Entry information : KflTrx01 (KFL_003860040/NTRC)
Entry ID 14208
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-11-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-11-07 (Christophe Dunand)
Peroxidase information: KflTrx01 (KFL_003860040/NTRC)
Name (synonym) KflTrx01 (KFL_003860040/NTRC)
Class Other Thioredoxin    [Orthogroup: Trx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflTrx01
start..stop
S start..stop
PpaTrx04 736 0 55..550 58..565
ThasTrx03-1 722 0 68..550 36..507
PpaTrx03 724 0 61..552 83..573
AtTrx03 714 0 102..550 80..528
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 38894..39197 304 N° 2 39918..40125 208 N° 3 40438..40522 85 N° 4 40960..41246 287
N° 5 41921..42044 124 N° 6 42497..42751 255 N° 7 43478..43678 201 N° 8 44226..44356 131
N° 9 44931..44994 64  
join(38894..39197,39918..40125,40438..40522,40960..41246,41921..42044,42497..427 51,43478..43678,44226..44356,44931..44994)


exon

Literature and cross-references KflTrx01 (KFL_003860040/NTRC)
Protein sequence: KflTrx01 (KFL_003860040/NTRC)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   552
PWM (Da):   %s   60206.31  
PI (pH):   %s   6.52
Sequence 593
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMSSQAILRSSAQTFSGALSRNQSCSCSDQTGAAFLRTPPGAGVHKRGLRPSSRLEKIRRVEVFGFDGVARTARIEKRQGGQIRAAVATEEAPPSTDSQDGDVVENLVIIGSGPAGYTAAIYAGRANLKPVMFEGYQVGGSPGGQLMTTTEVENFPGFPEGITGPDLMDRMRKQSERWGAELYTEDVEHVDITQRPFTIRSSEREVKANSIIIATGATAKRLGLPREHEFWSRGISACAICDGASPIFKGQDLAVVGGGDTAAEETIYLTKYARHVHLLVRKSQMKASKAMQDKVFGNPNITVHLNTEAVDVISNSKGQMEGLLLNKDGKEEKLQVRGLFYGIGHSPNSSLFHGQLELDDAGYVVVSEGGQTSVEGVYAAGDLQDHEYRQAITAAGSGCMAALMAERYLTANNLVREFHQKAAAEDVQPKKEFTEKDIEEKFDLSSAKHRGQYALRKLYHESDRLIGVLYTSPTCGPCRSLKPILNKVVDEFTNQIHFVEIDIEEDPEIAEAAGVMGTPVVHFFKNKAKLGEYQGVRMKRDYRSFIEENVK

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAATGAGCAGTCAAGCAATCCTGCGGTCGTCTGCTCAGACATTCTCCGGCGCTCTGTCAAGGAACCAGTCGTGTTCCTGCAGCGATCAAACAGGGGCAGCATTCCTGCGGACTCCTC
CAGGCGCGGGGGTGCACAAAAGGGGTCTAAGGCCCTCCTCCAGATTGGAAAAAATTCGAAGGGTAGAGGTTTTTGGGTTTGATGGGGTGGCTCGCACTGCAAGAATAGAAAAGAGGCAGG
GGGGTCAAATACGTGCAGCTGTGGCAACAGAGGAAGCTCCACCTTCCACAGATTCTCAAGATG
GTGAGATGCTTTTCCCTTCCTTACTGCAGGAGAGCTTGAGAGGAGAAAGAAATTGCA
AGTAGATGGTAGATGGTACATCCGTGGATGCAGGCTGGATTCAAGCAGACGTGGTTCCATGCCTCTGTTTCAGTTGCCTTCCTGAGGACGAAAACATCTCCTCTGTGGATCTTTCTTTCA
AGTTGTGACGTGGATGAGTCATCCTTAACGAGTGGCGCCAAAAGCTTTGCGCGAGCTCATCGGCTTTTTTTTGGGAACTTTTTGGTGTTCAAGCTTCTGCTTCTTGTCTTGTTGGTCTAT
CTGTGTCCTGGCAGTAGGGATCATTGGTAATGGTGCATATTTCTCCTTGAGCGGGTGTGCACACGTTCTCTCCACAGAATGTCTTTATAAAATGATTGCAGCCGCGTGTAGGCTGGTCAA
TATATGTACATGTGAGACGTCAAGGATCTCATAAAAGTAGAATCAAGCTGAGGGCATTTCTTGAGCATCTGTAAGTCACAACCAGCAGACTGTCGTATGTTTGTTCTGTTTACCAGGGCA
GCCTTCTCGCTCCAGAAGTTCGTTAAGTGGCAGCATTATCCTGTCAAGGTCGACCACATCAAGCCCTGCACAGTCACAAGTTCGAAATCCTGGTTTGCAGCGGTGTTGCCTTCCAGAACC
CCTTTACCTGACACACGCAAAACAGCCGGTACAGAGCATTTATTCTCCCTGTATATTGTGCAGGTGATGTCGTGGAGAATCTGGTGATCATAGGATCTGGTCCGGCTGGTTACACAGCCG
CCATTTATGCCGGGCGTGCTAATCTCAAGCCGGTTATGTTCGAAGGATATCAGGTGGGAGGGTCGCCGGGGGGGCAGCTTATGACAACCACTGAGGTGGAAAATTTTCCGGGTTTTCCGG
AGGGCATTACTGGTCCAGATCTGATGGACAG
GTGGGTATGCTCCACTTGTGATCAACCCTGGATCAGAAAGTGTATGTGTGCAGAACCTCTATCTGCCAGGCATGGTGGACCTTGCTCCT
TTGCACACTTTCTATCGACCCAAGAGTCAAGCTTCTCTGTTTGGTCTGAGATGGCCGCAAGTCCACTGTGCCGATATATTGTTGCACTAATGGTGAAGGCAGACATGCGCCAACTTTTGC
AACTGTGAAATCTTAAGAGTGGGTACATATGAAGCACCGTTGGACACCTACTGGCCAGCGAATACCATCTAAGTCCGACAGTGCTGGCTTTTCGTGTGCGCAGGATGAGGAAACAATCCG
AGCGGTGGGGGGCGGAGCTTTACACAGAGGATGTGGAGCATGTAGACATCACACAGCGACCATTCACA
GTGAGCTGACCTGCTTCTCAGTCACAGAGCCCTGTGAAGACCTGTTCTGTCA
GCCCCGTTTTACCCTTTCGGTTTTCAGGCTGAACCATTTGTTTTGTTGCTCTCTCAGCCATCTGGACGATTGGAGACTACAGATTGTACTTTTTCTGCTAGCGCCTTTCAGTCGGCAGAC
TTTGCCAGCGCTTTTGATCTGCTGAACACCGGTGGACAAGAAAGCTTGTCTGTCAACGTTTCTCGTCTGGGATTCTTCAGGAGCAGCTTGAGAGGAGCAATCCAAGTTACATCACATGTT
CATGGCATATCGCCTTGCTGGCTTAGATCGACGCTTGTTCTCTGCAAGGAAAAGACAAGGGCAGTGCAGCGGGTAAGAGACATAGGATTCAGGTGATGCTTCTTGTCCTGCTCTACTGAC
AGCCTACGACCACTCTGCGTTGCAGATACGGAGTAGCGAGCGGGAGGTCAAAGCAAACTCCATCATCATTGCAACGGGCGCCACCGCCAAACGGCTCGGTCTCCCTAGAGAACACGAGTT
CTGGTCGCGGGGCATCAGCGCTTGTGCGATTTGCGACGGGGCCAGCCCCATATTCAAGGGGCAGGATTTGGCTGTAGTTGGTGGGGGGGATACTGCGGCAGAGGAAACAATCTACCTGAC
AAAGTATGCTCGGCACGTGCATCTGCTCGTGAGGAAGTCACAGATGAAGGCGAGCAAGGCTATGCAAGACAA
GTGAGTCACTTGTTGAGCTGGTTGCAGCACTCTCCGTCTGGCTTTCAG
TGCGTCACAATCGCTGTAGACGGATGCGGTGGTTGTTCAGGAAGGTGCTGCGATGTATTTACAAGGCCTGTTGATGAGCTCGCAGACCTGCAGCCAAGCCACTCCAGAGGTCAGCACTAG
TATGTTGACAACATGACATCTCAGCAGTCCGTGTTGCTGTGCCTGGGGGGGTAGTCCTGGACCTCCAGGATCGCTCGGCATAGAAGACTCCTGAGGATCCGAGGTTGCGAGAACAAGTTT
GGCTGGAGAAGCACATTTTCTTGGTTCTACAAAGTCATTGAAGTGTAAAGGGGCTCTGCTTTGCTTTGTTCGCCTCAGGAGGAGGCTGCCGTCAGTTAGGTGTTTTTACACGGGGGTCTC
CCCTAAGTTCTTGCTTGAGACGAGCGCCGCAACTCCTGAAGCCCCTTCACATCTCGAAAGCGAGAGCCCCCTGGCAACCGTTTATGAGCCTATGGAGTGTTTCAATCCAATACGTAGGTT
GGCAGAACTGCACAGCTTCTACTGTTGATTGAAGATGTAAGGCATAGTAGCCCTCTGAAGGCCTTCTACCAAGGGTTGTTAAAGCAGACGGAAAGCTTGCTCTTGGGTCGCAGTTTTGCT
GACCGTTGAATCTGCTCCTTTTGCAGGGTCTTCGGCAACCCAAATATCACAGTGCATCTCAACACGGAGGCTGTGGATGTCATTTCCAATAGCAAGGGGCAGATGGAGGGGCTCTTATTA
AACAAAGACGGAAAGGAGGAGAAGCTACAG
GTGCGTGTGAAGTACCACCTCTTTCCCTTCTGCTTGATACCAATTGACGCAAGCGTGCGCAGTCAGCTCACAAACGCTGATGAATTGTAA
CCCTGTTAAGTGCAACGGTACCAGTTACGGGTCTGCTTGGTGCTTGAGGCGTGCCCATATGAGCAGAAAAGTTGGACGACATTGGAGCAGACTGATGCTTATGCCACGAACTGTTTCAGA
AGCTCCTCGCGTTCGTCTCACTTATTGCAGATAAGAACGATCAAGAGCCCCAAACTCCCCAAGGCCGAAACGCCCCAACGCTCACACGTCCACACTTCCAAACGGTTCTCATTCTGTCCA
GGGCGGGTTGGCAGCCTCCGATCGCATAGTCTCTGTTCATTCCCTGGAGAACCATCGGAAGAAGGCCTTCGACTCGGATTATAGAAGTTGGATATAACAGTTTCTCGTTCGCTTTTCTCC
AGGTACGAGGCCTCTTCTACGGCATCGGCCACTCGCCAAACAGCTCGCTGTTTCACGGGCAACTAGAGCTGGACGACGCGGGCTACGTGGTGGTCTCGGAAGGCGGCCAGACGAGCGTTG
AGGGCGTGTATGCGGCGGGCGATCTGCAGGACCACGAGTACCGGCAAGCGATCACGGCGGCGGGGTCTGGGTGCATGGCGGCGCTGATGGCGGAGCGGTACCTGACGGCGAATAACCTGG
TTCGAGAGTTCCATCAG
GTGGGTTGCGAGTTTCTATTGATCCAAACCCATCTTCCAAATCACTTACTTACATCAACTTTCAGGGGTGTCAAAGTTGTCCATTTTGGTGGTAGGAGTCAGT
TTTGGGGTGCGTAGCTATGTGGAAGGCCGGGGGTTATTTTCTGTTAGGAGTGAGTTTTGGGGTGCGTAGCTATGCGGATGGCCGAGGGTTTGTTCTTGCGAAATCAGCCCGCTTGGAATT
TGCTTCGGGAGGACTTTCCAATGCGTTTCTGCGCTGATCAAGTGGATGTAGAGTCTTCCAGTCTGTTCGTATGAGGACTTGCCTTTTTTCATTGTCCAGATCACCAGCCAAGCTGCGGTC
ATGAACTAGCTAGGTTGCATCATCGAGGCTTTGCAGAAGGCGGGCTCAATGCGAGCATCTGAGTCTGTTCGATCATAGAGCATTACGGCCAGCACTTACCGCAGAACCGACTCAGTTACA
ATGCATTTGTCTGATTTGCTGATTGCGGAACTTGGTCTAGAAATATTGTGCTTCGCCCACTTACTGCACTAAAGGCAGCCGATTTGCAGATCGGGACAACGAAGGCAAACGTTGATCCAC
AGATCGGGACAGGGAAGGCAAAAGTTGGACGCTTTTCCATCCTTTCTGCGTTCTCCGCAGTATCCAGAGTTCCTCACTCGGTTCGGAACAAGGACTTGCCGGGACGTCAAAATCTCAAAC
ACCTTGTCTTTGTCTCTGTGCAGAAGGCAGCCGCCGAAGACGTGCAGCCCAAGAAGGAGTTCACGGAGAAGGACATTGAAGAGAAGTTCGACCTTTCGTCCGCGAAGCACCGAGGCCAGT
ACGCGCTCCGGAAGCTGTACCACGAGAGCGACCGGCTGATCGGCGTCCTCTACACGTCGCCGACCTGCGGGCCGTGCCGATCGCTTAAGCCCATCCTAAATAAG
GTGCGTTCTCGCCTGA
GCCTTTCTTTGGAAAGGGAAATTGGTTGTTAGCAAAGGCTTCGTTAGCAAAGGCGTCGTCACGAGAGCGACCTGCTGATTGGCATGCTCTGGTTACTGCAGAGCTTTGCATTTTTCCAGT
TCGCTCTTTTCATGAAGTCCGTTGCCGACAATCCCGAAGTCGTTGCCGACAATCCCGAAGTCGTTGCTGAGATTGTTTAGCATGTCATGGAGCCGATGAGACGAGACGTGGACTGGTTGA
CGGTGTCTAATCTGATTAGTCCTGGAACGTTTGCCTCTTGCTCCCTGATTAACAAACTCTGTTCATACGCTTCTTTTTCTTACCCACCGTTCACATATCGACGTTCGAGAATCAAGATCT
ATTCATACGCTTCTTTTTGTTGTTAGCGTTCACTTTTCCACGTTCGTAGGGCCGTTCTGACGGTAAAAAACAGGACACCTCTCGTCCAGTTCCAGTTGCAATCCAGGGTGACTCAGAAAG
GGCTCAAGACTTCTTTCGTTGGGAGCCCTAATCAGGGCTGGTCTTGTGCAGGTTGTTGACGAGTTCACCAACCAGATTCACTTCGTTGAGATTGACATTGAAGAGGACCCCGAGATCGCG
GAAGCTGCGGGCGTGATGGGAACCCCGGTGGTGCACTTCTTTAAGAACAAGGCCAAACTTGG
GTAAGCCCCGACCGCTTGCCTTTCAGCTAATGTATTAAGGCGGACCAGCCGCTTGTGG
GCTTGTCTCGTATTCATAAGTTCTTTTTTCGTATTCGTAAGGCAGAGTCTGGAACGCTTCCTGATTCTAGAAAGTTTGTCTGACGTCGAAACGGGAAAGGGTCTTACTGATCATAGTGTT
GTCAGTCCACGTCTCGTTTCGATCGAGTGCACTTTCGCATCCCGTTAAGCGAAGAATCTGCTGGCGTATCTGCGTCAGCTGTTTCCAAATCTTGCATCAATGATAGGGAATGATGAGGGC
TTCACTCCTTTGAAGACTTCCGCTGCTGTGTTAAGAAGGGCGCCGGATTGAGTCTCGTGCTGCTGCTGACTGTCGGATTGCTACTACGTAGCGTTCACCTTTTGCATGCGTTTCTGGGCC
GTTTTCCAAATGCTGTTCCCTTGTCCCGCATTGAAGCTTCCTTTGGGTGTTTCGCTGCTCCCTTGTTTAGCCGTCACGAGTCATCTATACTCAGAACAGATTGTTCCTTAGGAGGGTTTA
TTGCAAAATGCTCACCTTCTGTGGTTTCTGTTTCAGGGAGTACCAAGGGGTCCGGATGAAGCGGGATTACAGGTCCTTCATTGAAGAAAACGTCAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCAATGAGCAGTCAAGCAATCCTGCGGTCGTCTGCTCAGACATTCTCCGGCGCTCTGTCAAGGAACCAGTCGTGTTCCTGCAGCGATCAAACAGGGGCAGCATTCCTGCGGACTCCTC
CAGGCGCGGGGGTGCACAAAAGGGGTCTAAGGCCCTCCTCCAGATTGGAAAAAATTCGAAGGGTAGAGGTTTTTGGGTTTGATGGGGTGGCTCGCACTGCAAGAATAGAAAAGAGGCAGG
GGGGTCAAATACGTGCAGCTGTGGCAACAGAGGAAGCTCCACCTTCCACAGATTCTCAAGATG
GTGATGTCGTGGAGAATCTGGTGATCATAGGATCTGGTCCGGCTGGTTACACAGCCG
CCATTTATGCCGGGCGTGCTAATCTCAAGCCGGTTATGTTCGAAGGATATCAGGTGGGAGGGTCGCCGGGGGGGCAGCTTATGACAACCACTGAGGTGGAAAATTTTCCGGGTTTTCCGG
AGGGCATTACTGGTCCAGATCTGATGGACAG
GATGAGGAAACAATCCGAGCGGTGGGGGGCGGAGCTTTACACAGAGGATGTGGAGCATGTAGACATCACACAGCGACCATTCACAATAC
GGAGTAGCGAGCGGGAGGTCAAAGCAAACTCCATCATCATTGCAACGGGCGCCACCGCCAAACGGCTCGGTCTCCCTAGAGAACACGAGTTCTGGTCGCGGGGCATCAGCGCTTGTGCGA
TTTGCGACGGGGCCAGCCCCATATTCAAGGGGCAGGATTTGGCTGTAGTTGGTGGGGGGGATACTGCGGCAGAGGAAACAATCTACCTGACAAAGTATGCTCGGCACGTGCATCTGCTCG
TGAGGAAGTCACAGATGAAGGCGAGCAAGGCTATGCAAGACAA
GGTCTTCGGCAACCCAAATATCACAGTGCATCTCAACACGGAGGCTGTGGATGTCATTTCCAATAGCAAGGGGCAGA
TGGAGGGGCTCTTATTAAACAAAGACGGAAAGGAGGAGAAGCTACAG
GTACGAGGCCTCTTCTACGGCATCGGCCACTCGCCAAACAGCTCGCTGTTTCACGGGCAACTAGAGCTGGACG
ACGCGGGCTACGTGGTGGTCTCGGAAGGCGGCCAGACGAGCGTTGAGGGCGTGTATGCGGCGGGCGATCTGCAGGACCACGAGTACCGGCAAGCGATCACGGCGGCGGGGTCTGGGTGCA
TGGCGGCGCTGATGGCGGAGCGGTACCTGACGGCGAATAACCTGGTTCGAGAGTTCCATCAG
AAGGCAGCCGCCGAAGACGTGCAGCCCAAGAAGGAGTTCACGGAGAAGGACATTGAAG
AGAAGTTCGACCTTTCGTCCGCGAAGCACCGAGGCCAGTACGCGCTCCGGAAGCTGTACCACGAGAGCGACCGGCTGATCGGCGTCCTCTACACGTCGCCGACCTGCGGGCCGTGCCGAT
CGCTTAAGCCCATCCTAAATAAG
GTTGTTGACGAGTTCACCAACCAGATTCACTTCGTTGAGATTGACATTGAAGAGGACCCCGAGATCGCGGAAGCTGCGGGCGTGATGGGAACCCCGG
TGGTGCACTTCTTTAAGAACAAGGCCAAACTTGG
GGAGTACCAAGGGGTCCGGATGAAGCGGGATTACAGGTCCTTCATTGAAGAAAACGTCAAATAA

Retrieve as FASTA