Entry information : PpaAPR01
Entry ID 14231
Creation 2016-10-27 (Christophe Dunand)
Last sequence changes 2016-11-08 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-11-08 (Christophe Dunand)
Peroxidase information: PpaAPR01
Name PpaAPR01
Class Thioredoxin Type APR    [Orthogroup: APR001]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaAPR01
start..stop
S start..stop
HaAPR01 591 0 15..465 2..463
HaAPR02 583 0 70..465 57..461
AtAPR03 582 0 48..465 36..458
ThasAPR03 577 0 44..465 34..466
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 747370..747469 100 N° 2 747747..747902 156 N° 3 748195..748315 121 N° 4 748507..748855 349
N° 5 749031..749168 138 N° 6 749285..749401 117 N° 7 749703..749888 186 N° 8 750219..750275 57
N° 9 750504..750677 174  
join(747370..747469,747747..747902,748195..748315,748507..748855,749031..749168, 749285..749401,749703..749888,750219..750275,750504..750677)


exon

Literature and cross-references PpaAPR01
Cluster/Prediction ref. Genebank:   5926584 UniGene:   Ppa.144
Protein sequence: PpaAPR01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   465
PWM (Da):   %s   50484.84  
PI (pH):   %s   5.83
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALKVASLEAAVMASLAPAASTSASLSRQSIVSGLAFRGQNGFQLGGLSSAGVSSRSLALGGKKIELDIAQPRRMLPVSATAVVSESVQSTVDIPKLAEKLDSASPLEIMDKALSLFGDDIAIAFSGAEDVALIEYAHLTGRPFRVFSLETGRLNPETLKLFDDVEKRYNIRIQYMYPDAAEVEELTRTKGLFSFYEDGHQECCRVRKVRPLRRALKGLKAWITGQRKDQSPGTRANVPVVVDPAFEGLDGGPGSLVKWNPLSNVSGTAVWSFLRTMDVPVNALHFKGYVSIGCEPCTRAVLPGQHEREGRWWWEDAKAKECGLHKGNLDGVAESSNSLGEKTEVADLFISENVVTFGREDMEALVKGENRDKSSLVVLYAPWCSFSQAMDESYNDVAEKLAGSNVVVGKFNADGAQKAYAKENLQLQSYPTVLFLPKNSSQIIKYPSENREVDALLGFVQALQ*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGAAGGTTGCATCACTGGAGGCGGCTGTTATGGCTAGTCTAGCGCCCGCGGCGTCCACTTCGGCGTCTCTGTCACGCCAATCGATTGTTTCAGGTTTGTGGCTGGCGTGGTCG
TTGTTTTTCCTGGGATTCGATGCTTTGTTGTGGTTTATAGATTGCGGTTTGGGGACGTCGGGTTGAGGTTTAGTGTGTGATGCGGTCAGGACTGGTGTTGAGTGGGGTGTGGTCGTGGGT
GGGGTCGGCGGCTTTCGGAAGTGGTTGGCTGTGTGCGCTTCTTTGTGGGATTTGCAGAGTTTTTGTAAGTTGCGCAGGCTCTGTGCGGTGTCGTTATTTGATTAGGCGTTGCGGACTCTC
TCGCTTGCCGTGAACAGGGTTGGCTTTTAGAGGGCAGAATGGGTTTCAACTCGGAGGATTGTCCTCCGCCGGGGTTTCGTCGCGAAGCCTGGCGTTGGGCGGTAAGAAGATCGAACTCGA
CATCGCTCAGCCTCGCAGAATGCTGCCCGTTTCAGCAACTGCTGTGGTTTCTG
GTAAGTTCGCTTGAAGTTCTAGTGTTCCCTCAAACCTTGATACGTTTTTGTAATGTTCGATTTGGAA
GGGGTAATTGTAGAGTAAAGCGTAGGCCGGAATGCGGTGCCTATTCGTCGTCAAGATAATTTTAGAATTTGATGGAAGGTGTCGTCGTACAATTACTCGCGTGTACATGTGAAATGACTA
TCTTTTCATCTCAAACTGGCAAATTTAAAGTACTAGTTACAGCGTACTGGCTGGTTATCTAAATTACAGGCTTGCGAGCTTATGTTTTCTTTTTACCATGTGCAGAGTCTGTGCAAAGCA
CCGTTGATATCCCCAAGCTGGCGGAGAAATTAGACTCCGCATCTCCTCTAGAGATTATGGACAAAGCTCTTTCACTATTCGGTGACGACATTGCCATCGCGTTCAG
GTACGTATCAATTA
CGTTCAAGTGCTTATCAGCGTTTCCTGCTATTCTGAGACGACTATGTCGAATAACTGCAACAAACTCGTTATTCTATGAAAACTGTTTTAATATCCCCACGCAGTAATCCGAGAAGTGGA
GAAGATGAAAGTTCTTATAATGCCTACCTGACTTGATTCTTGATTGTCCGGTTGCAGTGGAGCTGAAGACGTAGCGTTGATCGAGTACGCACACCTTACAGGCCGCCCCTTCAGGGTATT
CAGCTTGGAGACTGGAAGGCTGAACCCCGAAACCTTGAAATTGTTTGACGACGTGGAGAAGCGCTACAACATTCGCATTCAATACATGTACCCTGACGCCGCAGAGGTTGAGGAGCTTAC
GCGGACTAAGGGCTTGTTCTCCTTCTATGAGGACGGGCACCAAGAGTGCTGTAGGGTGCGGAAAGTGAGGCCTCTTCGTCGGGCTCTCAAGGGATTGAAGGCATGGATCACTGGACAACG
TAAAGACCAATCCCCCGGAACGCGTGCCAACGTTCCCGTTGTACAG
GTTATCATTGCAACCTAATCGCTCTATAACTAGTAGTAATCTTGTGAAGCTCGGGTCAAATTCTGTACTTTTTT
CACTTCTATCAACCTTGAAACTACGGAATCATTGTATTTTTACATATTTCTAGAACAATTCAGTCCAACCTTTCTCGGTGAATGCTGTGGATTCATACCAGGTGGATCCTGCTTTTGAGG
GCCTGGATGGCGGTCCTGGAAGCCTTGTGAAGTGGAACCCGCTGTCAAATGTTTCGGGAACTGCCGTATGGTCGTTCCTGCGCACCATGGATGTCCCTGTCAACGCCCTGCACTTCAAG
G
TTTGTGTACTCTCCGACACAATAAGTTTTCGGAAGAAGTGTACATTTATGAATATCGTAACTAGTTGGATCAGAATTCTCGAGAGCTTCTGTACTAACAGCGCTTTGTGTTACAGGGTTA
CGTATCAATTGGGTGCGAGCCATGCACAAGGGCTGTACTGCCAGGGCAACATGAAAGAGAAGGCAGATGGTGGTGGGAGGATGCAAAGGCCAAGGAATGTGGTCTTCACAAG
GTTAGGAA
TAAATCTTCAACACGTACAAGTTCTGGAAACTCGTATGCGGTTTGTCTCAATTCTGGTAATAAATTGCGTGGTTGTCGCGTCAAATCTAGTCTATATATGTTAACCGAATTTGACTGGCG
CGTTAAGTCTAGACTGTAGATTCTAGCTTGTGCGATCGATAAAGTACACTGCTATTTTTATCAATGAAGTGTCTACGAGGGGTTTTTGGCCCTATGTTTTCAAGCTGAACCATCTTCAAC
CTTCTGCTTAATGTATGCTCTACTAAATAGCGTGATGCTGGTTCTGTATCCAGGGTAACCTTGATGGTGTTGCCGAGTCCTCCAACTCTCTCGGAGAGAAAACTGAAGTTGCCGATCTTT
TCATTAGCGAGAATGTGGTGACATTCGGACGGGAGGATATGGAAGCCTTGGTGAAAGGAGAGAACCGTGACAAGTCATCACTAGTTGTGTTGTATGCGCCTTGGTGCTCCTTCTCTCAG
G
TACATTTACCCCATCCTCAGTTTCTCCCTTTCAATGTGTCATATTAGCAGCAAACCATCTACGTTTCTAGTATTGATTTTACCTGTTGATACTCGGTCACAATTGCTTTATACCAATGTT
GAATAATGCAATGTGTCTGTAAGTGCTTTTGCAAGCAGAATATGGAATTGTAACCTAAAACTCAGTTTCATGTCGTCCATTGTATCTAATTAGTCCCTGTATTGTTTCCTAGACTTGCAT
CTACTTAGTCTGAACTAGTCACAGAAGCTAACACAAAATGACACTGCCCGAGAGGGAGATTGTGGCTAATTCAAGCGCTTTTTTGACAGGCAATGGACGAGTCCTACAACGACGTGGCAG
AAAAGTTGGCGGGATCTAATGTTGTG
GTACGTGGCAACTAGCACCATCAATAAGTGCAGAATGAGATACGCCAAATTTTCCGAATCTATCACTTTTTGTGTTTTGTCTTATTATTTGGTC
AACGTAACAGTCCGAAGGGTCTTTCAGTCTAATCTTTGAAAAGACGTGTACCTAGTCTGGAGTTGCGCTTTTGTCACAACTGAGATTGTAGAAATAGAGTGCTGAATGTTGGCTTCTGGT
GTTGAACGGAATAGGTCGGCAAGTTCAATGCTGATGGAGCTCAGAAAGCCTACGCAAAGGAGAACCTGCAGCTGCAAAGCTACCCAACCGTCCTCTTCCTCCCTAAGAACAGTAGCCAAA
TTATCAAGTACCCATCTGAAAACCGCGAGGTAGATGCTTTGCTTGGGTTTGTGCAAGCATTGCAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGAAGGTTGCATCACTGGAGGCGGCTGTTATGGCTAGTCTAGCGCCCGCGGCGTCCACTTCGGCGTCTCTGTCACGCCAATCGATTGTTTCAGGGTTGGCTTTTAGAGGGCAG
AATGGGTTTCAACTCGGAGGATTGTCCTCCGCCGGGGTTTCGTCGCGAAGCCTGGCGTTGGGCGGTAAGAAGATCGAACTCGACATCGCTCAGCCTCGCAGAATGCTGCCCGTTTCAGCA
ACTGCTGTGGTTTCTG
AGTCTGTGCAAAGCACCGTTGATATCCCCAAGCTGGCGGAGAAATTAGACTCCGCATCTCCTCTAGAGATTATGGACAAAGCTCTTTCACTATTCGGTGACGAC
ATTGCCATCGCGTTCAG
TGGAGCTGAAGACGTAGCGTTGATCGAGTACGCACACCTTACAGGCCGCCCCTTCAGGGTATTCAGCTTGGAGACTGGAAGGCTGAACCCCGAAACCTTGAAA
TTGTTTGACGACGTGGAGAAGCGCTACAACATTCGCATTCAATACATGTACCCTGACGCCGCAGAGGTTGAGGAGCTTACGCGGACTAAGGGCTTGTTCTCCTTCTATGAGGACGGGCAC
CAAGAGTGCTGTAGGGTGCGGAAAGTGAGGCCTCTTCGTCGGGCTCTCAAGGGATTGAAGGCATGGATCACTGGACAACGTAAAGACCAATCCCCCGGAACGCGTGCCAACGTTCCCGTT
GTACAG
GTGGATCCTGCTTTTGAGGGCCTGGATGGCGGTCCTGGAAGCCTTGTGAAGTGGAACCCGCTGTCAAATGTTTCGGGAACTGCCGTATGGTCGTTCCTGCGCACCATGGATGTC
CCTGTCAACGCCCTGCACTTCAAG
GGTTACGTATCAATTGGGTGCGAGCCATGCACAAGGGCTGTACTGCCAGGGCAACATGAAAGAGAAGGCAGATGGTGGTGGGAGGATGCAAAGGCC
AAGGAATGTGGTCTTCACAAG
GGTAACCTTGATGGTGTTGCCGAGTCCTCCAACTCTCTCGGAGAGAAAACTGAAGTTGCCGATCTTTTCATTAGCGAGAATGTGGTGACATTCGGACGG
GAGGATATGGAAGCCTTGGTGAAAGGAGAGAACCGTGACAAGTCATCACTAGTTGTGTTGTATGCGCCTTGGTGCTCCTTCTCTCAG
GCAATGGACGAGTCCTACAACGACGTGGCAGAA
AAGTTGGCGGGATCTAATGTTGTG
GTCGGCAAGTTCAATGCTGATGGAGCTCAGAAAGCCTACGCAAAGGAGAACCTGCAGCTGCAAAGCTACCCAACCGTCCTCTTCCTCCCTAAGAAC
AGTAGCCAAATTATCAAGTACCCATCTGAAAACCGCGAGGTAGATGCTTTGCTTGGGTTTGTGCAAGCATTGCAATAA

Retrieve as FASTA