Entry information : KflAPR01 (Kfl_000020020)
Entry ID 14186
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-11-09 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-11-09 (Christophe Dunand)
Peroxidase information: KflAPR01 (Kfl_000020020)
Name (synonym) KflAPR01 (Kfl_000020020)
Class Thioredoxin Type APR    [Orthogroup: APR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflAPR01
start..stop
S start..stop
HaAPR02 514 0 93..508 83..460
ThasAPR02 513 3e-180 82..508 75..464
ThasAPR01 511 2e-179 26..508 5..457
AtAPR03 508 2e-178 93..508 81..457
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7583..7715 133 N° 2 7866..7982 117 N° 3 8175..8310 136 N° 4 8553..8667 115
N° 5 8854..8985 132 N° 6 9179..9418 240 N° 7 9679..9795 117 N° 8 10355..10648 294
N° 9 10942..10998 57 N° 10 11142..11360 219  
join(7583..7715,7866..7982,8175..8310,8553..8667,8854..8985,9179..9418,9679..979 5,10355..10648,10942..10998,11142..11360)


exon

Literature and cross-references KflAPR01 (Kfl_000020020)
Protein sequence: KflAPR01 (Kfl_000020020)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   519
PWM (Da):   %s   55315.95  
PI (pH):   %s   6.84
Sequence 560
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSTLAPQLGSASWAATTGHRPHGASSREACVAGTRLALHGAPEAPTAAAAVSAFWGHQLRRLPGAAIRSQRTACSRIRAVSVVEAPPSAGEVVDYAALAKDLAASSPLEIMDTALDLFGKNIGIAFSGAEDVALIEYARLTGRPFRVFSLDTGRLNAETYRYFAQVEAHYGIRIEYCFPEAKEVEDLVRTKGMFSFYEDGHQECCAVRKVRPLRKQLRTLDAWITGQRKDQSPGTRAAVPVVQVDPAFEGLSGGPGSLVKFNPLANVKGTDVWGFLRLLNVPVNELHSKGFVSIGCEPCTRSVLPGQHEREGRWWWEDATMKECGLHKGNIAVAAPQSAAPLTTGNGAAAANGAAPGAEVAAGTEGDASTEASTAVTSAPSEHADLYADTDAVASLSKEDVEQLLRSTGQDATLLVLYAPWCRFCQAMEESYVQLGEQLRGTNVRVASFRADGPERAFAQKEFGLKSFPTIVLFPRRAQGSRSRAFVTYPSERRDPASLLAFVSAIAGPVGETWSGP

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCTGAGCACCCTTGCCCCTCAACTGGGGAGTGCGTCGTGGGCGGCGACCACTGGTCATCGTCCACACGGGGCCAGTTCAAGGGAGGCGTGTGTTGCAGGGACTCGTCTGGCCCTAC
ACGGAGCACCAG
GTAAGTGGACGACCGCCGTTTTCCTGTGAGGCAGTGGTGGGTGAGCCTTGAGCTGCTGGATCATGCTGTCGCCACGCTGTGTGCTGGCCAGTCCCGACCTGCCTGCCC
GCTGTGGCTCATCTGTCAGCCTGCCTGCCTCGCTCACTGCAGAGGCCCCCACCGCTGCTGCTGCGGTCTCTGCCTTCTGGGGGCACCAGCTGCGGCGGCTGCCTGGCGCGGCTATCCGCA
GCCAGCGGACAGCATGCTCAAGGATCAGAGCGGTCTCAG
GTGCGCACTGGCCTGGACTGACGAGCCTCCACCTTAGTGCGATGCTTACCCTTCGGTCATCCTAGCGACCTGGCGCCACCT
CGCCTCTTGCCTGCCGCTGCCTCTGAAGCTCGTATTTTGGTCTGACTTCCGATGAGGCCTGCGCCGTGGTCCGCTGTTCCCCACCTCGTTGATTGTGGCAACGGTGTGCAGTGGTGGAGG
CTCCCCCGTCCGCAGGGGAGGTGGTGGACTACGCTGCTCTGGCCAAGGATCTGGCGGCGTCGTCCCCGCTGGAGATCATGGACACTGCGCTGGACCTGTTTGGCAAAAACATTGGCATTG
CCTTCAG
GTGGGCCTAACTTACACGCACCTCAGATTTACACGGACGTTCTGCCGCTGCTTGTGGCTGCCTGCTTTGAGGCAGCATTGCCGACTGGAACCTGGGAGGCGTGTCCGCTAGCT
GCGTGTCCGGTCCTCGCTGCTTGCCCTTCTGCAACTGGGCCCGCAAGCGGCCCTGCGCCTGTACTGTACACCACATGTCCGCCTCTGCCAGGCCGCTTCCTGCGCATTTACTGCTGGGTC
TGATTGCAGTGGGGCTGAGGATGTGGCCCTCATTGAGTACGCGCGGCTCACGGGACGGCCCTTTCGGGTGTTCAGCCTGGATACCGGCCGCTTGAACGCAGAGACGTACCGCTACTTTGC
TCAG
GTGGGCAGCGCTGGCCAGCCGCTGCAAGTGCTGGGTGCTGCATCAGGAGCGTGCTTAGGGCCCCCATGCGCATGTTTCTGCACCAGATCTGTCTGGCACCCCTCTCTCCGCTGCTC
GTGTCCAGCCCCTGGTGCTCTGTGCGTCGCTGCCCGCCCTGCTGAGTCGTGCTGGCGGTGCGGCGCTCAGGTGGAGGCGCACTACGGCATCCGCATCGAGTACTGCTTCCCGGAGGCCAA
GGAGGTGGAGGACCTGGTGCGCACCAAGGGCATGTTCAGCTTCTACGAAGACGGCCACCAGGAGTGCTGCGCCGTCCGCAAG
GTAACGCCCCGCGGCAGGCACCCCCCCGCCCCTCCGAC
GGAAGCTGCTCCAAGCAGGTGCCTCTCCGCCGGCGCTTGAGCCCAGCTTTGTCACATGTGCTGCTGGTGTGTGTATTGCCAGCTCCTCTGTGCTCAGGCGGGCAGCCACCCTGCGTGGGT
CCCGTCGTGAGCAAGTCCCCGGTGCGCGCGTGCAGGTGCGGCCGCTGCGTAAGCAGCTGCGGACGCTGGACGCGTGGATCACGGGGCAGCGCAAGGACCAGAGCCCCGGGACGCGAGCCG
CTGTGCCGGTGGTGCAGGTGGACCCCGCGTTTGAGGGCCTCTCTGGGGGGCCCGGCAGCCTGGTCAAGTTCAACCCGCTGGCCAACGTCAAGGGCACCGATGTGTGGGGCTTCCTGCGCC
TGCTCAATGTGCCCGTCAACGAGCTGCACTCCAAG
GTGGGGGGCCCCAGCAGTAGCACAAAGGCCGGGCATGGCAGCTTTGTTGCGGCACTGATGGGCCCCACTGAGCGTACAGTGCCCG
CCGCCCGCTTGTCAGTGCAAAGCCAGCCTAGGTACGCCGACTGCAGCGGTTGCCTTACCTGCGGTCCCTTTCTCTTGTTTCACGTGCATCTTCATGTTTTGGGGGTGATGATCCTCATGT
CGCTCTTCATACAAACCTGGCGTTGCCGGTTGGCTGATGCGGTTCGTGCGTGCAGGGCTTTGTGTCCATTGGGTGTGAGCCGTGCACGCGGTCGGTGCTCCCTGGGCAGCATGAGCGGGA
GGGCCGCTGGTGGTGGGAGGATGCCACCATGAAGGAGTGCGGCCTGCACAAA
GTGAGCCCCCACACCGGCGCCTCTCCGGCACCTGCCGCAGCCCGCGCTGGCTGCGCGGAGGACACTCA
GTGCGGCGCTGCTTCAGCTCGAGGCTCTCCCTCGCTGCGTTTTGGCTCCTCTTATTGCACTCTGGGGGCCCCACCAGGGCTCCTGACAGAACCGATGGAAGGAGAACGTGGCCTGCAGTT
TGCAGTCCCAACCCCCCACACCGCTTTGATACCCAATCAACTTTCAAGGTAGCGCGCGACCGGTAATGTCGACTTTGACTTGACGGCGGTCGGACCGTTTTGCTGCGGACAGTGAAAGTC
AAGCCGAAAGGCTCTGTGCTAGGTCGCAGTACACGGCATGTGCAATCCGTCGGCGGTGACGTCAACAGATCACGTTCGCTCGCGCACAGAGTACCACACGGGTGTCGGGGCTTGGAACTG
CAAAGTGCAGTCCGCATTCTCCCTCCATCCGTTCTGACACCTTGGTGTGGGATTGTCGTTCTTGGCCGGGCTGCATGCTTGCCTCGTCCTTGTGGGGCCTCCACCTCGTGCTGCTCGTTC
CATTCCCGCAGGGCAACATTGCCGTGGCCGCCCCTCAGTCGGCTGCTCCCCTCACCACCGGCAATGGCGCGGCCGCCGCCAACGGCGCTGCGCCGGGGGCGGAGGTGGCGGCTGGGACGG
AGGGGGATGCCAGCACGGAGGCGAGCACTGCCGTGACGAGTGCGCCGTCGGAGCACGCGGACCTGTACGCCGACACGGACGCGGTGGCGTCGCTGAGCAAAGAGGACGTGGAGCAGCTGC
TGCGCAGCACGGGCCAGGACGCCACGCTGCTGGTGCTCTACGCGCCCTGGTGCCGCTTCTGCCAG
GTACGCCACTGTCCGAGGGACACAGCGGCTGGGAAGAGGAAGGATCACAGCGTGC
ATTTGTCTGCAGTGGCGTGCTCAAGGGGTCGTTTGCTGTGCAGCCTTCTGAGCACTTGTCTTGTTCCAAGGACAAGTGAACGGCAGCTCAGCAGGATGACAGAGCAGCCTCGGCATGGGC
CAGGAGTCACCTTCGAGGACGGCGGGCCCAGCCCAATCCGTGACAGCCACGCGCAGCGGTGTGCCGACTTGCTCGTGTGCGAGGGCTCTGACGGGCGTGCTGTGCTGCGCTGGTGCAGGC
CATGGAGGAGAGCTACGTCCAGCTGGGCGAGCAGCTGCGGGGCACCAACGTGCGG
GTGAGCGCCGCGGCCCCGCTCTGAGGGCCTTCTGCTGCAGCACCGCGGACAGCCGGCGGCCCTCA
GCTCGTGCCTGCTGCCTCTGCGATTGTGCTTCTCCGATGGCCGCTCACTGTCCCGCCTGCTGTGTGCTGTCCTGGCAGGTTGCCTCCTTCCGGGCCGATGGGCCCGAGCGCGCCTTTGCG
CAGAAGGAGTTTGGCCTCAAGAGCTTCCCCACCATCGTGCTCTTCCCGCGGCGAGCGCAAGGCAGCCGTAGCCGCGCCTTTGTTACCTACCCCTCGGAACGGCGGGATCCGGCCAGCCTC
CTCGCCTTTGTGAGTGCCATTGCGGGGCCAGTGGGAGAAACCTGGAGCGGGCCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTCTGAGCACCCTTGCCCCTCAACTGGGGAGTGCGTCGTGGGCGGCGACCACTGGTCATCGTCCACACGGGGCCAGTTCAAGGGAGGCGTGTGTTGCAGGGACTCGTCTGGCCCTAC
ACGGAGCACCAG
AGGCCCCCACCGCTGCTGCTGCGGTCTCTGCCTTCTGGGGGCACCAGCTGCGGCGGCTGCCTGGCGCGGCTATCCGCAGCCAGCGGACAGCATGCTCAAGGATCAGAG
CGGTCTCAG
TGGTGGAGGCTCCCCCGTCCGCAGGGGAGGTGGTGGACTACGCTGCTCTGGCCAAGGATCTGGCGGCGTCGTCCCCGCTGGAGATCATGGACACTGCGCTGGACCTGTTTG
GCAAAAACATTGGCATTGCCTTCAG
TGGGGCTGAGGATGTGGCCCTCATTGAGTACGCGCGGCTCACGGGACGGCCCTTTCGGGTGTTCAGCCTGGATACCGGCCGCTTGAACGCAGAGA
CGTACCGCTACTTTGCTCAG
GTGGAGGCGCACTACGGCATCCGCATCGAGTACTGCTTCCCGGAGGCCAAGGAGGTGGAGGACCTGGTGCGCACCAAGGGCATGTTCAGCTTCTACGAAG
ACGGCCACCAGGAGTGCTGCGCCGTCCGCAAG
GTGCGGCCGCTGCGTAAGCAGCTGCGGACGCTGGACGCGTGGATCACGGGGCAGCGCAAGGACCAGAGCCCCGGGACGCGAGCCGCTG
TGCCGGTGGTGCAGGTGGACCCCGCGTTTGAGGGCCTCTCTGGGGGGCCCGGCAGCCTGGTCAAGTTCAACCCGCTGGCCAACGTCAAGGGCACCGATGTGTGGGGCTTCCTGCGCCTGC
TCAATGTGCCCGTCAACGAGCTGCACTCCAAG
GGCTTTGTGTCCATTGGGTGTGAGCCGTGCACGCGGTCGGTGCTCCCTGGGCAGCATGAGCGGGAGGGCCGCTGGTGGTGGGAGGATG
CCACCATGAAGGAGTGCGGCCTGCACAAA
GGCAACATTGCCGTGGCCGCCCCTCAGTCGGCTGCTCCCCTCACCACCGGCAATGGCGCGGCCGCCGCCAACGGCGCTGCGCCGGGGGCGG
AGGTGGCGGCTGGGACGGAGGGGGATGCCAGCACGGAGGCGAGCACTGCCGTGACGAGTGCGCCGTCGGAGCACGCGGACCTGTACGCCGACACGGACGCGGTGGCGTCGCTGAGCAAAG
AGGACGTGGAGCAGCTGCTGCGCAGCACGGGCCAGGACGCCACGCTGCTGGTGCTCTACGCGCCCTGGTGCCGCTTCTGCCAG
GCCATGGAGGAGAGCTACGTCCAGCTGGGCGAGCAGC
TGCGGGGCACCAACGTGCGG
GTTGCCTCCTTCCGGGCCGATGGGCCCGAGCGCGCCTTTGCGCAGAAGGAGTTTGGCCTCAAGAGCTTCCCCACCATCGTGCTCTTCCCGCGGCGAGCGC
AAGGCAGCCGTAGCCGCGCCTTTGTTACCTACCCCTCGGAACGGCGGGATCCGGCCAGCCTCCTCGCCTTTGTGAGTGCCATTGCGGGGCCAGTGGGAGAAACCTGGAGCGGGCCTTAG

Retrieve as FASTA