Entry information : SsteMnP23-1
Entry ID 14377
Creation 2017-05-11 (Catherine Mathe)
Last sequence changes 2017-05-11 (Catherine Mathe)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2017-05-16 (Marcel Zamocky)
Peroxidase information: SsteMnP23-1
Name SsteMnP23-1
Class Manganese peroxidase    [Orthogroup: MnP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP23-1
start..stop
S start..stop
SsteMnP23-3 748 0 1..380 1..380
SsteMnP23-2 744 0 1..380 1..380
SsteMnP04 692 0 1..380 1..380
SsteMnP16 692 0 1..380 1..380
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 407760..407917 158 N° 2 407655..407707 53 N° 3 407069..407599 531 N° 4 406935..407018 84
N° 5 406710..406881 172 N° 6 406551..406652 102 N° 7 406451..406493 43  
complement(join(406451..406493,406551..406652,406710..406881,406935..407018,4070 69..407599,407655..407707,407760..407917))


exon

Literature and cross-references SsteMnP23-1
DNA ref. JGI genome:   scaffold_22 (407917..406451)
Protein sequence: SsteMnP23-1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   380 (361)
PWM (Da):   %s   39475.23 (37539.2)  
PI (pH):   %s   4.02 (4.04) Peptide Signal:   %s   cut: 20 range:20-380
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFASLISFVGLSVAAVQAANFKRVTCPDGVNTATNAACCAFFALRDDLQANLFEGQCGEDAHEVIRLTFHDAIAFSPILKAQGMPAGGGADGSMLIFPNVEPNFHANLGISDSVNALLPFLAKHNTISAGDLIQFGGAVALSNCPGAPRLEFLAGRPNATAPAPDGLIPEPQDTVTEILARMADGGGFTPDEVIALLASHSIARADHVDPTLDAAPFDSTPFDFDTQIFVEVLLRGIGFPGTGGNQGEAESPLPLTNGEDVGELRLLSDQTFARDSRTACTWQGFVNQQEKMANAFQAAMAKLAVIGQDTSSLIDCSEVVPIPVPSSGKPATFPATKSNADIEQACASTPFPSLATDPGPAETLIPHCPDGSEDDCDDS*

Retrieve as FASTA  
Remarks Complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCTCTCATCTCTTTCGTTGGTCTCTCTGTCGCGGCTGTTCAAGCAGCGAACTTCAAGCGTGTTACTTGCCCCGATGGTGTAAATACCGCTACCAACGCTGCCTGCTGT
GCCTTCTTCGCTCTCCGCGATGACCTACAGGCTAACTT
GTATGTATGCCATGCAAATCACAATATTTTTATCAATGTAATAATTCTATAGGTTTGAAGGCCAGTGCGGTGAAGATGCTCA
TGAAGTCATTCGATTGACTTTCC
GTGAGTACCAGACCTTTCGGATCCATATATTATGTTCTTAATCCTAATTTACTAGACGACGCAATCGCCTTCTCCCCCATTCTTAAAGCTCAGGGTA
TGCCTGCCGGTGGAGGAGCAGACGGTTCCATGCTCATTTTCCCCAATGTCGAGCCCAACTTCCATGCTAACCTCGGTATCTCCGACTCCGTCAATGCTCTCCTTCCCTTCCTCGCCAAAC
ACAACACAATCAGTGCTGGTGACCTCATCCAATTTGGAGGCGCTGTTGCACTTAGCAATTGCCCTGGAGCTCCTCGTCTGGAGTTCTTGGCTGGTCGTCCCAACGCAACCGCACCCGCTC
CGGATGGTCTTATTCCAGAGCCTCAAGACACCGTCACGGAGATTCTTGCTCGGATGGCGGACGGTGGAGGATTCACCCCCGATGAAGTTATTGCTTTGCTGGCATCACACTCCATTGCGC
GTGCAGACCACGTCGATCCGACATTGGATGCAGCTCCATTCGACAGCACTCCATTCGATTTCGACACTCAAATCTTTGTTGAAGTCTTACTGAGAGGTATTGGATTCCCCGGAACCGGTG
GCAACCAGG
GTAGGTACTGCTTTCGAGGGATACGGATATGAAAATTAACCGTTTAATAGGTGAAGCTGAGTCTCCTTTGCCATTGACCAATGGCGAGGATGTGGGTGAGCTTCGTCTTCT
ATCAGATCAGACATTTGCTCGTG
GTACGTGAGCATTCCACATTAAAAATATATTTCTACTTAATATTCTCTCACAGACTCGAGAACTGCATGCACCTGGCAAGGGTTCGTGAACCAACAA
GAGAAAATGGCGAACGCTTTCCAAGCTGCCATGGCCAAGCTCGCCGTCATCGGTCAAGACACATCCTCGCTGATTGACTGCTCCGAAGTTGTTCCCATCCCTGTCCCTTCCAGCGGAAAG
CCTGCGAC
GTCAGTATCATTTTATGTTCAAATTTCTCTAATTTGCTAACTTTCGTTTCAATTTAGTTTCCCTGCTACCAAGTCAAATGCAGACATTGAGCAGGCTTGCGCTTCTACTCCA
TTCCCAAGTCTCGCTACCGATCCCGGTCCAGCAGAGACCTTGATTCC
GTGAGTATTATTAAATATTAATTTCAAGGATATTATTGACACGACTCTTAATTTCAGTCATTGCCCTGATGGC
TCTGAAGATGACTGTGACGACAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCATCTCTCATCTCTTTCGTTGGTCTCTCTGTCGCGGCTGTTCAAGCAGCGAACTTCAAGCGTGTTACTTGCCCCGATGGTGTAAATACCGCTACCAACGCTGCCTGCTGT
GCCTTCTTCGCTCTCCGCGATGACCTACAGGCTAACTT
GTTTGAAGGCCAGTGCGGTGAAGATGCTCATGAAGTCATTCGATTGACTTTCCACGACGCAATCGCCTTCTCCCCCATTCTT
AAAGCTCAGGGTATGCCTGCCGGTGGAGGAGCAGACGGTTCCATGCTCATTTTCCCCAATGTCGAGCCCAACTTCCATGCTAACCTCGGTATCTCCGACTCCGTCAATGCTCTCCTTCCC
TTCCTCGCCAAACACAACACAATCAGTGCTGGTGACCTCATCCAATTTGGAGGCGCTGTTGCACTTAGCAATTGCCCTGGAGCTCCTCGTCTGGAGTTCTTGGCTGGTCGTCCCAACGCA
ACCGCACCCGCTCCGGATGGTCTTATTCCAGAGCCTCAAGACACCGTCACGGAGATTCTTGCTCGGATGGCGGACGGTGGAGGATTCACCCCCGATGAAGTTATTGCTTTGCTGGCATCA
CACTCCATTGCGCGTGCAGACCACGTCGATCCGACATTGGATGCAGCTCCATTCGACAGCACTCCATTCGATTTCGACACTCAAATCTTTGTTGAAGTCTTACTGAGAGGTATTGGATTC
CCCGGAACCGGTGGCAACCAGG
GTGAAGCTGAGTCTCCTTTGCCATTGACCAATGGCGAGGATGTGGGTGAGCTTCGTCTTCTATCAGATCAGACATTTGCTCGTGACTCGAGAACTGCA
TGCACCTGGCAAGGGTTCGTGAACCAACAAGAGAAAATGGCGAACGCTTTCCAAGCTGCCATGGCCAAGCTCGCCGTCATCGGTCAAGACACATCCTCGCTGATTGACTGCTCCGAAGTT
GTTCCCATCCCTGTCCCTTCCAGCGGAAAGCCTGCGAC
TTTCCCTGCTACCAAGTCAAATGCAGACATTGAGCAGGCTTGCGCTTCTACTCCATTCCCAAGTCTCGCTACCGATCCCGGT
CCAGCAGAGACCTTGATTCC
TCATTGCCCTGATGGCTCTGAAGATGACTGTGACGACAGCTGA

Retrieve as FASTA