Entry information : SsteMnP24
Entry ID 14379
Creation 2017-05-11 (Catherine Mathe)
Last sequence changes 2017-05-11 (Catherine Mathe)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2017-05-16 (Marcel Zamocky)
Peroxidase information: SsteMnP24
Name SsteMnP24
Class Manganese peroxidase    [Orthogroup: MnP002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Sphaerobolaceae Sphaerobolus
Organism Sphaerobolus stellatus    [TaxId: 68786 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SsteMnP24
start..stop
S start..stop
SsteMnP16 709 0 1..380 1..380
SsteMnP23-3 705 0 1..380 1..380
SsteMnP19 703 0 1..380 1..380
SsteMnP23-2 701 0 1..380 1..380
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6609..6766 158 N° 2 6822..6874 53 N° 3 6937..7467 531 N° 4 7521..7604 84
N° 5 7656..7827 172 N° 6 7887..7988 102 N° 7 8053..8095 43  
join(6609..6766,6822..6874,6937..7467,7521..7604,7656..7827,7887..7988,8053..809 5)


exon

Literature and cross-references SsteMnP24
DNA ref. JGI genome:   scaffold_108 (6609..8095)
Protein sequence: SsteMnP24
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   380 (361)
PWM (Da):   %s   39646.31 (37710.3)  
PI (pH):   %s   4.08 (4.10) Peptide Signal:   %s   cut: 20 range:20-380
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFASLISFVGLSVAAVQAANFKRVTCPDGVNTATNAACCAFFALRDDLQINLFENQCGEDTHEVVRLTFHDAIAFSTSLKAAGKPAGGGADGSMLIFPNIEPNFSANNGIDDSVNALLPFLAAHNTISAGDLIQFAGAVGISNCPGAPRLEFMAGRPNATAPAPDGLIPEPQDSITEILARMEDGGGFSPDEVVALLASHSIARADHVDPTLNAAPFDSTPFDFDTQIFVEVLLRGIGFPGTGGNQGEAESPLPKTSGENVGELRLLSDQEFARDSRTACTWQGFVNQQEKMTNAFQAAMAKLAVIGQDKSKLIDCSEVIPIPVPSSGKPATFPATKTIADIEQACANAPFPSLATDPGSVETLIPHCPDGSEDDCDDS*

Retrieve as FASTA  
Remarks Complete sequence from genomics (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCTTCTCTTATCTCGTTCGTCGGTCTCTCTGTCGCAGCTGTTCAAGCAGCAAACTTCAAACGTGTTACCTGCCCCGATGGTGTTAACACCGCTACCAACGCTGCCTGCTGT
GCATTCTTCGCTCTCCGTGATGATCTTCAGATCAACTT
GTTCGTATACTATTAAAGCGGGAATAAATTCATTGCTGACGAGGTTATTCTCCAGGTTCGAAAACCAGTGCGGTGAAGACAC
TCATGAAGTCGTTCGCTTGACTTTCC
GTGAGTACTAGACTGACTGAATTTATGCTTTATGTCTCATCTTGTATTCCATCCCGTAACAGATGACGCTATTGCCTTCTCTACCTCTCTTAAG
GCGGCTGGCAAGCCTGCTGGTGGAGGTGCAGACGGTTCCATGCTCATTTTCCCGAACATCGAGCCCAACTTCTCTGCAAATAACGGTATCGACGACTCCGTCAATGCTTTGCTTCCCTTC
CTTGCTGCACACAACACCATCAGTGCCGGTGACCTCATCCAATTTGCGGGCGCTGTTGGAATTAGCAACTGTCCGGGAGCTCCTCGCCTCGAGTTTATGGCTGGTCGTCCCAATGCAACT
GCCCCTGCTCCAGATGGTCTCATTCCAGAACCTCAAGACTCTATTACGGAGATTCTTGCCCGTATGGAAGATGGCGGAGGATTTTCCCCCGATGAAGTTGTTGCTTTGCTGGCATCACAC
TCCATTGCTCGTGCAGACCATGTCGACCCCACATTGAACGCGGCTCCCTTTGATAGCACTCCCTTCGATTTCGACACCCAGATTTTCGTTGAAGTGTTACTTAGGGGTATCGGATTCCCC
GGAACCGGCGGCAACCAGG
GTGAGTATCTCCTAAGTAGGGCTCGTATTTGCGCTAAATTAGGTTATTTATAGGTGAAGCTGAGTCTCCTCTGCCGAAGACCAGTGGAGAAAACGTCGGTG
AACTCCGTCTTCTCTCAGATCAGGAATTTGCTCGTG
GTAGGTGAAACATGTCATGTTGAAAGTATTTGTCTGAATTTCCTGTGACAGATTCGAGGACTGCATGCACCTGGCAAGGGTTCG
TCAACCAGCAAGAGAAAATGACCAATGCTTTCCAAGCTGCTATGGCGAAACTTGCTGTTATCGGCCAGGACAAGTCCAAGCTGATTGATTGCTCCGAAGTCATTCCAATCCCTGTTCCTT
CCTCTGGAAAGCCCGCGAC
GTCAGTATAAATTCGATCACAAATTGATATGACGGCTAATCTTTCTTGGCATGTTACAGATTCCCTGCTACCAAGACCATTGCAGATATTGAGCAGGCTTG
CGCTAATGCTCCATTCCCGAGTCTCGCAACTGATCCCGGTTCAGTAGAGACCTTGATCCC
GTGAGTAATAATTATCCTCAGACAGCTTATGGAGCTCCATTATTGACTTGATATGTTCTT
CAAGCCATTGCCCTGACGGATCAGAGGATGACTGCGATGACAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTTTGCTTCTCTTATCTCGTTCGTCGGTCTCTCTGTCGCAGCTGTTCAAGCAGCAAACTTCAAACGTGTTACCTGCCCCGATGGTGTTAACACCGCTACCAACGCTGCCTGCTGT
GCATTCTTCGCTCTCCGTGATGATCTTCAGATCAACTT
GTTCGAAAACCAGTGCGGTGAAGACACTCATGAAGTCGTTCGCTTGACTTTCCATGACGCTATTGCCTTCTCTACCTCTCTT
AAGGCGGCTGGCAAGCCTGCTGGTGGAGGTGCAGACGGTTCCATGCTCATTTTCCCGAACATCGAGCCCAACTTCTCTGCAAATAACGGTATCGACGACTCCGTCAATGCTTTGCTTCCC
TTCCTTGCTGCACACAACACCATCAGTGCCGGTGACCTCATCCAATTTGCGGGCGCTGTTGGAATTAGCAACTGTCCGGGAGCTCCTCGCCTCGAGTTTATGGCTGGTCGTCCCAATGCA
ACTGCCCCTGCTCCAGATGGTCTCATTCCAGAACCTCAAGACTCTATTACGGAGATTCTTGCCCGTATGGAAGATGGCGGAGGATTTTCCCCCGATGAAGTTGTTGCTTTGCTGGCATCA
CACTCCATTGCTCGTGCAGACCATGTCGACCCCACATTGAACGCGGCTCCCTTTGATAGCACTCCCTTCGATTTCGACACCCAGATTTTCGTTGAAGTGTTACTTAGGGGTATCGGATTC
CCCGGAACCGGCGGCAACCAGG
GTGAAGCTGAGTCTCCTCTGCCGAAGACCAGTGGAGAAAACGTCGGTGAACTCCGTCTTCTCTCAGATCAGGAATTTGCTCGTGATTCGAGGACTGCA
TGCACCTGGCAAGGGTTCGTCAACCAGCAAGAGAAAATGACCAATGCTTTCCAAGCTGCTATGGCGAAACTTGCTGTTATCGGCCAGGACAAGTCCAAGCTGATTGATTGCTCCGAAGTC
ATTCCAATCCCTGTTCCTTCCTCTGGAAAGCCCGCGAC
ATTCCCTGCTACCAAGACCATTGCAGATATTGAGCAGGCTTGCGCTAATGCTCCATTCCCGAGTCTCGCAACTGATCCCGGT
TCAGTAGAGACCTTGATCCC
CCATTGCCCTGACGGATCAGAGGATGACTGCGATGACAGTTAA

Retrieve as FASTA