Entry information : CsorAPx03
Entry ID 15186
Creation 2018-04-27 (Christophe Dunand)
Last sequence changes 2018-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-04-27 (Christophe Dunand)
Peroxidase information: CsorAPx03
Name CsorAPx03
Class Ascorbate peroxidase    [Orthogroup: APx009]
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Chlorellaceae Chlorella
Organism Chlorella sorokiniana    [TaxId: 3076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsorAPx03
start..stop
S start..stop
CsorAPx05 191 2e-58 22..351 22..334
CsorAPx04 170 3e-50 18..351 17..339
CsorAPx02 161 1e-44 75..351 439..700
KflAPx-R02 133 9e-37 106..341 92..299
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2813255..2813485 231 N° 2 2813635..2813759 125 N° 3 2813989..2814148 160 N° 4 2814284..2814391 108
N° 5 2814550..2814678 129 N° 6 2814875..2814995 121 N° 7 2815137..2815216 80 N° 8 2815389..2815493 105
join(2813255..2813485,2813635..2813759,2813989..2814148,2814284..2814391,2814550 ..2814678,2814875..2814995,2815137..2815216,2815389..2815493)


exon

Literature and cross-references CsorAPx03
Protein sequence: CsorAPx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352 (331)
PWM (Da):   %s   37814.38 (35767.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.84 (9.83) Peptide Signal:   %s   cut: 22 range:22-352
Sequence 393
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAALLRVALALTLCLAPAALAACPFAGLAASDGRRELMAMGGSAPAPCDVERLDLRNERTMLRSIPFQSQTAHAVKRVAWDVIYYGERSMSLPGVSSKACPITAALVRAAFHDAGTWNGTTKKGGPNGSLRFEITQVVNSDARMVLAAAYIDKWAEAINARLAAMAAQSNSKHGGPRIPVGTTISLADVTQLAGAAAITALGGLKRWELFDLIPLGRKDQGKADDVSGLPPPFFAFKDLACRFLGMGYTLQDLVALSGAHTVGFFETGIEQTGGHSNFWRPMDRTPYAFDTDYFQLVLNKRGAFTSDNTLLTNRKTAALVTKYARNRRAFLDAFAHAYLKMASMNAVWQPYK

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCGCCCTGCTCCGGGTTGCGCTCGCCCTTACGCTCTGCCTCGCGCCTGCAGCGCTGGCCGCCTGCCCCTTCGCTGGCCTGGCTGCTTCCGATGGGCGCCGTGAATTGATGGCCATGG
GTGGCTCCGCGCCGGCCCCCTGCGACGTCGAGCGGCTGGATTTGCGCAATGAGCGAACCATGCTGCGGAGCATCCCCTTCCAGTCTCAAACCGCTCATGCCGTCAAGAGG
GTGCGCGGAA
GGGTGTGTTCGCGGGGCCGTAGAGGCGCCGCCTCCGTGCAGCGGCCGGTACAGTCGCGCCGTCAGCGCCGCCATGCATGCGCCACATTGCAGCCACACCTTGCTTAACTAATGTGCTGCC
TTCACCATGCACTCCACAGGTCGCCTGGGATGTCATTTACTACGGTGAACGCTCCATGTCACTGCCGGGCGTGTCCTCCAAAGCGTGCCCCATCACTGCCGCTTTGGTGCGTGCCGCTTT
CCACGATGCGGGCACCTGGAACGG
GTGAGCGCTGTCGCCATGCCTTCAAGCCGGGTTGCATTGCTGCCACAATGGCAGGCAGCATGGGGCACATGGCGCAAGGTGCACCACGCTTGCAGC
AGAGCGCCCACATGCATGCATGCATGCGCATGCGGCATGCGCATGCCGCGGCCCCGCCGCCAGTCCATCGCACCCTGCGAGAGCGCGCACCGCAGCCCTCCTCCATCCCCACCCCACTGT
TGTCCCCCTGCAGGACCACCAAGAAGGGCGGCCCCAACGGTTCCCTGCGCTTTGAGATCACCCAGGTCGTCAACAGCGACGCCCGCATGGTCTTGGCCGCTGCTTACATCGACAAGTGGG
CCGAGGCCATCAACGCGCGCCTCGCCGCCATGGCTGCTCAGTCCAACTCCAAG
GTGAGATCGACTGGCATCGAGAGGTCAGGCAGCAGACTGCCGCAAGCGTCACTGCACTGGCATGTGC
GCCAGGGAGAGGCACAACTCAACAAATGCGCCACCCACCTCCCACCTCTCACCGCCCGCCCTTGGCAGCATGGCGGCCCTCGCATCCCCGTTGGCACCACCATCTCCCTGGCGGACGTGA
CCCAGCTGGCCGGCGCAGCAGCCATCACCGCCCTGGGCGGCCTCAAGCGCTGGGAG
GTGGGTCCTCGCTCCGTGACTGCCACGCCGCCTCTCCATCTCTTGCTGCCGCCCTGCCGCCATG
CCTGCCCGCTTGAGCAACAGCAGTGCCAATGGCATCTACTCCCCACTGCCCCCTAAAGCTCTGCGCTCGTCCCACGCTCCCCACCCACCCGCAGCTTTTTGATCTCATCCCTCTGGGTCG
CAAGGACCAGGGCAAGGCGGACGATGTGAGCGGCCTGCCGCCGCCCTTCTTCGCCTTCAAGGACCTGGCCTGCCGCTTCCTGGGCATGGGCTACACGCTGCAG
GTGGGGATGGCAGCTGA
GCTTGCAGTGGGTCAGCGAACAGTGTGCACGTGGTGGTGTACGAGGAGTGAGCAAAACAGAGCAGCCTGGCAGACTGGTCACTCTAGTTGCAGTGCGAACGCCACAAGGCATGTGTGCTC
CTGGGACCATCCCCCCTTGCTGCCACTCAACCTGCACCTCTGCTCCCCCTCACGTGTAGGATCTAGTGGCCCTGAGCGGCGCGCACACGGTTGGATTTTTCGAGACAGGCATCGAGCAGA
CCGGGGGCCACAGCAACTTCTGGCGCCCCATGGACCGGACGCCCTATGCCTTTGACACTG
GTGAGACAACTGGCCGCTGTGTGCTTGCAAGCGGATGTGCAAGGCGGCAGGGCTCTCGGG
CTTCCAGCGCTGGCTAAGTAGTTTGAGCAACTGCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCTCCCCCGCCCTGCAGACTACTTCCAGCTGGTGCTGAACAAGAGGGGAGCCTTCA
CGTCTGACAACACGCTGCTGACCAACCGCAAGACCGCAGCG
GTGAGCAAGCACAGCAGAGGGATGGCAGGTTACAGGCGGGGCAGGGGTGCTGTTATCAGCTGTGGATGCCTGCAACTGC
CATGCTGGCTGGTTCAAGTTGACAGGGCAGCAGTGCTGCGGCATGGCAACATTGCACTGAAAGCCGTGCCCACTGATCCGCTTTCTAATGCAGCTGGTGACCAAGTATGCACGCAACCGC
CGCGCCTTCTTGGACGCCTTTGCTCACGCTTATCTGAAGATGGCTAGCATGAACGCCGTGTGGCAGCCTTACAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCGCCCTGCTCCGGGTTGCGCTCGCCCTTACGCTCTGCCTCGCGCCTGCAGCGCTGGCCGCCTGCCCCTTCGCTGGCCTGGCTGCTTCCGATGGGCGCCGTGAATTGATGGCCATGG
GTGGCTCCGCGCCGGCCCCCTGCGACGTCGAGCGGCTGGATTTGCGCAATGAGCGAACCATGCTGCGGAGCATCCCCTTCCAGTCTCAAACCGCTCATGCCGTCAAGAGG
GTCGCCTGGG
ATGTCATTTACTACGGTGAACGCTCCATGTCACTGCCGGGCGTGTCCTCCAAAGCGTGCCCCATCACTGCCGCTTTGGTGCGTGCCGCTTTCCACGATGCGGGCACCTGGAACGG
GACCA
CCAAGAAGGGCGGCCCCAACGGTTCCCTGCGCTTTGAGATCACCCAGGTCGTCAACAGCGACGCCCGCATGGTCTTGGCCGCTGCTTACATCGACAAGTGGGCCGAGGCCATCAACGCGC
GCCTCGCCGCCATGGCTGCTCAGTCCAACTCCAAG
CATGGCGGCCCTCGCATCCCCGTTGGCACCACCATCTCCCTGGCGGACGTGACCCAGCTGGCCGGCGCAGCAGCCATCACCGCCC
TGGGCGGCCTCAAGCGCTGGGAG
CTTTTTGATCTCATCCCTCTGGGTCGCAAGGACCAGGGCAAGGCGGACGATGTGAGCGGCCTGCCGCCGCCCTTCTTCGCCTTCAAGGACCTGGCCT
GCCGCTTCCTGGGCATGGGCTACACGCTGCAG
GATCTAGTGGCCCTGAGCGGCGCGCACACGGTTGGATTTTTCGAGACAGGCATCGAGCAGACCGGGGGCCACAGCAACTTCTGGCGCC
CCATGGACCGGACGCCCTATGCCTTTGACACTG
ACTACTTCCAGCTGGTGCTGAACAAGAGGGGAGCCTTCACGTCTGACAACACGCTGCTGACCAACCGCAAGACCGCAGCGCTGGTGA
CCAAGTATGCACGCAACCGCCGCGCCTTCTTGGACGCCTTTGCTCACGCTTATCTGAAGATGGCTAGCATGAACGCCGTGTGGCAGCCTTACAAGTGA

Retrieve as FASTA