Entry information : MsPrx01 ( Prx1A)
Entry ID 158
Creation 2006-12-27 (Christophe Dunand)
Last sequence changes 2016-02-16 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-02-16 (Achraf Jemmat)
Peroxidase information: MsPrx01 ( Prx1A)
Name (synonym) MsPrx01 ( Prx1A)
Class Class III peroxidase    [Orthogroup: Prx043]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago sativa (alfalfa)    [TaxId: 3879 ]
Cellular localisation N/D
Tissue type Leaves
Inducers Pathogen interaction
Pseudomonas syringae infection
Repressor N/D
Best BLASTp hits
Perox score E-value MsPrx01
start..stop
S start..stop
MtPrx26 687 0 1..350 1..353
PsPrx14 611 0 1..350 1..356
GmPrx24 547 0 10..350 7..350
MtPrx15 541 0 1..350 1..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1515..1737 223 N° 2 2016..2206 191 N° 3 3286..3451 166 N° 4 3595..4067 473
join(1515..1737,2016..2206,3286..3451,3595..4067)


exon

Literature and cross-references MsPrx01 ( Prx1A)
Literature el-Turk,J., Asemota,O., Leymarie,J., Sallaud,C., Mesnage,S.,Breda,C., Buffard,D., Kondorosi,A. and Esnault,R. Nucleotide sequences of four pathogen-induced alfalfa peroxidase-encoding cDNAs. Gene 170 (2), 213-216 (1996)
Protein ref. UniProtKB:   Q93XK6   O24081 [Mismatch]
DNA ref. GenBank:   AJ306689.1 (1515..4067)
Protein sequence: MsPrx01 ( Prx1A)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (323)
PWM (Da):   %s   37301.08 (34413.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   4.29 (4.29) Peptide Signal:   %s   cut: 28 range:28-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNPLGLSATAFCCMVFVLIGGVPFSNAQLDPSFYNSTCSNLDSIVRGVLTNVSQSDPRMLGSLIRLHFHDCFVQGCDASILLNDTATIVSEQSAPPNNNSIRGLDVINQIKTAVENACPNTVSCADILALSAEISSDLANGPTWQVPLGRRDSLTANNSLAAQNLPAPTFNLTRLKSNFDNQNFSTTDLVALSGGHTIGRGQCRFFVDRLYNFSNTGNPDSTLNTTYLQTLQAICPNGGPGTNLTDLDPTTPDTFDSNYYSNLQVGKGLFQSDQELFSTNGSDTISIVNSFANNQTLFFENFVASMIKMGNIGVLTGSQGEIRTQCNAVNGNSSGLATVVTKEDGMASSF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and mRNA.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCACTTGGTCTAAGTGCAACAGCTTTTTGCTGTATGGTGTTTGTGCTAATTGGAGGAGTACCCTTTTCAAATGCACAACTAGATCCTTCATTTTACAACAGTACATGTTCTAAT
CTTGATTCAATCGTACGTGGTGTGCTCACAAATGTTTCACAATCTGATCCCAGAATGCTTGGTAGTCTCATCAGGCTACATTTTCATGACTGTTTTGTTCAAG
TATGTGTGTTCTCCATC
TCTTACCTTGACATTTTCATGACTGTTTCCTACTATTTATTTTTCTTTTTCAAATTTAAATTTTAAGGACGGTGAATTTTGTGAAATTATAAGTGTCTCGTAGTAATATTTAAGCGAGTT
AGACCTCGAGGCTTTAAATACAAAGATTCAATAAAACCTCATTACCATGTATGTGATTTCGTCAAATTTGTTGTTATTTCAAACATGCGCGCATAATGAGTTCAAATGAATATATGCTAA
TAGTTGTGAACTTTGTCGCAGGTTGCGATGCCTCAATTTTGCTGAACGATACGGCTACAATAGTGAGCGAGCAAAGTGCACCACCAAATAACAACTCTATAAGAGGTTTGGATGTGATAA
ACCAGATCAAAACAGCGGTGGAAAATGCTTGTCCTAACACAGTTTCTTGTGCTGATATTCTTGCTCTTTCTGCTGAAATATCATCTGATCTG
GTATATATTTCCTAGTTTCCTAGTCATA
TATTTAAATGAACTTCTAGCAAGATAGTATGTTTTTTAATTCCAAAAAAACGTAGATATTGGTAGGAAAATCAAAGAAAAGAAAGTAAGAACAGAATGAGATCGTATGAAAGAGAGAGTT
GTCACAACCCATGTTTTGGACAACTTATGAGACAATCAAAGATAAACAAATAAACGTAGGTATTGACACAAAAATCAAAACAACAGAGAGAGTAAGAACACAATAAAATATATGAAAGAG
AAAGTTGTCTTAAGATTTGTCACAAAATGATTGTACAAATGTCATTTCTCAATTATATAACCGGTGGGATTTCACAAGCTTGTAAGCCCTAATTCGGGTAAGGCAAGGCTATCAAATTAT
GGTGTGGTCCAGCAGTAGCGTAAACTTTTATATTGTGTCTGGTTATGTATATTTTGGTTTGGACTGATATGATGGTTTTAATTTTACATGATCATATCTTGAACATTGATGTTCCCACTT
TTGAGATTTCCTACTTTTGAGATTGTTAAAAAACTCATCCGGCGGTAGTTAACCGTCGAAATTCCTTGTTCCACAATAGTTAATTATCGAAGTGGCATTTATTTAACAAACAGTTTACTG
TCGATGGGAGTAAAGATGTAATTTTTGGTGTTTTATAGCGAAAGATGAAGTGGGAACAGCAAAATTCTCATATCTTATGCTCTAAAGTTGTACTTTCCTTTTCATGTTGTTTTATGATGT
TTAAATAACATTGTTAAAGAAATACTAACCGTAAAAATAAATTTAATACATTGTTCGAACTTTGGTACCTCTAACTTTGTGTGTGTGAAATTATGATGACTTTGTCATCTCGTATGTCAA
CAAAAAAAAAAAATACTAACCGTAAAAATAAATAGTTAAAATAGTTTTATAAAAATGAATTAGTTATTTGCCTATAATTTGGACTAGTTTAAATAGCTCAAACAAATCATTATCAAGGAT
ATGTGACAATGTACGTTTTTCAATTTTATTAATTAACATCATAAACCATAATATATATTTTGTTTATCCTACAATGCAACAAAAATTGCAGGCAAATGGTCCTACTTGGCAAGTTCCATT
AGGAAGAAGGGATAGTTTGACAGCAAATAATTCCCTTGCAGCTCAAAATCTTCCTGCCCCCACTTTCAACCTTACTCGACTAAAATCTAACTTTGATAATCAAAACTTCAGTACTACTGA
TCTAGTTGCACTCTCAG
GTATAAATTTTTTGTTTCTTTAAAATATGTAACTTGAATGTATGTACATATAGTGTAAAATTTACTCATATTAAGTATCCCCCATTTAATTTTTTTTTCTTCT
AATAACATCGTTGTATTAACTTTTTTCATTCATTTTTTAGGTGGCCATACAATTGGAAGAGGTCAATGCAGATTTTTCGTTGATCGATTATACAATTTCAGCAACACTGGAAACCCCGAT
TCAACTCTTAACACGACCTATTTACAAACATTGCAAGCAATATGTCCCAATGGTGGACCTGGTACAAACCTAACCGATTTGGACCCAACCACACCAGATACATTTGACTCCAACTACTAC
TCCAATCTCCAAGTTGGAAAGGGCTTGTTTCAGAGTGACCAAGAGCTTTTTTCCACAAATGGTTCTGACACTATTTCTATTGTCAATAGTTTCGCCAATAATCAAACTCTCTTCTTTGAA
AATTTTGTAGCCTCAATGATAAAAATGGGTAATATTGGAGTTTTAACTGGATCTCAAGGTGAAATTAGAACACAGTGTAATGCTGTGAATGGAAATTCTTCTGGATTGGCCACTGTAGTC
ACCAAAGAAGATGGAATGGCTAGCTCATTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATCCACTTGGTCTAAGTGCAACAGCTTTTTGCTGTATGGTGTTTGTGCTAATTGGAGGAGTACCCTTTTCAAATGCACAACTAGATCCTTCATTTTACAACAGTACATGTTCTAAT
CTTGATTCAATCGTACGTGGTGTGCTCACAAATGTTTCACAATCTGATCCCAGAATGCTTGGTAGTCTCATCAGGCTACATTTTCATGACTGTTTTGTTCAAG
GTTGCGATGCCTCAATT
TTGCTGAACGATACGGCTACAATAGTGAGCGAGCAAAGTGCACCACCAAATAACAACTCTATAAGAGGTTTGGATGTGATAAACCAGATCAAAACAGCGGTGGAAAATGCTTGTCCTAAC
ACAGTTTCTTGTGCTGATATTCTTGCTCTTTCTGCTGAAATATCATCTGATCTG
GCAAATGGTCCTACTTGGCAAGTTCCATTAGGAAGAAGGGATAGTTTGACAGCAAATAATTCCCTT
GCAGCTCAAAATCTTCCTGCCCCCACTTTCAACCTTACTCGACTAAAATCTAACTTTGATAATCAAAACTTCAGTACTACTGATCTAGTTGCACTCTCAG
GTGGCCATACAATTGGAAGA
GGTCAATGCAGATTTTTCGTTGATCGATTATACAATTTCAGCAACACTGGAAACCCCGATTCAACTCTTAACACGACCTATTTACAAACATTGCAAGCAATATGTCCCAATGGTGGACCT
GGTACAAACCTAACCGATTTGGACCCAACCACACCAGATACATTTGACTCCAACTACTACTCCAATCTCCAAGTTGGAAAGGGCTTGTTTCAGAGTGACCAAGAGCTTTTTTCCACAAAT
GGTTCTGACACTATTTCTATTGTCAATAGTTTCGCCAATAATCAAACTCTCTTCTTTGAAAATTTTGTAGCCTCAATGATAAAAATGGGTAATATTGGAGTTTTAACTGGATCTCAAGGT
GAAATTAGAACACAGTGTAATGCTGTGAATGGAAATTCTTCTGGATTGGCCACTGTAGTCACCAAAGAAGATGGAATGGCTAGCTCATTCTAA

Retrieve as FASTA