGCCTCGTAGTCCGGGTTTGCCGGCTTTCGTATGGAGAGATTTGCTTCCTTGTACGAGGAAGGAGACGAGATGTTGGTGAGCTGGCCTG
GTTAGACTTCAGCCCCCACCGTCTGCACTTTCCTTTTTCAAAGTGCTATTGCTTATGCTGGTGCTCGGCGATGACGCAAACGGCTCCGGTCAATTAATGACGCCTTCTGTGCTGGATAGC
TGTGAGCCGTGGTAATGACACGGTTGTCCTCGTCTGTATGCTGTCTTCATCTTTATCTTCGGCGTCGCAACGATTCAATAGATGCCCCATGGGCCCCACGCTTCTCTTCCCTTCAGCAGA
AGACGTTTGCTTCAAGTTTTTAAGAACGAGCCCCTCAAAAGAGTCTCCCGTGTTCCCTCTCGTCAGGATCCGGTCATCTCCATGCTGCGCGCGAAGATCGCCGCCTCGACGGGCAACTTC
GACGGCGCCGTCGCGGCCGCCGAGCGCGCCGTGAAGCTCGACCCCGACAACTGCGCCGCCATCCAAACCTTAAAGCAGGTGCGCGCGCTGGCAAACGCGCGCACCCGCGGGAACGACCTG
TTCAAGGCGGGCGACTTCGGGGGGGCCGAGAAGGCGTACTCGGAGGGCCTGGAAACCCCCCTGGGAAAGGAGAACGCGTTCCTGCTGTCGAACCGGGCGGCCGCGCGGTCGAAGCAGGGC
CACTGGGAGGAGGCGCTCGCGGACGCGGACAAAGCTACGCGCGCATATCCGAACTACAG
GTGGGGTGCCTGTGTGCGGTGTAGCGAGTGACATCCTAGGCGTCGAAAAATGTTGCAAGCA
GTGGCTGCCCCGCTTCGACACAACGTATTCAAGCGTCCCTCTCGAAATGTTTCACCCACGAACTTTCAGGGAGTTAGGTGAGAGTATCGCGGAGGAGGGAGGATCTGCCGCTTTGGCTTC
AACAACGGTCGCTGTTTGACGGAAAAGCTTCCCTTTTATTACCCGCCAGATTATGACAGTTCGTCTACGGTTCCAAGATTGTGGCCCTTCCTCTCCTGCAGCAAAGCGAAGCTGCGAAGG
GCGCACGCGTACCGAAACTTAGGCAGGCACGAGGAGGCGGTGAGAGACCTGGAAGAACTAGCGGCGGCGGCACCGTATGACGCGGACCTGGGCCGGGAGCTGTGGGAGGCGAACCGCGAG
CTGGCGCAGTCGCGGGGCGAAGACGTGTCGGGGTGGAAATTCACACCGCCGGGGGGCCTCGTGGATGTGACGAGCGATCAGCAGTACCGGGAGAGGGTGAATGGGCCCGGCCTGGTCGTG
GGCTACTTCACAG
GTGGGCCGTCCTTCGCGATCCGTGTTTCTTCATGCCGACGTCATCTGGGCCTCTACGACAGGCGTATTAGGCTTCGATAGAGTCAGCTTCTACCAAGGGGATCGGCG
AAGCCGGCTAGAGCCTTGATTCGAGACGGTTTCGACATCAATGTCTTTGTGTATCGTCAGCTTTTTCAGGGAACCTGAGCAGTCACAGAGAACATACGCTCACAAAAGCTGAGCGAGAAG
AGCGGGATGTCAGAGGAAATACGCTTATAGAAACTGAGCCAGCAAAAAACTTAGCTTCTCGTCAGCGTTCCACCCGTTCCCAACTTGTACGTCACTGCTCACGAGTGACAACGCCCTCTC
TCCGCCGTTCGTCCAGCCACGTGGTGCGGGCCGTGCCGTCAGATCGCCCCGGTGATTAAGAAGCTCCCGGAGAAGTACCCCGGGCTCTCCATCATGAAGGTGGACATCGACTCCCACCAG
CAGCTGGCTGCGGCGGAGGGGGTGGCCTCCGTGCCCACGTTCAAAGTGTACAA
GTGAGTCACGCTACTTACCAGCGCGTTCAAAGTGTACAAGTGAGTGACGCCACTCAGCAGCACATTC
AAGAGTGTACACTTGAGCAACGCCAGTCAGCAGCACACTAACTGAAACTGCACAGGTGAATAACGCCAGTCAGCAGCACGTTCATATTGCACAGTCGAGTAAGGCCAGTCAGCAGTATGT
TTCAAAGTGTACAAGTGAAAGCCGCCAATCAGCAGCACAGGCCTCTGGCGGTGCAGCCAAGCACACCAGTCCGCGGCATCTCAGAGGGCGGCCACAGTCGCGACTGCTGCTTGGGATGAG
AGTCAACCTACGCAGTTCGTGGTCTTCGGCCAGGCCGTTGTTACAGAGGCAGCTTGCTGTTTGTGCATCCTGTGTAGAGAAGGTCTCCATGGAAGTGGCCCTGGAACCAGGGGCTGTCAG
CGAAGGGGGGACATTTGTATGCAGATCAAGCGAACAACAGTCTCCAGGATACCTCTGGCTTTCGGCTTCTCCTCGAGGGTTTGGCCCTAAGTCTTGTCTAAGTCGCCTTTGCTCCGTCGA
AAAGAAGACCTCTTCTAGAATCTGATCCGCCGGCAAGACGACTCTGCTCTTTCGAAAAATTGTCTTTTGATATTGATCCGCCGGATACGTGTGATGCAGAAATGGGCGCAAAGTCAACGA
GATCACCGGCGCAAACGCCCCTCTCCTGGATCAGGTGATTAGTCAGAACCTTCAAGACATCCTTAAGAAGGTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGGCGGCGACAAATGTACTCCTTCATCTGAAGATGATGCTCACGACGTCAATGGAGGACATGAGAAGCAGCAGGGGAGCAAAGAAGCCGAAGAGCTCAAGAACCAGGGGAATGAG
CTGTATCAAGCTGGGAGGGTCAAAGATGCACTATCCAAATTTGACGAGGCCGTCTCAAAGTCCCCCGATGTGGCTGTCTACCGAGCCAACAAAGCAGCAGCTCTGTCCAGCCTGGGCAGG
CTGGGGGAGGCAATGCTGGAAAGCAAG
AAAGCAGTAGAGCTAGACGACAACTATGCACGAGCCCATGAACGGCTGGCAAACCTGTGCCTGAGGCTTGGAAGGTTCAAGGAGGCGAAGAAA
CACTTCGAAAAGGCTGGCGAGGGAGGAAAGGATGGTCAAAAGCGGGCTGACCAG
CTGGATCAGCACGCCAAGGCCGCCTTGTGTGCGCGTGACAAGGGTGAGTGGGAGAAGGCACTGCGA
GAAGCGGACGCCACAATTCAGGGGGGCGCCGACGCTGACTGCACCCTGCTGGGAGTGAAGGCAGAGGCACTCCAGAATCTGGGCCGGAGCGACGAAGCGGAGAAGGCGCGTGCGCAAGCG
GAGAAAGCGGCAGCGGATGCAGGGACACCGGCCATCAGG
GATCCGGTCATCTCCATGCTGCGCGCGAAGATCGCCGCCTCGACGGGCAACTTCGACGGCGCCGTCGCGGCCGCCGAGCGC
GCCGTGAAGCTCGACCCCGACAACTGCGCCGCCATCCAAACCTTAAAGCAGGTGCGCGCGCTGGCAAACGCGCGCACCCGCGGGAACGACCTGTTCAAGGCGGGCGACTTCGGGGGGGCC
GAGAAGGCGTACTCGGAGGGCCTGGAAACCCCCCTGGGAAAGGAGAACGCGTTCCTGCTGTCGAACCGGGCGGCCGCGCGGTCGAAGCAGGGCCACTGGGAGGAGGCGCTCGCGGACGCG
GACAAAGCTACGCGCGCATATCCGAACTACAG
CAAAGCGAAGCTGCGAAGGGCGCACGCGTACCGAAACTTAGGCAGGCACGAGGAGGCGGTGAGAGACCTGGAAGAACTAGCGGCGGCG
GCACCGTATGACGCGGACCTGGGCCGGGAGCTGTGGGAGGCGAACCGCGAGCTGGCGCAGTCGCGGGGCGAAGACGTGTCGGGGTGGAAATTCACACCGCCGGGGGGCCTCGTGGATGTG
ACGAGCGATCAGCAGTACCGGGAGAGGGTGAATGGGCCCGGCCTGGTCGTGGGCTACTTCACAG
CCACGTGGTGCGGGCCGTGCCGTCAGATCGCCCCGGTGATTAAGAAGCTCCCGGAG
AAGTACCCCGGGCTCTCCATCATGAAGGTGGACATCGACTCCCACCAGCAGCTGGCTGCGGCGGAGGGGGTGGCCTCCGTGCCCACGTTCAAAGTGTACAA
AAATGGGCGCAAAGTCAAC
GAGATCACCGGCGCAAACGCCCCTCTCCTGGATCAGGTGATTAGTCAGAACCTTCAAGACATCCTTAAGAAGGTCTGA

Retrieve as FASTA