Entry information : CsorAPx05
Entry ID 15188
Creation 2018-04-27 (Christophe Dunand)
Last sequence changes 2018-04-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2018-04-27 (Christophe Dunand)
Peroxidase information: CsorAPx05
Name CsorAPx05
Class Ascorbate peroxidase    [Orthogroup: APx009]
Taxonomy Eukaryota Viridiplantae Chlorophyta Trebouxiophyceae Chlorellaceae Chlorella
Organism Chlorella sorokiniana    [TaxId: 3076 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsorAPx05
start..stop
S start..stop
CsorAPx02 288 9e-92 66..341 432..707
CsorAPx03 187 1e-56 44..334 46..351
CsorAPx04 157 1e-45 19..334 17..339
KflAPx-R02 110 5e-28 105..324 90..299
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 587409..587567 159 N° 2 587724..587797 74 N° 3 587968..588083 116 N° 4 588336..588388 53
N° 5 588557..588625 69 N° 6 588853..588894 42 N° 7 589098..589202 105 N° 8 589460..589476 17
N° 9 589639..589712 74 N° 10 589945..590055 111 N° 11 590241..590317 77 N° 12 590522..590578 57
N° 13 590844..590921 78  
join(587409..587567,587724..587797,587968..588083,588336..588388,588557..588625, 588853..588894,589098..589202,589460..589476,589639..589712,589945..590055,59024 1..590317,590522..590578,590844..590921)


exon

Literature and cross-references CsorAPx05
Protein sequence: CsorAPx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (307)
PWM (Da):   %s   36431.58 (34575.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   10.33 (8.55) Peptide Signal:   %s   cut: 22 range:22-328
Sequence 384
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTLPKRAASLLLLVLAIAGAQACPFASMVQGGDVEAVGRKLLQATCNVAALDRTNQASPPAGPPTQTAVDVAVRNVAKQIIFFSTDRNAPGVGGAGAPNRNVRHGALLRQAFHDCGTYVKTARTGGCNGSLRTAGETGAAVNRNIVSTVALVQRYRQLINAEINRRIAAKQLPAGTQISYADVFQLTGAAAVVATGGPANLFDRVEMGRVDWATRTDDVSQLPDRNLGFTALSCRFLSMGFTLRDMVALSAAHTLGAVNGRAMTPTPQTFDASDYFQLVSRGTAAFRTDNALTDSRTAQLVQRWSNSANRGEMLAAFADAYIKMGRMNAMWRSYPQPAEYVRA

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACGCTTCCCAAGCGGGCCGCGTCCCTGCTGCTGCTGGTGCTGGCCATCGCCGGCGCGCAGGCATGCCCCTTTGCGAGCATGGTGCAGGGCGGCGATGTGGAGGCCGTGGGGCGCAAGC
TCCTGCAAGCGACCTGCAACGTTGCTGCGCTGGACCGG
GTGCGCGGCCAATTGGAGCGGCCAATTGGCCGCTCGGCCCGCAATGCAGCGCAAGGCGCGCGCAGGCAGCGCTGTGGTCCCT
ACCCGCCGCCGCCGCATCCTAGCCGCCAACCGAACCTTGCGCGATTCCCCACCAACCCCATTGGCCCCCCGCAGACCAACCAGGCTTCCCCGCCTGCTGGTCCCCCGACCCAGACGGCCG
TTGATGTGGCTGTGCGCAACGTTGCCAA
GTGCGCCTGCCGGGTCCCGCTGCCGCTTGCTGTTGTGCAGCGGTGCACCACCGCTGCCGCCGCTGGGTGGGGTGGCGCATTGCTGGCCGGCT
GGTGCTCAACCTCAAGCTGTTGCATCTCAGTGACGTGCTCCATTGATTTCAACGCTCATAAGGTTCATTGCTTTGCAGGCAAATCATTTTCTTCTCCACTGATCGCAATGCGCCTGGCGT
GGGCGGCGCCGGCGCCCCCAACCGCAACGTGCGCCACGGCGCCCTGCTGCGCCAAGCCTTCCATGACTGCGGAA
GTGAGTTGCCCTTTGTTCTGATGAAGTGCTAGCATGTGCTGTGCTA
TGAAGTGCTGCTTGTGCTGCTGCGCCTGGCCTTGCAGGCTTCCGCACTGAGTGTGAAGGAGGTGTTCTACCAGCACCGCCTCATGCCAACCGCTGCCGCTGCCACTGCAAGTCAGGACTG
CATGTATGTACTTTGCCAACGCTGCCGTAAGGGCCCCAGTACACCACCTTCTCACATCCACCATCCTCTCCACCCTTGTTCCACAGCTTACGTTAAGACAGCTCGCACCGGCGGCTGCAA
CGGCAGCCTGCGTACCGCG
GTGTGTACAGCGCACAGCCAGCACCGCACCGCACCGCACAGCATGCTGTGCATGAACAGCAAGCGCATCACCTGCGGTCTACCTCTGCTGTCTCGAACGCC
TGAAAGCCACCTGCGATCCCATGGCATTGCTGACTGCTGTCTCGCTGCTACTGCACTGTGCCTGCAGGGCGAGACCGGCGCTGCCGTGAACCGCAACATTGTCAGCACCGTTGCGCTGGT
GCAGCGCTACCGCCAG
GCAAGCGGCACTGCTGAAGAGAAACCTTGGTTGTTTGAATAATTGGACTGATGCATGTGCGCCCAGCTGGCGATCCGGCAGTCTGCTGCGACTTGCAGGTTGTA
GCCTGCGTTTGTTTGCATGCTGGGGTATGGCGGATGATGTCGAACTGCACTTCTTCCTGCTCCTGCTCACAGCTGCCTGCTTTGCCCTCTCACCTGACTGCAACTATTCTGCGCTGCCTG
CAGCTGATCAACGCTGAGATCAACCGCCGGATTGCCGCCAAGCAGGTGCGGCTGTGTAGCATGTGCAGAGGGGCAGTGCTGAGTGCTGGTGGAGGGCTGCTGAATTGCAGTGCTGGGCCC
CAGCACCCGAGCGGCGCAGCAGGCCGCCTCACGGCAGTGCAGACCACGGGTGTACGCTGGTTGCACTGCACTGTGCGCCGCTCAAACCCGCCGTAACTCTTCAAATCCCCACCTGGTTGC
CCCTGCAGCTGCCCGCCGGCACCCAGATCTCGTATGCCGATGTGTTCCAACTGACTGGCGCCGCAGCGGTTGTGGCCACCGGCGGCCCCGCCAACCTCTTCGATCGCGTGGAGGTGCGCG
CCATGCCGTTCAGATTACTTTGTGTGCATGCATGCGTTCTGTATATGCCGGCAGGCACAGCAGGCTTCCGGCCACCACAGCCTCTTACAGCCTGCATGATTGTGCGGGAGAGTGGTGTGC
AGCTGGTCTGCCTTTTGCATCGCCATGCTGATCTGCCACTGCTGCAAGGCCTGGGAATCTTGGCTCCTGACTGCCGCCTACACTTCCCTCCCTCCCCTTCCTCCCCCATGCAATGGTCCT
TTCCTTGAAGATGGGCCGCGTTGACTGGTGAGCACGCCTGCTGTCCTGCCAGGTTTACGGTTGGGCCTTGTCGCACGTGAAATCATGAACAAGTGTAGGCTGTTGCGCCGCGTCTCACTG
AGCCAGCCTGGAGGCCAAGCAAGCTGAACAAGTCATCAACCCACCCGCTCCCCCGCCCCATGCCCGCAGGGCCACCCGCACCGACGACGTGTCGCAGCTGCCCGACCGCAACCTGGGCTT
CACCGCCCTGTCCTGCCGCTTCC
GTGCGTTCATGCTGCTGCTGCTGCATGCGTTGATCCTGCCGCTTCCGTGCGTCAATCCTGCTGCTGCATGCGTTGATCCCGCTGCTGCCACCGCTGC
CACGCCAGGGCTGGCTTCTGCTCTGGCCGCGCCCAATCAGCCAAGCATGCGCTTGTTGCCAGATGCCACTCCTGCCCTGCCTCCCCGCTGCATCGCCTCCCCATAATCCGTATCTGTTCC
CCCCGCCTGCCGCAGTGAGCATGGGCTTCACTCTGAGGGACATGGTGGCCCTGTCGGCCGCCCACACGCTGGGTGCTGTCAACGGCCGCGCCATGACCCCCACCCCCCAGACCTTTGATG
CCTCCG
GTACGCAGCTACTTGTGCTGGTGGTGGCCTGGGGTCAGCTGCTGTAGCGCTGGTTTGGGCCTGCCGAGACTGTGCGGTGTGGCACCCAACCCAGCTGGCATGCCTTCAGGTTTG
CCCCGCAACCACACACGCTGTGCCCAGCAACCACACAAGCCACCTGCCGTTCCCTTCCATGCCGCACACAGACTACTTCCAGCTTGTGTCCCGCGGCACCGCCGCCTTCCGCACCGACAA
TGCGCTGACTGACTCGCGTACCGCCCAG
GTAGTGACTTTTGGTGGAAGGAAGTGTGGGCTTCTGCGGGCACTTGTGCTGAGCAAGTATGCGTCTGGCAGCTTGGGGACAGCACCTGTAAA
TGGCTGACATGCCTGCTGAAGGAAGGCATTCCGTTTGCATGCACACAGCCGCGCTGACCTGGCTGGCTGGCTCCCTCCCTGCCTCCCTTCCTTACCCCCTTGCTCTCTGCAGCTGGTGCA
GCGGTGGAGCAACTCCGCTAACCGCGGCGAGATGCTGGCGGCCTTTGCG
GTGAGGGCTGAGGGTCGCTGCCACTGCTGCCACTGCTGCGGGCGCTGCTGCCAGTGTCGCCACACCAACCA
CGCTTAGCTGGACCCACGCTAGTTAATGAAAGGCATCACTTCACCGCAGAAGCAACCACCTCACTTGCCTCCCTCCCCCCAATTGCAGGACTCGTACATCAAGATGGGCCGCATGATGAC
AGCTCCCTTTCACCCTGTTTGGCGGGAAAACGAGCCAACCAGAACCCTGTTTGCCTCCCTCCCCCCAATTGCAGGACGCGTACATCAAGATGGGGCGCATGAACGCCATGTGGCGCTCCT
ACCCCCAGCCCGCCGAGTATGTCCGCGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGACGCTTCCCAAGCGGGCCGCGTCCCTGCTGCTGCTGGTGCTGGCCATCGCCGGCGCGCAGGCATGCCCCTTTGCGAGCATGGTGCAGGGCGGCGATGTGGAGGCCGTGGGGCGCAAGC
TCCTGCAAGCGACCTGCAACGTTGCTGCGCTGGACCGG
ACCAACCAGGCTTCCCCGCCTGCTGGTCCCCCGACCCAGACGGCCGTTGATGTGGCTGTGCGCAACGTTGCCAAGCAAATCA
TTTTCTTCTCCACTGATCGCAATGCGCCTGGCGTGGGCGGCGCCGGCGCCCCCAACCGCAACGTGCGCCACGGCGCCCTGCTGCGCCAAGCCTTCCATGACTGCGGAA
CTTACGTTAAGA
CAGCTCGCACCGGCGGCTGCAACGGCAGCCTGCGTACCGCG
GGCGAGACCGGCGCTGCCGTGAACCGCAACATTGTCAGCACCGTTGCGCTGGTGCAGCGCTACCGCCAGCTGATCAACG
CTGAGATCAACCGCCGGATTGCCGCCAAGCAG
CTGCCCGCCGGCACCCAGATCTCGTATGCCGATGTGTTCCAACTGACTGGCGCCGCAGCGGTTGTGGCCACCGGCGGCCCCGCCAACC
TCTTCGATCGCGTGGAG
ATGGGCCGCGTTGACTGGGCCACCCGCACCGACGACGTGTCGCAGCTGCCCGACCGCAACCTGGGCTTCACCGCCCTGTCCTGCCGCTTCCTGAGCATGGGCT
TCACTCTGAGGGACATGGTGGCCCTGTCGGCCGCCCACACGCTGGGTGCTGTCAACGGCCGCGCCATGACCCCCACCCCCCAGACCTTTGATGCCTCCG
ACTACTTCCAGCTTGTGTCCC
GCGGCACCGCCGCCTTCCGCACCGACAATGCGCTGACTGACTCGCGTACCGCCCAG
CTGGTGCAGCGGTGGAGCAACTCCGCTAACCGCGGCGAGATGCTGGCGGCCTTTGCGGACGCGT
ACATCAAGATGGGGCGCATGAACGCCATGTGGCGCTCCTACCCCCAGCCCGCCGAGTATGTCCGCGCCTGA

Retrieve as FASTA