Entry information : AipaRboh03(araip.Araip.GM90H.1)
Entry ID 16335
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-02 (Christophe Dunand)
Peroxidase information: AipaRboh03(araip.Araip.GM90H.1)
Name AipaRboh03(araip.Araip.GM90H.1)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Arachis ipaensis    [TaxId: 130454 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AipaRboh03
start..stop
S start..stop
AdurRboh07 1962 0 1..946 1..946
NschRboh06 1788 0 1..946 1..951
AeveRboh06 1781 0 1..946 1..950
CcaRboh05 1757 0 1..946 1..945
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 730..1381 652 N° 2 1609..1768 160 N° 3 2274..2322 49 N° 4 3050..3163 114
N° 5 5052..5474 423 N° 6 5612..5998 387 N° 7 6091..6186 96 N° 8 6323..6438 116
N° 9 6645..6812 168 N° 10 6905..7064 160 N° 11 7172..7369 198 N° 12 7476..7604 129
N° 13 7713..7791 79 N° 14 7889..7998 110  
join(730..1381,1609..1768,2274..2322,3050..3163,5052..5474,5612..5998,6091..6186 ,6323..6438,6645..6812,6905..7064,7172..7369,7476..7604,7713..7791,7889..7998)


exon

Literature and cross-references AipaRboh03(araip.Araip.GM90H.1)
Protein ref. GenBank:   XP_020974788.1
Protein sequence: AipaRboh03(araip.Araip.GM90H.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   946
PWM (Da):   %s   107021.46  
PI (pH):   %s   9.74
Sequence 987
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNGHPKHQRRWASDTVPARATVSAGTSPGTESTSAGGEEFVEVTLDLQDDDTIVLRSVEPATVINVVVDSGTTGGSGHETPASVSRSPTIRRTSSRGLRQFSQELKAEAVAKAKQFSHELKAELRRFSWSRSSSSAQNVGGSNAGGGFETALAARALRKQRAQLDRTRSGAHKALRGLRFISSKSNNGVDAWNEVQSNFNRLAKDGYLHRSDFAQCIGMRDSKEFALELFDALSRKRRLTVEKISRDELFEYWTQITDQSFDSRLQIFFDMVDKNEDGRIAEEEVKEIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRARSPIRRASRRLVYYLQENWRRLWLLTLWVCIMIGLFTWKFFQYKQKDAFQIMGYCLLTAKGAAETLKFNMAIILLPVCRNTITWLRSTKLAYAVPFDDNINFHKTIAAAIVVGVILHAGDHLACDFPRLVRASEADYEKYLKGVFGDHKPSYLDIVKGIEGVTGILMVILMSIAFTLATKWFRRNLIKLPKPFSRLTGFNAFWYSHHLFVIVYVLLIIHGIKLYLVHKWYLKTTWMYLSIPVLLYAAERTIRFFRSGFYTVRLIKVAIYPGNVLTLQMSKPPQFRYKSGQYMFVQCPAVSPFEWHPFSITSSPGDDYLSVHIRQLGDWTQELKRVFAEACEPPVSGKSGLLRADETTKKSLPKLKIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIIKMEEQADSVSDISRGSDQSVGSTDSPSLNKIAPKRKKTLKTTNAYFYWVTREQGSFDWFKGVMNEVAELDQRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVFSKMCSKHYGGRIGVFYCGAPVLAKEINKLCFDFNEKGPTKFEFHKEHF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAACGGTCATCCGAAGCACCAGCGCAGGTGGGCATCCGACACCGTTCCCGCCAGAGCAACCGTCAGTGCGGGAACTTCGCCGGGAACAGAGTCAACCTCCGCCGGCGGAGAAGAGTTTG
TGGAGGTCACTCTCGATCTTCAAGACGATGACACTATCGTCCTTCGGAGCGTTGAACCAGCCACTGTCATTAACGTTGTTGTTGACAGTGGTACCACTGGTGGCAGTGGACACGAAACTC
CGGCGTCTGTTTCTAGGTCGCCGACGATCCGGCGGACCTCGTCAAGAGGCTTGCGGCAGTTCTCGCAGGAGCTGAAGGCGGAGGCGGTTGCAAAGGCAAAGCAGTTCTCGCATGAGCTTA
AGGCAGAGCTGCGACGGTTCTCGTGGAGCCGTTCGTCTTCGTCAGCTCAAAATGTTGGCGGAAGCAATGCCGGCGGCGGATTTGAGACGGCGCTGGCAGCTCGCGCTCTAAGAAAGCAGC
GCGCTCAGCTAGATCGCACTCGTTCCGGTGCTCACAAAGCACTGCGCGGTCTGCGATTTATTAGCAGTAAATCAAATAATGGCGTTGATGCGTGGAACGAGGTGCAGAGCAACTTCAATA
GGCTCGCCAAGGACGGTTATCTCCATCGCTCCGATTTTGCTCAGTGCATAG
GTTCGTATCTTTTTCAAAATTCTGTTCAGGTTATTGCAAATTTGTAATGTTCCTTTTAACAGTTTGATT
CGTTATCCTCAAGTGTTTTCCCTCAACGTTTATTGCATTAAGTTTTATTTATTTATTTATTTATTTACAGTTGCAACTTGCAATTATTTAGATCTCACATCCTCTGTCATTTGAATTTTG
ATATTGTGCGCTTAAGGTTGTTATGCTTTTCTATGCAGGAATGAGAGATTCCAAGGAATTCGCTCTGGAATTATTTGATGCTCTAAGCCGGAAGCGAAGGTTGACGGTTGAGAAGATAAG
CAGGGATGAACTTTTTGAATATTGGACGCAAATTACCGATCAAAGCTTTGATTCGCGACTTCAGATCTTCTTCGACAT
GTAATCATTGAGTTATTATTGCAGTCCAACTTAATTAATAGT
GATTACTAATATTAATATTTCAATGCTTTTCAATTACTTTCCTTTCTTTAAGGAAAAGTTTGCAAGTCCTAATTAATTTATGTCATAATAAACACATTGTTAAATATTAGCATGTCACCA
TATATTTGCATTGACACTTAAATATTCGTAAAAAATCTTTGATGCTTTCTTAGCTTGTAATTCAATTACGTTTTTAGATCATCAATTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTTTCTTCAATTATTATGGTTTTATATAACGTGACTTAGTATTTTAAAAATTTTATTCATCAAACAGGGTGGATAAAAACGAAG
ATGGAAGAATCGCCGAAGAAGAAGTAAAAGAG
GTATAGAAGACTTTTATATTACAAACCAAAATGTTCTCTCTTATTTTTGTATTAAACTGAATTTATTTTCTTTTCTGTCTATTTAATT
TAGCAATAATCATTGTTCAATATTCAGCGTTTAAAATTCAAGGTTTAAACTTATGCCTCTATTTTATATTATGAAGTGTGATTCCAAATTATGAATTCAACTGTGTCACTGCTTAATTGT
TTATCCATTTAATAACCATGCATTCTACGAGTATAACATAAGTATTCTCTTTTCGTTGTAGATTATTTATTTTGTTATATTATTAATTCGTCGCTAGCATGGCGTCCACTTGATCTTCAA
TTAATCAACGTTAGGCAGGATTGGGTAAACTTAATCGCATGATTATTAAATGAACTACTTCTAATATTCAGTATTTCCACTCATGACGTTTTCCAAATTCTAGAAACTCAAGCATAATAA
TATTAGTTGGTATATTTCAAGAGTCAGTGAACTATATACGTCTTACTTTTTCGGCTTTGGTTATACAGATGGCGCTTTCATTTTTCTTATTTTACCGAATTCATAGAATTTATAATGGAG
ACGTTTTCAGTGGAGTAGTTGGTGGGGGCGTAGTCGTCATTTTGTGCTGAACTTTTCTTTTGGCCTTTTTTTTTAATCAAACACGTAATACTCAATTAAAGCTTTTACATTAAGCTTTTT
CGTTGGCCAATTCCTTTTTTTTTTCTTATTAATTTCCAGATCATCATGTTGAGTGCTTCAGCAAATAAGTTATCGAGATTAAAAGAGCAGGCTGAAGAATATGCCGCTCTGATTATGGAA
GAGTTAGACCCAGAAGGACTTGGTTACATCGAG
GTAGGAAATCGCACTATATTAGATAGATAATATTATTTCTGACTTTATCAACCCGCACTACTCTAACATAGCCGTACATATTTTACA
GTTATCTACATAGATACTCTACCTTTAGTTGTGTTACCGTGTTAGTACGAGGTGAATTACGATAATGCAGCTTAGATTAGTCAGTTTCGAATTAGGACCACCACACCTGTCTTCGGTCAA
AATTTGGCCCAAATAGTGTTATTTGAAAATAATTCAGAATATTTTTAATGATGTTCAACCATGCAGGAAAGAAGGGAGATGAAGAAAGAAAATAAACTGTGATAATTAATAATACAAATG
ATCTTGCCTTCAAAGAAAAATGATTTGATGTCATAGCAACTCATTGCATCATATGTTAATAATTTAATAGTGTATATAATAAGATCTTGTTTCTATCCTTTTGCTGCGTCAAACTTACCT
AAAATCAGGTAGAGAAAACTTGGTCATAGTGTACGTGTTGCAATTAACTCGTTATTCCTATTAAGGTAGTTCCTCGCCGCAGGTAGTGATGCCGTATAATGTGACTTATCGGAAATATTT
GGTAACCAAAGAAAATTAGTCAAAAGCAGCCATAACTTATCTTATTTAACATTTATTAATTGTTGCGACAATTAATGAATGCTAAATAAGGTAAGTTTTGACTGTATTTTTTGTCTCCCT
AATATTAGCCGTGACTTATTACCATAGCTTAGAGTAACCTTATTTCTTTATCACTTGACTTTTCTTCATAAGATATTCATACTTTTTTTTTGTCTTTTAATAAAGAATAATTTATATGTT
TTGAATAGAGGTCATTGAATAATTATTAATTTTCTGCTAATTATTTGTCAAATGTTGAATTAAGATTAGAAGTTTAACTACTAAGCTAATACTTAAAGGACCAACAATTAGCTCCTTTTT
TTTTTTAATTTCATGAAGTATGTTTTTGAAGGTGCATGTGAGGAAGAGAAATGTCATTTTTAGAAGAAATAAAAGAAGAAAAATGACCGGAGTTGACTACTAAATAATTTGGTTCTATAT
ACCTTTTCATAATTATTGTGCATCTTGGTGTTTTTTTTTAGGAATGCTAGCGACCAGCACTTTTTGTTAAATTCTAGCCAACACTTAACCATTAAAAGAAAATTGAATGATTCTACACCA
TTAGATGCAATCTCACACCATCAAAAACATTATTGATGGCTAATTAATGACTAAAAACCACAAAATCTGCTGGTTTCCTAAACTTTTTCTTTTCTTTTTATATGTTTTTGGAAGAAGATT
TACTTTAAATAGAAACTTACTATCAAAGCTCAAAAGTTCCAACGGATTATACTAAATGTTTTTTTAATTATCAAAACTCAAAAGGTTATTATTATTTTTTAAAATTTAACAATATTATAC
ATATTATTTAGTATATTTAAGATAGTATTCAAAAGGATTTTTAATGTTGTTGGTTGATGTCTCTGCATTATTGAATATGGTCACTATGACTTGATTGACTTCGTGTCAATGAGAAATCAA
TATATATTCCTCAAACAATTGACCACATACAAATTTGAAGTGTTGAAAGGAGTATATGCTTGCCCTTCTTCTTTTTTTAATATCTCCCAAAGCACTAAGAATTCCAAGAGTGAGTGCCTG
ATGAATGGTGTTCTGAGACATATCGGACACGTCTCATTATGCTTCTTTTCCCAAGTGGCTTTTCTGCTGCTTGGCCAGTTACGCGTACACTACTCAAAGCGTAAGTGCGCGTGCTGCATT
CTTTTGCTGTTGTGATGCTGATAATGAAGGGAATGTAGTAATCACTGGCATTATTTCTTTTGCATGATTGAGTCTCTAATTGTTTTGTGGCAACTTGGATTGTCATCATCTGTCCCCGCA
GCTATGGCAATTGGAGACGCTTCTTTTGCAGAAGGACACGTACCTTAACTACAGCCAAGCTCTAAGCTACACAAGCCAAGCTTTGAGCCAGAACCTTCAGGGACTAAGGGCAAGAAGTCC
TATTCGTAGGGCGAGCCGCAGGTTGGTCTACTATTTGCAAGAGAATTGGAGGAGACTTTGGCTCTTAACATTGTGGGTTTGCATAATGATTGGGCTGTTCACATGGAAGTTCTTTCAGTA
TAAGCAGAAAGATGCCTTTCAAATAATGGGTTACTGTCTTCTAACGGCCAAAGGTGCCGCTGAGACTTTAAAGTTCAACATGGCAATTATACTATTGCCCGTATGTAGAAATACCATTAC
TTGGCTTAGGTCTACCAAGCTGGCTTATGCTGTACCTTTTGACGACAACATTAACTTTCATAAG
GTACGCATTGTATATATATGATCGCCTTTAGAATTTCAAAACACTTAATTCCAGGA
ATTCAAAAACAAAACAACTAGACATGATATGTAGATTGGGGTCTGCTATTTTTCTTCAAATTCACTTATTTATACTTGCAGACAATTGCTGCGGCCATTGTGGTTGGTGTTATACTTCAT
GCCGGGGATCACCTTGCATGCGATTTTCCAAGACTTGTAAGAGCTTCTGAGGCTGATTACGAGAAGTATTTGAAGGGTGTATTTGGTGATCATAAACCCAGTTACCTAGACATTGTTAAA
GGGATTGAGGGTGTGACTGGAATATTGATGGTGATTTTAATGTCAATAGCATTTACACTTGCAACTAAATGGTTCAGGAGAAATCTGATTAAGCTGCCTAAACCATTTAGTAGGCTTACT
GGCTTTAATGCCTTCTGGTATTCACACCATCTGTTTGTCATTGTTTATGTCCTGCTCATCATCCATGGTATAAAGCTTTATCTTGTGCACAAATGGTACCTCAAAACG
GTATGCAAATCA
GATTTCGGTTATTAGGAATCTTAGTTAAATAACTTGTTCTTCGGCGATTGCTAACTTGACGCATCAATTTCTTTGTGCAGACATGGATGTATCTTTCAATTCCAGTTTTACTTTATGCGG
CAGAAAGAACAATCAGATTCTTCCGTTCTGGTTTCTATACTGTCCGTCTTATAAAG
GTGAGTACTGAGCAGATGAGGGGGAAACATGTGCAAGGCGCTTAAAATGGGCTTTTAACTTCAT
TATAAACATAGCTTTATTGAGTAGCTCTCAGCTTATATTAACTTTTTGACATTGTGAAAAACTTCTATTTAGGTCGCCATATATCCTGGAAATGTTCTAACATTGCAAATGTCTAAGCCT
CCCCAGTTCCGATACAAGAGTGGACAATACATGTTTGTACAATGTCCCGCTGTTTCTCCGTTTGAATG
GTAAGTTGCATTTCAGTTTTTCTTGCTTCTTTTTCTTATATTTAAGTATATA
TAAAACAGAGCGCAACAGGGTATTGATTGAATTATGAAAGGCAGTGAAAGTGAACCACTAAAGTGATATGTCATTTTTATGAGTAGTTAGTTACAGTCTTGGTTATGCTTCTTGCGTGAT
GTGACGGTAACATGGATCAATATATGTATGACAGGCATCCATTTTCTATTACCTCATCCCCTGGCGATGACTACCTGAGTGTTCACATTCGGCAATTGGGTGATTGGACACAGGAGCTTA
AAAGGGTATTCGCTGAAGCATGTGAGCCCCCTGTATCCGGAAAAAGTGGCCTTCTCAGGGCTGATGAAACAACCAAGAAAAG
GTAAGTGTTGCACTTGCCATTTACTTTTGCCTTCTTGT
TTTGATTCTCAGGACAAATAATTTATGTTTGTTTGTTATTAACAATGGATACAGTCTTCCAAAGCTAAAGATAGACGGACCTTATGGTGCGCCAGCTCAAGATTATAGAAAATACGATGT
TTTGTTACTTGTCGGTCTCGGAATAGGAGCAACACCTTTCATCAGCATTCTGAAAGATCTTCTAAACAACATCATCAAAATGGAGGAGCAGGCG
GTGAGTGTTTGTGCTACACAGGAAAA
TAGAACTGTTATGCCATCCGTTTGCAATTGTCTGGAAATTCATTTCTGACTAAACTGACTATCATGATTACTTCTGTCCAGGATTCAGTCTCTGATATAAGTAGAGGTTCAGACCAAAGT
GTTGGGAGTACAGATTCACCATCTCTAAACAAAATTGCTCCAAAACGGAAGAAAACATTGAAGACTACCAACGCTTATTTCTACTGGGTTACAAGAGAGCAAGGTTCTTTTGATTGGTTT
AAAGGAGTCATGAATGAAGTAGCTGAACTTGATCAACGG
GTAATGATTAATGCAGAGGATTTATTTATTCTACCGAGGAATTATCTTTATCAGAATTTGTTTCCTTGGCGCCACATGATT
AAGAACTAGTAATGTTGAACTACAGGGTGTCATTGAGATGCACAATTACTTGACTAGTGTATACGAGGAAGGTGATGCAAGATCTGCCCTCATTACCATGGTGCAAGCACTCAACCATGC
CAAAAACGGTGTTGATATCGTCTCAGGGACTAGG
GTAAGCCTTCTAAATTTTATTATTTGTTCTCTTGTTGCCGTTCAATTTCTTTATTGGGAGTGAGTAATTCTAAAACATCGATTCGC
TTCTTCAAATTTCTATCGTCAGGTGCGAACCCATTTTGCTAGGCCTAACTGGAAGAAGGTATTCTCCAAAATGTGTTCCAAGCACTATGGCGGACGAATAGGTCAGTTTGTCTCCAACAA
GCATGCATTGCAAATGCACTTTGTTATTCTTTTCTCTTTTACTGATATTATGCTTATCTTAATTCTGATCTCTATCAGGGGTATTTTATTGCGGAGCACCAGTTTTGGCAAAAGAAATTA
ACAAGCTCTGCTTCGACTTCAATGAAAAAGGTCCAACAAAATTTGAGTTTCATAAGGAACACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAACGGTCATCCGAAGCACCAGCGCAGGTGGGCATCCGACACCGTTCCCGCCAGAGCAACCGTCAGTGCGGGAACTTCGCCGGGAACAGAGTCAACCTCCGCCGGCGGAGAAGAGTTTG
TGGAGGTCACTCTCGATCTTCAAGACGATGACACTATCGTCCTTCGGAGCGTTGAACCAGCCACTGTCATTAACGTTGTTGTTGACAGTGGTACCACTGGTGGCAGTGGACACGAAACTC
CGGCGTCTGTTTCTAGGTCGCCGACGATCCGGCGGACCTCGTCAAGAGGCTTGCGGCAGTTCTCGCAGGAGCTGAAGGCGGAGGCGGTTGCAAAGGCAAAGCAGTTCTCGCATGAGCTTA
AGGCAGAGCTGCGACGGTTCTCGTGGAGCCGTTCGTCTTCGTCAGCTCAAAATGTTGGCGGAAGCAATGCCGGCGGCGGATTTGAGACGGCGCTGGCAGCTCGCGCTCTAAGAAAGCAGC
GCGCTCAGCTAGATCGCACTCGTTCCGGTGCTCACAAAGCACTGCGCGGTCTGCGATTTATTAGCAGTAAATCAAATAATGGCGTTGATGCGTGGAACGAGGTGCAGAGCAACTTCAATA
GGCTCGCCAAGGACGGTTATCTCCATCGCTCCGATTTTGCTCAGTGCATAG
GAATGAGAGATTCCAAGGAATTCGCTCTGGAATTATTTGATGCTCTAAGCCGGAAGCGAAGGTTGACGG
TTGAGAAGATAAGCAGGGATGAACTTTTTGAATATTGGACGCAAATTACCGATCAAAGCTTTGATTCGCGACTTCAGATCTTCTTCGACAT
GGTGGATAAAAACGAAGATGGAAGAATCG
CCGAAGAAGAAGTAAAAGAG
ATCATCATGTTGAGTGCTTCAGCAAATAAGTTATCGAGATTAAAAGAGCAGGCTGAAGAATATGCCGCTCTGATTATGGAAGAGTTAGACCCAGAAGGAC
TTGGTTACATCGAG
CTATGGCAATTGGAGACGCTTCTTTTGCAGAAGGACACGTACCTTAACTACAGCCAAGCTCTAAGCTACACAAGCCAAGCTTTGAGCCAGAACCTTCAGGGACTAA
GGGCAAGAAGTCCTATTCGTAGGGCGAGCCGCAGGTTGGTCTACTATTTGCAAGAGAATTGGAGGAGACTTTGGCTCTTAACATTGTGGGTTTGCATAATGATTGGGCTGTTCACATGGA
AGTTCTTTCAGTATAAGCAGAAAGATGCCTTTCAAATAATGGGTTACTGTCTTCTAACGGCCAAAGGTGCCGCTGAGACTTTAAAGTTCAACATGGCAATTATACTATTGCCCGTATGTA
GAAATACCATTACTTGGCTTAGGTCTACCAAGCTGGCTTATGCTGTACCTTTTGACGACAACATTAACTTTCATAAG
ACAATTGCTGCGGCCATTGTGGTTGGTGTTATACTTCATGCCG
GGGATCACCTTGCATGCGATTTTCCAAGACTTGTAAGAGCTTCTGAGGCTGATTACGAGAAGTATTTGAAGGGTGTATTTGGTGATCATAAACCCAGTTACCTAGACATTGTTAAAGGGA
TTGAGGGTGTGACTGGAATATTGATGGTGATTTTAATGTCAATAGCATTTACACTTGCAACTAAATGGTTCAGGAGAAATCTGATTAAGCTGCCTAAACCATTTAGTAGGCTTACTGGCT
TTAATGCCTTCTGGTATTCACACCATCTGTTTGTCATTGTTTATGTCCTGCTCATCATCCATGGTATAAAGCTTTATCTTGTGCACAAATGGTACCTCAAAACG
ACATGGATGTATCTTT
CAATTCCAGTTTTACTTTATGCGGCAGAAAGAACAATCAGATTCTTCCGTTCTGGTTTCTATACTGTCCGTCTTATAAAG
GTCGCCATATATCCTGGAAATGTTCTAACATTGCAAATGT
CTAAGCCTCCCCAGTTCCGATACAAGAGTGGACAATACATGTTTGTACAATGTCCCGCTGTTTCTCCGTTTGAATG
GCATCCATTTTCTATTACCTCATCCCCTGGCGATGACTACCTGA
GTGTTCACATTCGGCAATTGGGTGATTGGACACAGGAGCTTAAAAGGGTATTCGCTGAAGCATGTGAGCCCCCTGTATCCGGAAAAAGTGGCCTTCTCAGGGCTGATGAAACAACCAAGA
AAAG
TCTTCCAAAGCTAAAGATAGACGGACCTTATGGTGCGCCAGCTCAAGATTATAGAAAATACGATGTTTTGTTACTTGTCGGTCTCGGAATAGGAGCAACACCTTTCATCAGCATTC
TGAAAGATCTTCTAAACAACATCATCAAAATGGAGGAGCAGGCG
GATTCAGTCTCTGATATAAGTAGAGGTTCAGACCAAAGTGTTGGGAGTACAGATTCACCATCTCTAAACAAAATTG
CTCCAAAACGGAAGAAAACATTGAAGACTACCAACGCTTATTTCTACTGGGTTACAAGAGAGCAAGGTTCTTTTGATTGGTTTAAAGGAGTCATGAATGAAGTAGCTGAACTTGATCAAC
GG
GGTGTCATTGAGATGCACAATTACTTGACTAGTGTATACGAGGAAGGTGATGCAAGATCTGCCCTCATTACCATGGTGCAAGCACTCAACCATGCCAAAAACGGTGTTGATATCGTCT
CAGGGACTAGG
GTGCGAACCCATTTTGCTAGGCCTAACTGGAAGAAGGTATTCTCCAAAATGTGTTCCAAGCACTATGGCGGACGAATAGGGGTATTTTATTGCGGAGCACCAGTTTTGG
CAAAAGAAATTAACAAGCTCTGCTTCGACTTCAATGAAAAAGGTCCAACAAAATTTGAGTTTCATAAGGAACACTTCTAA

Retrieve as FASTA