Entry information : NnPrx11-1
Entry ID 16200
Creation 2020-03-11 (Christophe Dunand)
Last sequence changes 2020-03-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: NnPrx11-1
Name NnPrx11-1
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Nelumbonaceae Nelumbo
Organism Nelumbo nucifera (sacred lotus)    [TaxId: 4432 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value NnPrx11-1
start..stop
S start..stop
NnPrx11 570 0 1..343 1..336
CsPrx41 526 0 9..343 8..338
CclPrx93 526 0 9..343 8..338
PtPrx92 525 0 12..343 11..341
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 56..307 252 N° 2 453..644 192 N° 3 765..930 166 N° 4 1041..1462 422
join(56..307,453..644,765..930,1041..1462)


exon

Literature and cross-references NnPrx11-1
Cluster/Prediction ref. Genebank:   104597816
Protein sequence: NnPrx11-1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343
PWM (Da):   %s   37948.09  
PI (pH):   %s   6.16
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALSQYAKPPTPFLQHSAFIFFSILSVYAINLHATDPPLTLDYYSSTCPNVLEIVRKEMECAVLSDPRNAASILRLHFHDCFVQGCDGSVLLDDTITLRGEKKAPTNIRSLRGFRIIDGIKNKLESECPGIVSCADMLTIAARDAVILVGGPYWHVPLGRKDSRTASFSLATTNLPTPDQGLLTLISKFLYQGLSVTDMVALAGAHTIGMARCVNFRERIYGDFQETAHKNPLTEIYLSNLKSGCPPIGGDDNTTAMDYFSPNLFDNSFYQILLRGEGLLNSDQEMYSSKLALETKELVKKYAFDPIAFFQQFSDSMVKMGNITDPDSFVTGEVRKNCRFINT

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTTTCTCAGTATGCAAAACCTCCAACTCCATTCCTGCAACATTCAGCCTTTATCTTCTTCTCCATCTTAAGCGTCTATGCTATTAATTTGCATGCGACAGACCCTCCTTTAACA
CTGGATTATTATTCATCTACGTGCCCGAATGTGCTGGAGATTGTAAGGAAAGAGATGGAATGTGCAGTGCTGTCTGATCCACGCAATGCAGCGTCCATACTCCGCCTCCATTTTCATGAC
TGCTTTGTCCAG
GTTAGTACGTATTCTATGCCTATGGCTGGCCGGTGGGTTCCCCTTCATCTGTTTCCTCATTATGTTCACTCTAGCCCTGTGACTTATCTTTTTAATTAGTTGAGATTT
TCAGACGTACTGTTAACAAAATCTCTGTGTGACACAGGGATGTGACGGGTCAGTTTTGCTTGATGACACAATCACCCTCAGAGGAGAGAAGAAAGCACCCACTAATATCCGCTCCCTGAG
AGGTTTCAGGATCATTGACGGGATCAAGAACAAGCTCGAATCTGAGTGCCCCGGAATCGTATCCTGTGCAGATATGCTCACCATTGCAGCAAGGGATGCAGTCATTCTG
GTAAAACTAAG
GACTACTACGTAGCAGTGTACCACTAATGTTTGTCTTAGGTCCAGATGCTGATGTCTTACTACATATATAGAAATCAAGGATTAATTAATTGTTGCACTGCTCTTTTAGGTGGGCGGGCC
TTACTGGCATGTTCCTCTGGGTAGAAAGGATTCCAGGACTGCAAGCTTCAGCCTAGCAACCACGAATCTGCCTACTCCTGATCAGGGTCTTCTCACTCTCATATCAAAGTTCCTTTATCA
AGGTCTCTCAGTCACAGATATGGTAGCTCTTGCAG
GTATATATGTATCTCTTTACAGCCCGAGGGTATATTTTTATATAATTTACAAGCTAGGAATTAAAATGGGCTAATAATAAATTAA
TGGTGGTCGTGGAATATAATTGCAGGTGCACACACCATTGGCATGGCCCGCTGCGTGAACTTCCGAGAGAGGATTTATGGAGACTTCCAGGAAACTGCACACAAGAATCCGCTCACAGAG
ATATATCTCAGCAACCTGAAATCTGGTTGCCCACCCATTGGAGGAGATGACAATACGACTGCGATGGATTATTTCTCACCCAACCTTTTCGACAATTCTTTCTATCAGATACTGCTGCGA
GGGGAGGGACTACTGAACTCGGACCAGGAGATGTACTCCAGCAAGCTGGCACTTGAGACCAAGGAGCTTGTTAAGAAATATGCCTTCGACCCAATTGCTTTCTTCCAGCAGTTCTCAGAT
TCTATGGTGAAGATGGGAAATATCACCGATCCTGACAGCTTCGTTACAGGGGAAGTAAGGAAAAATTGCAGATTTATTAACACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACTTTCTCAGTATGCAAAACCTCCAACTCCATTCCTGCAACATTCAGCCTTTATCTTCTTCTCCATCTTAAGCGTCTATGCTATTAATTTGCATGCGACAGACCCTCCTTTAACA
CTGGATTATTATTCATCTACGTGCCCGAATGTGCTGGAGATTGTAAGGAAAGAGATGGAATGTGCAGTGCTGTCTGATCCACGCAATGCAGCGTCCATACTCCGCCTCCATTTTCATGAC
TGCTTTGTCCAG
GGATGTGACGGGTCAGTTTTGCTTGATGACACAATCACCCTCAGAGGAGAGAAGAAAGCACCCACTAATATCCGCTCCCTGAGAGGTTTCAGGATCATTGACGGGATC
AAGAACAAGCTCGAATCTGAGTGCCCCGGAATCGTATCCTGTGCAGATATGCTCACCATTGCAGCAAGGGATGCAGTCATTCTG
GTGGGCGGGCCTTACTGGCATGTTCCTCTGGGTAGA
AAGGATTCCAGGACTGCAAGCTTCAGCCTAGCAACCACGAATCTGCCTACTCCTGATCAGGGTCTTCTCACTCTCATATCAAAGTTCCTTTATCAAGGTCTCTCAGTCACAGATATGGTA
GCTCTTGCAG
GTGCACACACCATTGGCATGGCCCGCTGCGTGAACTTCCGAGAGAGGATTTATGGAGACTTCCAGGAAACTGCACACAAGAATCCGCTCACAGAGATATATCTCAGCAAC
CTGAAATCTGGTTGCCCACCCATTGGAGGAGATGACAATACGACTGCGATGGATTATTTCTCACCCAACCTTTTCGACAATTCTTTCTATCAGATACTGCTGCGAGGGGAGGGACTACTG
AACTCGGACCAGGAGATGTACTCCAGCAAGCTGGCACTTGAGACCAAGGAGCTTGTTAAGAAATATGCCTTCGACCCAATTGCTTTCTTCCAGCAGTTCTCAGATTCTATGGTGAAGATG
GGAAATATCACCGATCCTGACAGCTTCGTTACAGGGGAAGTAAGGAAAAATTGCAGATTTATTAACACATAA

Retrieve as FASTA