Entry information : CcajRboh03(Cajca_10167)
Entry ID 16344
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-04 (Christophe Dunand)
Peroxidase information: CcajRboh03(Cajca_10167)
Name CcajRboh03(Cajca_10167)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Cajanus cajan    [TaxId: 3821 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcajRboh03
start..stop
S start..stop
GmRboh02 1732 0 1..884 1..885
GmRboh15 1707 0 1..884 1..871
PvRboh02 1698 0 1..884 1..881
PauRboh04 1693 0 1..884 1..881
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59..563 505 N° 2 1157..1316 160 N° 3 2543..2591 49 N° 4 3005..3118 114
N° 5 3310..3738 429 N° 6 3931..4317 387 N° 7 4423..4518 96 N° 8 4620..4735 116
N° 9 4839..4941 103 N° 10 5054..5127 74 N° 11 5360..5871 512 N° 12 5967..6076 110
join(59..563,1157..1316,2543..2591,3005..3118,3310..3738,3931..4317,4423..4518,4 620..4735,4839..4941,5054..5127,5360..5871,5967..6076)


exon

Literature and cross-references CcajRboh03(Cajca_10167)
Protein ref. GenBank:   XP_020212169.1   KYP71208.1 [Incorrect prediction]
Cluster/Prediction ref. Genebank:   109796787
Protein sequence: CcajRboh03(Cajca_10167)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   884
PWM (Da):   %s   100511.79  
PI (pH):   %s   9.47
Sequence 925
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIEESHEQEYAWSETESTGSRSTRVGFSGPMSGPLVVSNKKSTKKSARFKDDQDFVEITLDVRDDGVSLQNIKGGDPETALLATRLEKRPSSLSLRLRQVSQELKRMTSSKKFDRVDRTKSGAARALRGLKFITKNVGTEGWSQVEKRFDELAVESKLPKTRFSLCIGMHESKEFAGELFDALSRRRGITSGSITKDELREFWEQITDQSFDSRLQTFFDMVDKNADGRIAEEEVKEIIALSASANKLSKIQERAEEYAALIMEELDPDNLGYIEIYNLEMLLLQAPAQSTHITTDSRIMSQMLSQKLVPTKEHNPIKRGLRALAYFVEDNWKRIWIIALWLAICAALFTWKFIEYKHRAVFHVMGYCVTSAKGAAETLKFNMALILLPVCRNTITWLRSKTKLGMAVPFDDNINFHKVIAFGIAIGVGIHAIAHLTCDFPRLLHATDEEYEPMKPFFGEERPNNYWWFVKGTEGWTGITIVVLMAIAYTLAQPWFRRGRLNLPKPLKKLTGFNAFWYSHHLFVIVYGLFIVHGYYLYLSKKWYKKTTWMYLAIPMILYACERLLRAFRSGYKSVKILKVAVYPGNVLALHMSKPQGFKYSSGQYIFVNCSDVSPFQWHPFSITSAPGDDYVSVHIRTLGDWTSQLKAVFARACQPASGDQSGLLRADMLQGNNIPRMPNILIDGPYGAPAQDYKNYEVILLVGLGIGATPLISILKDVLNNMKQQKDIEEGMVESGVKNKRKPFATNRAYFYWVTREQGSFEWFKGVMDDVAEYDKDGIIELHNYCTSVYEEGDARSALITMLQSLHHAKSGVDIVSGTRVKTHFARPNWRSVFKHTALKHPGKRVGVFYCGAHALVGELKRLSLDFSRKTNTKFDFHKENF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGATTGAAGAGAGCCATGAGCAGGAGTACGCGTGGTCGGAGACGGAGAGCACGGGGAGCAGGAGCACGCGAGTGGGCTTCAGTGGGCCCATGAGCGGCCCACTGGTGGTGTCCAACA
AGAAGAGCACCAAGAAGAGCGCCAGGTTCAAGGACGACCAGGACTTCGTCGAGATCACGCTGGACGTGCGCGATGACGGCGTCTCCCTCCAGAACATCAAGGGCGGCGACCCCGAGACCG
CGCTCCTCGCCACCCGCCTCGAGAAGCGCCCCTCCTCGCTCTCCCTGCGCCTCCGCCAGGTCTCGCAGGAGCTCAAGCGCATGACGTCATCCAAGAAGTTCGACAGGGTCGACAGGACCA
AATCTGGCGCTGCTCGCGCCCTCCGAGGCCTCAAGTTCATCACCAAAAACGTCGGAACTGAAGGCTGGTCACAGGTGGAGAAGCGTTTCGATGAGTTGGCCGTTGAATCCAAATTGCCCA
AAACGCGCTTCAGTCTGTGCATTG
GTATGTATAATGTATAATACTTTATTCTGCTTTTTCAAACCATGCACGTGTCAAACTTACTCATTTTATGCTTTTGTTATACGTATTATTATCAAA
TGAAACATATATATACGTACTTAACCTATTTGAGGATGGGACAGTATTTTTTTTTAATATTTATTTTCTTATACTTAATTTACTTTGAATCTGTCTTTATTTATTTATTTACTTTTTTGC
ATCAAGTGTGTCATTAAAATATTAATTATTTTAATCTATCTTATTATTTACCTATTAAGCTTGGTGTAGGCAGACTAGAATACATTATAATAATAATAATAAAAAGTGTGAGAGTTATTG
TCCTTTAGTGAGATTAAATAATTAAGAATGTGTTTAAAATATGTTAAATAAAAGAATGCACTACTACTCCTACAGTTTCTTCACTGGGATTGGTCAATATAGTATCATATTTTATTCTTT
TAAATAAAAGTAATTTTAAAAACTGGATATTTTTATAAATTTAATATTATTAACCAATTTAATAATTTTTGAAGCTCTGTAAATTAATTACAAATGTCTAACAAATATCGGTGAATTTTG
GACGGAATGATGTATAGGCATGCACGAGTCGAAGGAGTTTGCTGGCGAATTATTTGATGCATTATCTCGTCGTCGGGGCATAACATCAGGTTCCATAACCAAGGATGAGTTGCGCGAATT
CTGGGAACAAATTACGGATCAGAGTTTTGATTCAAGGCTTCAGACCTTCTTTGATAT
GTAAGCTTTTATACTTCAATTTCATTTCCTTTTTTTTTTTTTTTTTATAAAAAAAATTCCTTA
ATTAAAAATGACCCTTATATATATAGAATATCATCAGAGATAGTGGGACATTGCTTAGCGATTATTTTTCGCTGTCAAACAGAGAAAAAAACAACGCCGCATTTCGTGCATTTGCATGTG
AAACATGCATGCGTCATAATACAATTATTGACTTTCTAATATTATAAATCTATGATCATTAAATACAACGAAAGGCACCGGAAGCAGCGTGAGACTTTTTTTTAAGGTACTTAAGTGACG
CGTTTTTTTTGTAACATCTTCAAATGAAGAGGTTTTGAGTGTAGTTCTTGTTAACAGTATTTTATTTATGTCATAAGAGTTTCACTATCAGTCATTTTAAGGTTAATGTTATGCCTGATG
CCTTAATTATCGACTTCTTTTGTTTCAAAATATAAAAGTAGTATATGTAAAGAAGATTAATATAGATACGAATTTTCAATTATAATTAAATACTTATTTGAATTATATGTTTAATTGAAA
AATGATCTAAAATAAAACTCTTTCAGGGCTAGGTGTTTCTACGTTTTCTTTAGTATGAGATTATAATTTTCACTCTGGGGTAAACTTAATTAATTAGTCTAAACACATTGTATTTATGTT
GAATTTTGGAACCCTATATTATAACTAGATTCTACGTCAATGTCAATTCGCTAAATGAGCTACACCTCCAGGTTAAAATAATGAGTTGGTCTATGTATTTATTTAAAACACTTCTACAAA
TTGTTTTGCTTATTCTTTAAGGATGTGAGTTATTTTATTCATTAATCGGTCAATCCTTAACATATTTTAAGATTAGGTGTGGAATAATCGGGGGTGTAGCTAGAGAGTACGAAGAAATCA
TCATGAATATTAAACAACAAATTGAATACATAAAGAAAAAAAAATGAATGAATCAACGGTTGGCCCCTTTAAGGGAGGAAAAAAGAAGGAAAGAATCAAAGCTTTGGCCATTTAAGAAAA
AGAACGAATCAACGGATGGTTGGGTTGACCTTTGAAAAATGCATGTGAAATAAGCTAGCAGCTAATTGAGAAACATTACATGTACGTATATCTAAGTCAAAAAAGAAAAACAATAATGAG
TTAAATGTCAACATTATTGAATTTTGATTGGATCTTCACCCATTTGCTATGACTTGTCCCTAAATAATTTTAATTCATGTCAGGGTGGACAAGAATGCCGACGGAAGAATCGCCGAAGAA
GAAGTTAAAGAG
GTGAGGGTTTACTGTGATAAGAAGATAAAAAAATATTCTCTCTTTATTTTTTATTCTCGTACTTGAGAGAGGGAAAAATGAAAAATTTGTATTGAAAAATCCTGCACA
AAAAAAAATATTGTATTTGTTTTTATCTTTATTTTTCTTATCTCTCTTATACATTAGAGAGTAAAAAATAAGCTATATATTCCTTAATCTAGAAGTCGTATATATATTATTGTTTCAATA
CTTTATTTAATGATTTTAATTACAGAAGTAATTTTATAAGATATTAAATTTATTAATTGAGGTGGTAACATGTAACATGTCATTCGATATTAGTGTAAAACTTTTTTTACCACAACAATA
CATTATTTATCATTTTACAAGAAGCTTGTGGAGATGTGAACATTATTGTGTGATTCATTTTACAGATTATCGCCTTAAGTGCTTCCGCTAATAAGCTATCAAAAATACAAGAAAGAGCGG
AGGAATATGCAGCCCTTATCATGGAGGAGTTGGATCCAGATAACCTTGGATACATTGAG
GTTTATATTCTATCCAATTGAGCCTGTTTTCATTGTACAACAATCATAACAATAGTCTAAT
AAAAAAAGTCCAATGAAATGAGCCCAAGGCTTGCTTTAAAACTGGCCTTTAAGGGGGGGAATATTATTTAATTTAATTTAATTTAATTTTCCCTTCAAACATGTCACTTATATTCTATTT
TTGCATGCAGATATACAACTTGGAAATGCTACTTTTGCAAGCCCCAGCACAATCAACCCACATAACCACGGATAGCCGTATTATGAGTCAAATGCTGAGCCAAAAACTAGTCCCAACCAA
AGAGCACAACCCCATCAAGCGTGGCTTAAGGGCACTGGCATACTTCGTGGAGGACAATTGGAAACGGATTTGGATCATTGCCCTCTGGCTTGCAATTTGTGCTGCCCTTTTCACTTGGAA
GTTCATCGAATACAAGCACCGTGCCGTGTTCCATGTCATGGGCTATTGTGTCACATCAGCCAAAGGTGCTGCTGAGACCCTCAAGTTCAACATGGCCTTAATCCTTTTACCTGTATGCAG
AAACACCATCACTTGGCTCAGAAGTAAGACCAAGTTAGGCATGGCCGTTCCCTTTGATGACAACATTAACTTTCACAAG
GTACACTTACTTATAATAAAACTTACATATAGTTCTGTAAA
TATCGTTGCTGATGTTCTTCATAAGTATTGTTCCTTGTTTAAAATCAGAGTTTTATCAAAGTATATAATTAGTATTTATATTTAATAAATTTTTTTAATTACTCCTAGTTAGCTAATAAT
TAATGACATTGATGGTGTCACTTTGGTTTAGGTGATAGCTTTTGGCATTGCAATTGGGGTTGGGATACATGCTATTGCCCATTTAACGTGTGACTTCCCAAGATTGTTGCACGCAACGGA
CGAGGAATATGAGCCCATGAAGCCATTTTTTGGAGAAGAGAGGCCCAATAATTATTGGTGGTTCGTGAAAGGGACAGAGGGATGGACCGGGATAACCATAGTGGTGCTTATGGCTATAGC
CTACACTTTGGCTCAGCCATGGTTCAGACGAGGCAGGCTCAACCTCCCTAAACCTCTCAAAAAGCTAACCGGGTTCAACGCGTTTTGGTACTCTCACCACCTTTTTGTCATCGTCTATGG
ACTTTTCATCGTTCACGGATACTACTTGTACCTTTCCAAGAAATGGTACAAGAAAACG
GTATGCATGCTCTCACTATATTATATCCTCGTTTTCCTTTTATTTTTCTTCACATGAAATTT
TGTTCTTATGTTCTGAATTTGGTCACACATTTTATTGCCACAGACTTGGATGTATCTTGCAATTCCCATGATACTATACGCATGCGAACGATTACTTCGTGCTTTTAGGTCTGGCTACAA
AAGTGTCAAGATTTTGAAG
GTACACTAATTGAAAAGATTTAATTAATTTCAATTTTGCATTTTGCTACTAATGAAGATATGAGAATACTAATTTTTTTTTATGCTTTTTTTTAAATTCAG

GTTGCAGTGTACCCAGGAAATGTCTTGGCCTTGCACATGTCTAAACCACAAGGGTTTAAGTACTCTAGTGGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCATTTCAATG
GTAA
GTGAACATTCCTTTTCTTATTGTTTTTATTACACACATTAATATTAAAATGAGGAGAGTGAAGTTAACAATGCTCACAATTTTGTTGTGGTATCTGTAGGCATCCTTTCTCTATTACTTC
AGCCCCGGGAGATGACTATGTAAGCGTTCACATACGGACTTTGGGTGATTGGACATCACAACTGAAGGCTGTTTTCGCCAGG
GTACAAACACTTTTCTTCATTATGCTAATGATGTTATA
ATATGTAGTGTTAGTTGAACCTTCTCCTCAAATATGTTCATGGCCTAAAAAATTTGCCATGTTTATTGATACAGGCATGTCAACCAGCAAGTGGTGACCAGAGTGGTCTTCTAAGGGCTG
ATATGTTACAAGGCAACAACATTCCAAG
GTAAGTTATGAACTAGAGACAACGATTTTTGGACAAAATTTAGGTGTCATTGGTGATGTTTTTCAATCAGAGATTAAAGTTGAAATTTGATC
TCAATAATGTGTGTAATTCTGATTGAAAAACGATACCAACAATACTTATGATACTGAATCAAAGTTTCATCTATGGTTTTAGTACTTAAAACACCAAATTGATTCTTTACTAATTCTAGT
GAAATTTAAATTAATTGTAGGATGCCAAACATTTTGATTGATGGTCCTTATGGAGCCCCAGCACAAGACTACAAAAACTATGAAGTAATCCTTCTGGTGGGTCTAGGAATTGGTGCCACC
CCTTTGATTAGTATACTGAAAGATGTGCTAAACAACATGAAGCAACAGAAGGACATAGAAGAAGGGATGGTAGAGAGTGGAGTTAAGAACAAGAGGAAACCCTTTGCCACCAACCGGGCC
TATTTCTATTGGGTGACTCGTGAGCAAGGTTCCTTTGAATGGTTCAAGGGTGTGATGGATGATGTTGCGGAGTATGACAAGGATGGAATAATCGAGCTTCATAATTATTGCACAAGTGTG
TATGAGGAAGGAGATGCTCGATCGGCTTTGATCACAATGCTTCAATCGCTGCACCATGCAAAAAGTGGTGTGGATATAGTTTCGGGGACAAGGGTGAAGACACATTTTGCTAGACCAAAT
TGGCGCAGTGTTTTTAAACATACTGCACTTAAACACCCTGGCAAAAGAGTTG
GTAAGAACTAGTACTGATTTTCTCTTAGTTAATTTAATTGTTGAATTCATGTCATCATGTCTTGCTTA
AGCTCACAATGCTTCAATCATTTCCAGGTGTTTTCTACTGTGGGGCGCACGCACTGGTTGGAGAACTTAAAAGGCTTTCTCTCGACTTTTCTAGAAAGACCAACACTAAGTTTGATTTCC
ATAAAGAGAATTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGATTGAAGAGAGCCATGAGCAGGAGTACGCGTGGTCGGAGACGGAGAGCACGGGGAGCAGGAGCACGCGAGTGGGCTTCAGTGGGCCCATGAGCGGCCCACTGGTGGTGTCCAACA
AGAAGAGCACCAAGAAGAGCGCCAGGTTCAAGGACGACCAGGACTTCGTCGAGATCACGCTGGACGTGCGCGATGACGGCGTCTCCCTCCAGAACATCAAGGGCGGCGACCCCGAGACCG
CGCTCCTCGCCACCCGCCTCGAGAAGCGCCCCTCCTCGCTCTCCCTGCGCCTCCGCCAGGTCTCGCAGGAGCTCAAGCGCATGACGTCATCCAAGAAGTTCGACAGGGTCGACAGGACCA
AATCTGGCGCTGCTCGCGCCCTCCGAGGCCTCAAGTTCATCACCAAAAACGTCGGAACTGAAGGCTGGTCACAGGTGGAGAAGCGTTTCGATGAGTTGGCCGTTGAATCCAAATTGCCCA
AAACGCGCTTCAGTCTGTGCATTG
GCATGCACGAGTCGAAGGAGTTTGCTGGCGAATTATTTGATGCATTATCTCGTCGTCGGGGCATAACATCAGGTTCCATAACCAAGGATGAGTTGC
GCGAATTCTGGGAACAAATTACGGATCAGAGTTTTGATTCAAGGCTTCAGACCTTCTTTGATAT
GGTGGACAAGAATGCCGACGGAAGAATCGCCGAAGAAGAAGTTAAAGAGATTATCG
CCTTAAGTGCTTCCGCTAATAAGCTATCAAAAATACAAGAAAGAGCGGAGGAATATGCAGCCCTTATCATGGAGGAGTTGGATCCAGATAACCTTGGATACATTGAG
ATATACAACTTGG
AAATGCTACTTTTGCAAGCCCCAGCACAATCAACCCACATAACCACGGATAGCCGTATTATGAGTCAAATGCTGAGCCAAAAACTAGTCCCAACCAAAGAGCACAACCCCATCAAGCGTG
GCTTAAGGGCACTGGCATACTTCGTGGAGGACAATTGGAAACGGATTTGGATCATTGCCCTCTGGCTTGCAATTTGTGCTGCCCTTTTCACTTGGAAGTTCATCGAATACAAGCACCGTG
CCGTGTTCCATGTCATGGGCTATTGTGTCACATCAGCCAAAGGTGCTGCTGAGACCCTCAAGTTCAACATGGCCTTAATCCTTTTACCTGTATGCAGAAACACCATCACTTGGCTCAGAA
GTAAGACCAAGTTAGGCATGGCCGTTCCCTTTGATGACAACATTAACTTTCACAAG
GTGATAGCTTTTGGCATTGCAATTGGGGTTGGGATACATGCTATTGCCCATTTAACGTGTGACT
TCCCAAGATTGTTGCACGCAACGGACGAGGAATATGAGCCCATGAAGCCATTTTTTGGAGAAGAGAGGCCCAATAATTATTGGTGGTTCGTGAAAGGGACAGAGGGATGGACCGGGATAA
CCATAGTGGTGCTTATGGCTATAGCCTACACTTTGGCTCAGCCATGGTTCAGACGAGGCAGGCTCAACCTCCCTAAACCTCTCAAAAAGCTAACCGGGTTCAACGCGTTTTGGTACTCTC
ACCACCTTTTTGTCATCGTCTATGGACTTTTCATCGTTCACGGATACTACTTGTACCTTTCCAAGAAATGGTACAAGAAAACG
ACTTGGATGTATCTTGCAATTCCCATGATACTATACG
CATGCGAACGATTACTTCGTGCTTTTAGGTCTGGCTACAAAAGTGTCAAGATTTTGAAG
GTTGCAGTGTACCCAGGAAATGTCTTGGCCTTGCACATGTCTAAACCACAAGGGTTTAAGT
ACTCTAGTGGACAGTATATTTTCGTTAACTGTTCAGATGTCTCCCCATTTCAATG
GCATCCTTTCTCTATTACTTCAGCCCCGGGAGATGACTATGTAAGCGTTCACATACGGACTTTGG
GTGATTGGACATCACAACTGAAGGCTGTTTTCGCCAGG
GCATGTCAACCAGCAAGTGGTGACCAGAGTGGTCTTCTAAGGGCTGATATGTTACAAGGCAACAACATTCCAAGGATGCCAA
ACATTTTGATTGATGGTCCTTATGGAGCCCCAGCACAAGACTACAAAAACTATGAAGTAATCCTTCTGGTGGGTCTAGGAATTGGTGCCACCCCTTTGATTAGTATACTGAAAGATGTGC
TAAACAACATGAAGCAACAGAAGGACATAGAAGAAGGGATGGTAGAGAGTGGAGTTAAGAACAAGAGGAAACCCTTTGCCACCAACCGGGCCTATTTCTATTGGGTGACTCGTGAGCAAG
GTTCCTTTGAATGGTTCAAGGGTGTGATGGATGATGTTGCGGAGTATGACAAGGATGGAATAATCGAGCTTCATAATTATTGCACAAGTGTGTATGAGGAAGGAGATGCTCGATCGGCTT
TGATCACAATGCTTCAATCGCTGCACCATGCAAAAAGTGGTGTGGATATAGTTTCGGGGACAAGGGTGAAGACACATTTTGCTAGACCAAATTGGCGCAGTGTTTTTAAACATACTGCAC
TTAAACACCCTGGCAAAAGAGTTG
GTGTTTTCTACTGTGGGGCGCACGCACTGGTTGGAGAACTTAAAAGGCTTTCTCTCGACTTTTCTAGAAAGACCAACACTAAGTTTGATTTCCATA
AAGAGAATTTTTAA

Retrieve as FASTA