Entry information : NnPrx11
Entry ID 16199
Creation 2020-03-11 (Christophe Dunand)
Last sequence changes 2020-03-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: NnPrx11
Name NnPrx11
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Nelumbonaceae Nelumbo
Organism Nelumbo nucifera (sacred lotus)    [TaxId: 4432 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value NnPrx11
start..stop
S start..stop
NnPrx11-1 585 0 1..336 1..343
CsPrx41 523 0 6..336 12..338
CclPrx93 523 0 6..336 12..338
PtPrx92 521 0 1..336 1..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 58..288 231 N° 2 449..640 192 N° 3 801..966 166 N° 4 1086..1507 422
join(58..288,449..640,801..966,1086..1507)


exon

Literature and cross-references NnPrx11
Cluster/Prediction ref. Genebank:   104600479
Protein sequence: NnPrx11
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336
PWM (Da):   %s   37058.39  
PI (pH):   %s   4.34
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPQFLQYLVLSFFFILSFFAFDLQATDPPLTLDYYASTCPTVLEIVRKEMECAVQSDPRNAASILRLHFHDCFVQGCDGSILLDDTITLQGEKKAPANVNSLRGFEIIDSIKNKLESECPETVSCADMLTIAARDAVILVGGPYWDVPLGRKDSRTASFSLATSNLPTPEQGLLGLISKFLYQGLSVTDMVALVGAHTIGMARCVNFRERIYGDFQETAGSDPLSETYLSSLKSTCPPTGGDDNITALDYFSPNLFDNSFYHLLLKGEGLLNSDQELYSSLLGFQTKELVQKYALDSVAFFQQFSDSMVKMGNITDPENFTTGEVRKDCRFINT

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTTCCCCAGTTTCTGCAATACTTGGTTCTAAGTTTCTTCTTCATTTTAAGCTTCTTTGCTTTTGATCTGCAGGCGACAGATCCTCCTTTAACACTGGACTATTACGCGTCGACA
TGTCCTACCGTGCTGGAAATTGTGAGGAAGGAGATGGAATGTGCTGTGCAATCGGATCCACGTAATGCAGCATCCATTCTCCGGCTGCATTTTCATGACTGCTTTGTACAG
GTTAGTAGT
CCAAGGCTTCTGGGTTTCTTCAGTAGTGTTGGTTTCCTGCTGGCTTCTGGGTTTATTCATATTCAGCCCTGTAGATATATACTATACACATACACCATCTGGCTCTGGGTACGTAACATT
GACTGAAATCTAGTTAGCTCCATGGACACAGGGCTGTGACGGGTCAATTTTGCTAGATGACACGATAACACTCCAAGGAGAGAAGAAAGCACCCGCCAATGTGAACTCTCTGAGAGGTTT
CGAGATTATTGACAGTATCAAGAATAAGCTCGAATCAGAATGCCCTGAAACTGTGTCTTGTGCAGATATGCTTACCATTGCAGCAAGGGATGCTGTTATTCTG
GTAAAACTGATCAGAAC
GTTTACTAAATAATAATAGTATTTAAGTCGATTAGTAATCTTAATTTGGGTTTAATTTCTCGAGAAAGCTCTGTGATGAAATCTTTCATGAAGCTAAGGAGGACGGATTACCGATTAAAT
ATTGGTCATCACTAATGTTTTAGGTTGGTGGGCCTTACTGGGACGTTCCTCTGGGTAGAAAAGATTCAAGAACTGCAAGCTTCAGCCTAGCAACCTCGAACCTGCCCACTCCTGAACAGG
GTCTTCTGGGTCTCATATCAAAGTTCCTGTATCAAGGCCTCTCAGTTACAGATATGGTTGCTCTTGTAG
GTAATGCCTGAATCGAATAATCTTTTTGCCTGTATCCTAAGAGAATTCTAC
AAATAAAACAATTAGTGTTGGATGGAGTAATTAATTAATAAAACTAGCTGTTATCTGAAAATTTACAGGTGCACACACCATTGGCATGGCTCGATGCGTGAACTTCCGAGAGAGGATCTA
TGGAGACTTCCAGGAAACTGCAGGCAGTGATCCGCTCAGCGAGACGTATCTCAGCAGCTTGAAATCTACTTGCCCACCCACTGGGGGAGATGACAACATCACTGCACTGGACTACTTTTC
GCCTAACCTTTTCGACAACTCCTTCTACCATCTACTGCTCAAAGGAGAAGGATTACTGAACTCGGACCAGGAATTGTATTCTAGTCTTCTGGGGTTCCAAACCAAGGAGCTTGTTCAGAA
ATATGCATTAGACTCGGTTGCTTTCTTTCAGCAGTTCTCAGATTCTATGGTGAAGATGGGAAATATTACTGATCCTGAGAACTTCACCACTGGGGAAGTAAGGAAAGATTGCAGATTTAT
TAACACATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTTCCCCAGTTTCTGCAATACTTGGTTCTAAGTTTCTTCTTCATTTTAAGCTTCTTTGCTTTTGATCTGCAGGCGACAGATCCTCCTTTAACACTGGACTATTACGCGTCGACA
TGTCCTACCGTGCTGGAAATTGTGAGGAAGGAGATGGAATGTGCTGTGCAATCGGATCCACGTAATGCAGCATCCATTCTCCGGCTGCATTTTCATGACTGCTTTGTACAG
GGCTGTGAC
GGGTCAATTTTGCTAGATGACACGATAACACTCCAAGGAGAGAAGAAAGCACCCGCCAATGTGAACTCTCTGAGAGGTTTCGAGATTATTGACAGTATCAAGAATAAGCTCGAATCAGAA
TGCCCTGAAACTGTGTCTTGTGCAGATATGCTTACCATTGCAGCAAGGGATGCTGTTATTCTG
GTTGGTGGGCCTTACTGGGACGTTCCTCTGGGTAGAAAAGATTCAAGAACTGCAAGC
TTCAGCCTAGCAACCTCGAACCTGCCCACTCCTGAACAGGGTCTTCTGGGTCTCATATCAAAGTTCCTGTATCAAGGCCTCTCAGTTACAGATATGGTTGCTCTTGTAG
GTGCACACACC
ATTGGCATGGCTCGATGCGTGAACTTCCGAGAGAGGATCTATGGAGACTTCCAGGAAACTGCAGGCAGTGATCCGCTCAGCGAGACGTATCTCAGCAGCTTGAAATCTACTTGCCCACCC
ACTGGGGGAGATGACAACATCACTGCACTGGACTACTTTTCGCCTAACCTTTTCGACAACTCCTTCTACCATCTACTGCTCAAAGGAGAAGGATTACTGAACTCGGACCAGGAATTGTAT
TCTAGTCTTCTGGGGTTCCAAACCAAGGAGCTTGTTCAGAAATATGCATTAGACTCGGTTGCTTTCTTTCAGCAGTTCTCAGATTCTATGGTGAAGATGGGAAATATTACTGATCCTGAG
AACTTCACCACTGGGGAAGTAAGGAAAGATTGCAGATTTATTAACACATGA

Retrieve as FASTA