Entry information : RsPrx72-1A
Entry ID 14335
Creation 2017-04-10 (Christophe Dunand)
Last sequence changes 2017-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-10 (Christophe Dunand)
Peroxidase information: RsPrx72-1A
Name RsPrx72-1A
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Raphanus
Organism Raphanus sativus (Chinese radish)    [TaxId: 3726 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RsPrx72-1A
start..stop
S start..stop
BrPrx72-1Ab_other 664 0 1..335 1..335
TsPrx72 654 0 1..335 1..335
ThPrx72 653 0 1..335 1..335
BrPrx72-1Aa_other 650 0 1..335 1..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 85..318 234 N° 2 406..597 192 N° 3 691..856 166 N° 4 1152..1573 422
join(85..318,406..597,691..856,1152..1573)


exon

Literature and cross-references RsPrx72-1A
Cluster/Prediction ref. Genebank:   108806074
Protein sequence: RsPrx72-1A
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (314)
PWM (Da):   %s   37099.9 (34764.5)  
PI (pH):   %s   8.62 (8.71) Peptide Signal:   %s   cut: 24 range:24-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVSLNILIVALSLIALSPLCLSSKAYESGGYLFPQFYDHSCPKAQEIVQSIVAKAFAQDPRMPASLLRLHFHDCFVKGCDASILLDSSGTIISEKRSNPNRNSARGFEVIEEIKNALEQECPETVSCADILALAARDSTVITGGPSWEVPLGRRDARGASLSGSNNGIPAPNNTFQTILTKFKRQGLNLVDLVSLSGSHTIGNSRCTSFRQRLYNQSGNGKPDLTLNQYYAYALRKQCPRSGGDQNLFFLDLATPFKFDNHYFKNLIMYKGLLSSDEVLFTKNRESKELVELYAESQEAFFEQFAKSMVKMGNISPLTGARGEIRRICRRVNPAAY

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTATCACTGAACATTCTTATCGTAGCCCTCTCCCTCATCGCCCTCTCTCCTCTTTGTTTGAGCTCTAAAGCCTATGAAAGTGGCGGCTATCTCTTCCCTCAGTTCTACGACCAC
TCATGTCCTAAAGCTCAAGAAATTGTTCAGTCAATTGTTGCCAAAGCATTCGCACAGGATCCTCGCATGCCCGCCTCCTTGCTCAGACTCCATTTCCACGATTGTTTCGTGAAG
GTTTCA
ACCTTAGCCACTTCTCAACCTTACTTTGCTATGGAATAATTAAATTTCCGTTTTAAACATTTTTTTTCTCGCTTACTGCAGGGATGTGATGCTTCCATACTATTGGACAGCAGTGGAACC
ATAATCAGCGAGAAACGATCAAACCCTAACAGAAACTCAGCCCGTGGTTTCGAGGTCATCGAGGAAATCAAGAATGCCTTAGAACAAGAGTGTCCTGAAACAGTTTCTTGCGCTGATATC
TTGGCTCTAGCTGCTAGAGACTCAACCGTCATT
GTAAGTCAGAACAACAAATAATCAAACTATTTGTATTAGTAATTATCACTAAAAACTTAAATTAGTTCAACACATGGTCATATGTTA
ATACAGACAGGTGGACCGAGTTGGGAAGTACCTCTAGGAAGAAGAGACGCGAGAGGAGCAAGCTTGAGTGGTTCCAACAATGGCATTCCTGCTCCCAACAACACTTTTCAAACTATCCTC
ACTAAGTTCAAGCGTCAAGGCCTTAATCTCGTCGATCTTGTCTCCCTCTCTG
GTATTAATTAATTAATTATAATATTCATTTGTAACAACTTACCTATATATATTAACCGACCCTAAAAA
TCGTTACAGAACTCCCCCCATAATTTTTTTTGAGTGTTTGTTAGGTTTTGAAAACATTTTAAATGTGCTATGTGGATGTTGAAGGGCTTGTTAAACGTTACACCAGCTTTGCTAAGTTTA
AAATAATAAAATTATTTAGAAAGCCCCATAAGTTTTGTTACATTTGCTTAGCTGATTAAGCTCAGTTGTTAATATTTAGAAGGGGTTTTGTTTCGTGTGATATGCAGGAAGTCACACCAT
CGGAAACTCGAGGTGCACAAGTTTCCGGCAGAGGTTATACAACCAGTCTGGCAACGGCAAGCCTGATCTAACCCTAAACCAATACTACGCCTACGCGTTGCGTAAGCAATGTCCAAGATC
CGGCGGTGACCAAAACCTCTTCTTCCTCGACTTGGCGACGCCTTTCAAGTTCGACAACCACTACTTCAAGAACCTCATCATGTACAAAGGGCTGTTGAGCTCTGACGAGGTTCTGTTCAC
GAAGAACAGAGAGTCCAAGGAGCTGGTGGAGCTCTACGCTGAGAGTCAAGAGGCCTTCTTTGAGCAGTTTGCGAAATCGATGGTGAAGATGGGGAATATCTCTCCTTTGACGGGCGCGAG
GGGAGAGATCCGGAGAATCTGTCGGAGGGTTAACCCTGCAGCTTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTATCACTGAACATTCTTATCGTAGCCCTCTCCCTCATCGCCCTCTCTCCTCTTTGTTTGAGCTCTAAAGCCTATGAAAGTGGCGGCTATCTCTTCCCTCAGTTCTACGACCAC
TCATGTCCTAAAGCTCAAGAAATTGTTCAGTCAATTGTTGCCAAAGCATTCGCACAGGATCCTCGCATGCCCGCCTCCTTGCTCAGACTCCATTTCCACGATTGTTTCGTGAAG
GGATGT
GATGCTTCCATACTATTGGACAGCAGTGGAACCATAATCAGCGAGAAACGATCAAACCCTAACAGAAACTCAGCCCGTGGTTTCGAGGTCATCGAGGAAATCAAGAATGCCTTAGAACAA
GAGTGTCCTGAAACAGTTTCTTGCGCTGATATCTTGGCTCTAGCTGCTAGAGACTCAACCGTCATT
ACAGGTGGACCGAGTTGGGAAGTACCTCTAGGAAGAAGAGACGCGAGAGGAGCA
AGCTTGAGTGGTTCCAACAATGGCATTCCTGCTCCCAACAACACTTTTCAAACTATCCTCACTAAGTTCAAGCGTCAAGGCCTTAATCTCGTCGATCTTGTCTCCCTCTCTG
GAAGTCAC
ACCATCGGAAACTCGAGGTGCACAAGTTTCCGGCAGAGGTTATACAACCAGTCTGGCAACGGCAAGCCTGATCTAACCCTAAACCAATACTACGCCTACGCGTTGCGTAAGCAATGTCCA
AGATCCGGCGGTGACCAAAACCTCTTCTTCCTCGACTTGGCGACGCCTTTCAAGTTCGACAACCACTACTTCAAGAACCTCATCATGTACAAAGGGCTGTTGAGCTCTGACGAGGTTCTG
TTCACGAAGAACAGAGAGTCCAAGGAGCTGGTGGAGCTCTACGCTGAGAGTCAAGAGGCCTTCTTTGAGCAGTTTGCGAAATCGATGGTGAAGATGGGGAATATCTCTCCTTTGACGGGC
GCGAGGGGAGAGATCCGGAGAATCTGTCGGAGGGTTAACCCTGCAGCTTATTAA

Retrieve as FASTA