Entry information : CcajRboh06(Cajca_16255)
Entry ID 16347
Creation 2020-03-12 (Baptiste Sarrette)
Last sequence changes 2020-03-22 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-05-04 (Christophe Dunand)
Peroxidase information: CcajRboh06(Cajca_16255)
Name CcajRboh06(Cajca_16255)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Eudicotyledons
Organism Cajanus cajan    [TaxId: 3821 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcajRboh06
start..stop
S start..stop
GmRboh18 1694 0 1..938 1..935
GmRboh09 1682 0 1..938 1..928
PauRboh07 1641 0 1..938 1..930
PvRboh05 1640 0 1..938 1..926
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 292..620 329 N° 2 716..1005 290 N° 3 1437..1596 160 N° 4 3034..3082 49
N° 5 4340..4453 114 N° 6 6297..6719 423 N° 7 7449..7832 384 N° 8 7920..8015 96
N° 9 8622..8737 116 N° 10 8831..9004 174 N° 11 9251..9410 160 N° 12 9489..9692 204
N° 13 9800..9928 129 N° 14 10056..10134 79 N° 15 11583..11692 110  
join(292..620,716..1005,1437..1596,3034..3082,4340..4453,6297..6719,7449..7832,7 920..8015,8622..8737,8831..9004,9251..9410,9489..9692,9800..9928,10056..10134,11 583..11692)


exon

Literature and cross-references CcajRboh06(Cajca_16255)
Protein ref. GenPept:   XP_020221163.1
Cluster/Prediction ref. Genebank:   109803903
Protein sequence: CcajRboh06(Cajca_16255)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   938
PWM (Da):   %s   106652.78  
PI (pH):   %s   9.2
Sequence 979
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTASFGRCSAGELEVPESCGTSSPAAGGHAYGAMLPVFLNDLRSNHHKELVEITLELENDAVVLCNVAPAPSLAPNASPSSSGEGGGGAVVARSLSITSRIRRKFPWLRIRRKFPWLRSVSSASSAESAAAAVAVEDPVATARNARKMRAKLERTRSSAQRALKGLRFISKSGEASEELWRKVEERFTLLAKDGLLAREDFGQCIGMEDSKEFAVCIFDALARRKERKVSSINREELHEFWLQISDQSFDARLQIFFDMADSNEDGRITREEVQELIMLSASANKLAKLKEQAEGYAALIMEELDPENLGYIELWQLEMLLLEKDRYMNYSRQLSSASVNWSQNMTDLRPKNEIQRFYRALQCLALEYWRRGWVLILWLVITTCLFAWKFYQYKNKSTFQVMSYCIPVAKGAAETLKLNMALILLPVCRNTLTWLRSTRARKFVPFDDNINFHKMIAFAILVGVVVHAGNHLACDFPLLVNSSPEKFSIISSDFNDKKPTYKSLYISVEGMTGISMVILMIISFTLATHHFRRNAVKLPSPFNRLTGFNSFWYSHHLFGLVYVLLLIHGSFLHLTHRWYHKTTWMYISVPLLLYVAERTLRTRRSTHYTVKIMKVSRLPGNVFSLIMSKPNGFKYKSGQYIFLQCPKISPFEWHPFSITSAPGDEYLSVHIRIVGDWTQELKLLLTKEDERLPSLNCRATFGELMELDQTRQPRLLVDGPYGAPAQDYQNFDVMLLIGLGIGATPFISIIRDLLNNTRTTDELVVQESNTETSQTTRSDESSNSFTSSNLTPGGNKILRRTTNAYFYWVTREPGSFEWFKGVMDEVAEMDHKGQIELHNYLTSVYEEGDARSTLITMIQALNHAKTGVDILSGTRVRTHFARPNWREVFTKIASKHPFSTIGVFYCGMPMLAKELKKLSLELSHKTTTRFEFHKEYF

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGAACGGCGTCGTTCGGGAGGTGCAGCGCCGGAGAGCTCGAAGTGCCGGAAAGCTGCGGCACTTCGTCGCCGGCGGCCGGAGGACACGCCTACGGCGCCATGCTGCCGGTGTTCCTGA
ACGACCTGCGGAGCAACCACCACAAGGAGCTCGTGGAGATCACGCTGGAGCTGGAAAACGACGCCGTGGTGCTCTGCAACGTGGCGCCGGCGCCGTCTTTGGCTCCGAACGCGTCGCCGT
CGTCGAGCGGTGAGGGAGGCGGCGGAGCGGTGGTGGCGAGGAGCCTCTCGATCACGTCGAGGATTCGGAGGAAGTTCCCGTGGCTGCG
GTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCCTCTCGATCACGTCGAGGATTCGGAGGAAGTTCCCGTGGCTGCGGTCGGTGTCGTCGGCGTCGTCGGCGGAGAG
TGCCGCTGCCGCCGTGGCCGTGGAAGATCCGGTGGCGACGGCGCGAAACGCGCGGAAAATGAGAGCGAAGCTGGAGCGCACGAGGTCGAGCGCGCAGCGAGCGCTGAAAGGCTTGAGGTT
CATCAGCAAGTCCGGCGAAGCCAGCGAGGAGTTGTGGCGAAAGGTGGAAGAGAGGTTCACCTTGTTGGCCAAGGATGGCTTACTCGCTCGTGAAGACTTTGGTCAATGCATAG
GTAATAA
GGAAATATATAATTCAAACAAAATAAAATAACATTACAATAACTCATTTAACTTGCATAACTAGTGTTCAACCCAGTTAATTATAGAGTTTGTTTATACAAAATTTATAAGTGATTTTGA
GATTATTTTTAATAAAAAAATTTCAATTCTACTTACAAGTTTTTATTCGAAAATACTAGTGGTTAGATGAAGAGGGATCGAGCATAATTAGAAACATGAGAATCTAGGTTTTTATTTGGT
ATAGATGCAGATACAAATTTAAATATATTTTTGAAATTATTAATTAAAATTAAATAATAATTTTCAATAAAAAAGTTCTTAGAAAACAGTTTTAACTTGTACACAGATATACTGTGGAGT
AACATGATTATGTGCATATATTTTGCTAAAATAATTGTGAATTTGGTGAATTGAATGATGAAAGGGATGGAGGATTCGAAGGAATTTGCGGTGTGTATATTCGACGCATTGGCACGAAGG
AAGGAAAGGAAAGTGAGTAGCATAAACAGAGAAGAGTTGCATGAGTTCTGGTTGCAAATTTCGGACCAGAGTTTTGATGCTCGCCTTCAGATTTTCTTTGACAT
GTGAGTTTTTCATCAC
CTTCTACCACCGCTGTGTGTTTTCGTTACAATCATTAAGAAACACTGTCTTTTTTCCCATCACCGCCCGAGAAAATTCGTGGCTTATTAAATGTTTGGATAATGTATTTTTATACGTCAT
GTTTTTTTAGTTTCTTTAGAAAGAAAAAAAAAAAAAGTTTTGACTGTGCTCGGTGACTGTTAGCGTTATAAAATCACTAGTTAGAGGTTTTGTTTTTTTGGTACATCACTTGTTACAGTT
ATAAAGCAATAAAACATACGGATTAAATTGGAAATGAATAGTATGAACAAGGATTTATAATACTATTAGTTTAATTAATATTATATCTCAAAATAATTTTATATCAATCTTATAGTATTT
ATTACGTCAACAAATGAAAGGAGTGAATATTAAAAATATATAAAATAAATTAAATGAAAATAATTTTAATATAGAAAATTAATATAATCTGCACCGTAAAAATAAGAACAGAAATATATT
TTTAGCGTAATTTTTTCATGACAAAATTGGATATAGGTTTTTGTCTAAATTATAAGATATTTGCTCCAATTTTTAATTTGTACAAGAGTTTACGTATATAACTTGTGCAATATTTTTTTT
AAAAAAAATTTCCCTTATTTTTCTTTTGCTATATTAGTTAAGAGGAAAACAAAAAGTCCACGGGATGATCGCATGAGTTTTGTCATTTTTCTTTTAAGATTGCGTTGCTTAAACACACAG
AACACATAGAATCTTATGAAAAATAATAAAATGAAGTTTAAGAAAGCCATTTAGCTTAAAATGAAGTTTAAGAAAGCCAATTTAGCTTGAAAAGGATTGTCCTATATATAGTTGCCAAAA
AGGAGATCGCCGTAATTCGTAAAGAAATCAATTAAATTCAAGTAAATCAGTTTATTAATGTAATTTCAAGTACCATTATATCTATAAGTTTATTTAAACACAATTTGATAGCTCAAACTC
AAATAGTAGAGTTAGGGGACATGTTGTAAAAAATAAAAGCAGGGTTCAATTGTTATGATCCTAAATATCCCACCTCAATATATCCAACTCCAATCGTTTGACATACAAACAACTCAGAAT
CTTATCTATATGTACTACTTTATATCAACCTATCTCTCATTTCAATCAATCTTTACTTTTGAATTTGATAAAAAAAGAAAAAGTAAACTATTTAAAGTCAATTTGATATTGACTTATAAT
TTAAGAATGAGATATTAATTTTCATATAAAACTTATATGATAATTTTCACTTAAGACAGTGACAAACAGCCCCTTGAATTAGGATGAATTATTCGTAAATTTTATTGCAACATCAATACG
ATTATTCTTTCACCTATAAACAGCTGCTTGCCGGGAGAACAAGCACTGAAATTTTTGATAATGTTTTTTAAATGTTAAATTAAAAATTGTATTTATTTCAGGGCAGACAGTAACGAAGAT
GGAAGAATTACTAGGGAGGAAGTACAAGAG
GTAAGATTTAAGATACCGAAAAATATACATATAAATATACCTAACTCTTTACTGAAGTTTCACCGTACAGTACCATTTGTAAAACTATAA
TATAATGTAATATTCTATAAATACAATTCTTAAATGAATGCTATTGAAAAACTGAATGAAAGATTAAAAAAAAAAAAAAAAGGAAACAGGACATGAAAATAATAGTTTTTGCAATTTTCT
TACCACCACCATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTGATAAAAAAATAAATAAATAAATCATCTTATATTTGTGAGTTGTGACCTT
AATTAAGAAGGTAAAGTTTTGAACTAGTACGCTTTAAGCAAAAGATTTAAGAGATTAACAAACAGTACGGATAATGTTAACTAAGGAACGACAAGTTAATCTTCAAGCGGATTTAAACAC
TATTTGATGTGATGGCTCTATAGCTAAATTTTACCATATTTAGAAATTGAGATAAATATGTTTTTAATTTTTTAAATTAAAAGTAATTTTTTTAATTTTTAAATTTAAATTAATCTTTTT
ATTTTATATTTTTGTTTTTTAATTTTTATACTTAAATTTTATTAAAAAAATATGTTAAATATTATGATATAAAATCTATTTATCAAATATTTATAAATGAAAACATCACATTAAATTTAA
TTAATAATATATGATTATCTAAATTTATTATTTTAAAATATGTTATTGTTGTTTGAAAGACTATTTTTTTTTATATAAAAATTATATGATTAAAACTAATAATTTTAATTTTAAAAATTA
AAAATAAATTTACTCTTTTAAGAGTTAAAAAGATATTTAACCATCATAGATTTTATTACATCTAGTAGCTTGATGTATGTGTTAACAAAACCCAACAGGTGATCATATTAAAATGACTTC
ATAAATTAATCATATAACTATCCACCGCTTTATTTTTTATTTATTATTATATATAATTGGTAAACGAAGGTTCCAAACAAATATTAATTTAATGGAAACCGTAGAAGTTTACATAATTAC
ATTGTAGCTTACATTCATTCCGACAAATTAAATTGAATTAAAAATACATTATTATATTTATACTCATGAATCGATTGTAGAACAGAAATAAAGCGAGAGAGATATTGAATAGTAAGAGCG
TTGGCAAATTTATTTTATTACTTTTCTTGTCGCTGACGTGAACATCACGTTCTGATCATACTCTCTGTTTTCAATTTTATTCAACAGCTCATAATGCTCAGTGCTTCCGCGAACAAGCTA
GCTAAGCTAAAGGAACAAGCTGAAGGATACGCCGCGCTAATAATGGAAGAATTAGATCCAGAAAACCTGGGGTATATCGAG
GTAAGAGTGTGACACAGAGAGAAGGGAAACGAGAATAAT
TTGAAACTTCAAACTATTAATTACATAAGAAAAAAAATATTCCATTCGTATCATCCAATTTTTTTATTTTATTATTTGTTTTTGCAAACACTTAAGTTGAGTGACATCACTTATTTAATT
TTTTTTAGTAGTATCAATTATATCGTTACATAGTCTCTGTCTCTCTTTTATATATATACAGTTAATCATTTATATACTATTAGTGTAGGATTTTTTTACATTAATAACTAATTAAATATT
TTAATATCTTTTTATTGTATAATGATACCAATCATATCATTATACATTTCTTCAATCTTTTTATATCTTTCAAGATCTTTACACGTTTTGTGAACACTGGAGTGATGTTAATTTATTTAT
ATCTCTTCTTGTTGTGAGACACTATCAATCATATCATCACATATTTTTTCTTCTTTTTATATCTTTCAAGATGTATACATGTTTTGCAAACACTCGATTGATGCCACTTATATAATTTCT
TTATCTCTCTCCTTGTAATGTAACATTATCAAATAATCATCACATGTTTCTTCTTTTCTTTTATATATTTTAAGGTGATTACACATTTTCCAAAAATCTTATCTCTTCTTATATATGTAA
CATTATTAATCATATTATCGCATTTTTTTATGTGTTTTTTAAGGTGCATGTTTTGCGAAAACTTGACACTATTTATTTTAATTTTTTTTATCTCTCTTCTTCTTGTTGCGTAACATTATT
AATCATATTATTGCATATTTCTTCTTTCTTTTATATATTTCAAGGTGTTTACACATTTTGCGAATACAGAAATGATGCACTTGTTTTTTTTTTGTTTTTTTGTTTTTATATATTTTATTT
TATCTTTCTTATTATTATGTAACATATTATCAATCATATTATAACACATTTCTTCTTTCTTTTTATATCTTTCAAAGTGTTTGCATGTTTTAGTGAATTCGTAAGTGACACCATTTATTT
TAATTGATTTATCTCTTTTCATGTAGTGTAACATTATTGATCACATCATCACACATTTTTTCTTTCGTTTTATATCTTTCAGGTTGTCTGCATGTTTTGCATATACCCAAGTGATACCAT
CTTATTTCAATTTCTTTTTTTATCAATCTTTTTATTGTGTAACATTATTAATAATATTATCACAAATTTATTCTTTCTTTTTAAACCTTTCAAGGCATATGCTCATTTTGCTAAGTAAGG
TGTCTTATTTTAATTCTTTATCTCTTTTTCTTGTAGTGTAACATTATCAATCATATAATTACAATTTTCTTTCTTTCTTTTTATATTTTTCAAGGTGCTTAAACGCTTTCCAAACATTCA
AATGATACTATTTATTTTAATTTCTTTATCTCCTTTCTTATTGAGAAACATTATCAATCAATTTATCAAAAGAAAAAATTCTCAATCACATCATCACATACTGCTTTCTTTTTATATCAT
TCAAGTATTTTGTATTTTTTGTGAACACCCGAATGGTGCCACTTATTTTAATTTCTTTATCTATCTTCTTGTTGTGTTACATTATTAATCATATCATCATATTCTTTTTGTCTTTCTTTT
TATATCTTTCAAGGTGAATGTCTGAGCATTTTATAAATAGTCAATTGTTGAAACTTATTATAATATCTTTATCTTTCTTCATGCTGTGTGACATTATCAAACGTATCATCAAATTTTTTT
TATACTTTTCAATGTGTCTACATTGAAAGGTACTATCACAGAATTTATTTCCTTTTGAATAGTATATTTTTGTTTACAATTTTTGTTACACTTTCTTGATCGCTTAAATTTGTCTTTTAT
TCAGTTGTGGCAACTAGAAATGTTGTTACTAGAAAAGGATAGGTACATGAACTACAGCAGACAACTCAGCAGTGCAAGTGTAAATTGGAGTCAAAATATGACGGACTTGAGGCCCAAAAA
TGAAATCCAAAGATTTTACAGGGCACTCCAATGTCTTGCATTGGAGTATTGGAGAAGGGGTTGGGTTTTGATATTATGGCTGGTTATCACTACTTGCCTTTTTGCCTGGAAATTCTACCA
ATATAAAAATAAATCAACTTTTCAAGTTATGAGCTATTGCATACCAGTAGCTAAAGGTGCTGCAGAGACACTGAAGCTCAACATGGCTCTCATCCTCTTACCAGTTTGTCGAAATACGTT
GACATGGCTTCGTTCTACCAGAGCTAGAAAGTTTGTCCCTTTTGATGACAATATTAATTTCCACAAG
GTATGTAAAATAGAGATGATGTCAACTTAGGATATTTTAAATGCAAAAAAAGT
TCTGTATAATTTTCAAATAGTAAATCTCTTAAAACAGAGGTTTTAATTAATACAACTTAGGGTGCTTTAAATTATTCATTATCATTCTAGCTAATAACTACTACACCCATTTCAAAATAA
CTATAATTTAATATTTTTACACATTAATAACAACAACAAATATATCACTTATTTAATACAATTTTATTTCTTAATAAAAGTATTACTTTTAGTTGTAGTGGTTAAAGAAATTGTGAGCGG
CTAAATTAGGAAAGAGAAAATTAATATTTCTTTGAAAACTGAGAACATGAGTCTTTTTGAAAAAAATTTCAAATGTTAAAATTGTAGTTATTTAGGACAGAGAGAGTACTTTGCTTAAAA
TTAAAAAGAAAAATCCAAATATAGTAATTGTAAAAAAAATATTTTTAAGAAGTAAATAGAAATTATTTTAAAAAAAATTGATTTTTTTTTAAATAGCTTAGTCAAACATAAAAAATAAAA
ATTAATTATTTAATTAGAAAATATTTTTAAATTAAAAAATTAACAAACATGCCCTAATTTATTTATTTTGCTAATTATGAAGGCTCTACTTATAGTATTGAGACATGATATTACTTGCTC
TCCAAAAATGGCAATATTTTAAATTAAGCTGGTATAAATTCCTCACAATTTGATTGTGTCCTTGTCCATTTTATAGATGATTGCATTTGCCATACTTGTTGGAGTTGTTGTTCATGCTGG
CAATCATCTGGCATGTGATTTCCCTCTTCTCGTAAACTCATCTCCAGAGAAGTTTTCGATTATATCTTCAGATTTTAATGACAAAAAACCCACATATAAATCACTTTACATTAGTGTGGA
AGGCATGACTGGAATCTCAATGGTTATTTTGATGATAATCTCTTTCACTTTAGCAACTCACCACTTCCGGAGAAATGCAGTGAAGCTTCCGTCACCCTTTAACAGATTGACAGGCTTTAA
TTCATTCTGGTACTCACACCATCTTTTTGGTTTGGTCTATGTTCTACTCCTCATCCATGGGTCATTTTTGCATTTAACCCACCGTTGGTACCATAAAACA
GTAAGAATTTCGACTGCTCT
ACAACATGGGATAAGTGAGTGTTGTTTAAAGAACATACATCAACTTACCGTTTCCTTTTAATTTCAGACATGGATGTATATCTCTGTTCCACTGTTGCTTTACGTTGCAGAGCGTACTCT
ACGCACTCGTAGATCAACACATTATACTGTGAAAATTATGAAG
GTAATGAAAACAAGTCCATGTTTATTTTTCAAGCTTAAATACATCCTCAAATATGGAGTAAAAAATTTTAAATTTGG
AAGACCGAAAACAAATTTACTTCATATTTAAGCATATTTCTATTTCTAGTAGTGGGTGAATACACCAAGAAAAAAAACCACTTATGAGTAGGGAGTAATTTATGACTAGCCTTTTCTTTC
TTTGATGAAAATTTGCATATGGTCTTTTCCTTGGTCATTATCTCTTTGATTTTTTTATGAACAAAATTGATTATTCTGACTTTTGAGTGTATTTGATTCCATGTTTGAATTGAAGGAAAT
GAGTCCCCTTTAGATAATCCACGTGTATTTTGGAATAAAAGAATTTATGGAGAAATATTTTAAGGAAAAATATGTCATGTCTTTTTGTATTTTGGCATGAAGAAAACTAGGATGAAGAAA
AAATAAAACCTATCTAGACTTAAGAATATGGATTTGGACATAATTTAATCTTAGAAAAACTAACTTTTAACATGAAGATTATCCATCACTTATGCAATATATTTTGATTATATCTCTAAT
TGATATGAGATTTCTAATACATGTCAATTTCCTAACTTTGATCTAGCAGGTTTCAAGGTTGCCCGGAAATGTCTTCAGCTTAATCATGTCCAAGCCTAATGGATTTAAGTACAAAAGTGG
ACAATATATATTTTTACAATGTCCAAAAATTTCTCCCTTTGAATG
GTGAGTGTTGTTCTAATTCTCAGGTCTACTAAAAAGTTATAGACATGAGAAAATTCAAATTCAAATTAAATATTT
TCATGAAATATATTTTAGGCACCCATTTTCCATTACCTCGGCCCCAGGAGATGAGTACCTAAGTGTTCACATTCGCATAGTGGGAGACTGGACCCAAGAACTTAAGCTTCTTCTCACAAA
AGAAGATGAGAGATTACCTTCACTTAATTGTCGTGCAACATTTGGTGAACTAATGGAACTGGATCAAACAAG
GTAAGTAAGGTCAATTGTTTTTTCATAAATGCAATGGTAAAAAAATGT
TAGATTGCTTAAGTTTTTGTCCTTTGTATTTTAATAACAATAGTTTTGATCATTATATTTTTTAAAATGTGGTGGGTTTGATCCTACAGTTTGTAAAATACTAGACTAAGATTAGTTTTG
ACCAAATATTAAGAGACTCAACATTTTACCCCAATTTCGTGAATGAAAATTATTAGACAAAATAGAATTTTGTTTCAGACAACCGAGACTTCTAGTTGATGGTCCTTATGGAGCTCCAGC
ACAAGACTACCAAAATTTTGATGTAATGCTCCTCATAGGATTAGGAATTGGAGCAACTCCTTTCATTAGCATTATCAGAGATCTCCTCAATAACACAAGAACAACGGATGAACTAGTG
GT
ACTAACAAAACTCTAGCTCACTTTTCAGAAAGTTGATTCCACTTTTATCTTCAATTTTCAATTTTCTTATATTCAGGTGCAGGAATCAAACACAGAAACAAGTCAAACAACTAGATCAGA
CGAAAGCTCTAATAGTTTTACATCTTCAAATTTAACACCAGGAGGAAATAAGATATTAAGAAGGACTACAAATGCTTATTTCTACTGGGTCACTAGGGAACCTGGATCTTTTGAATGGTT
CAAAGGAGTAATGGACGAAGTTGCTGAAATGGACCACAAA
GTAATATATGATGTTCATAAATAAGTTTCAATCCTACTTATAAATAGTTCTCTACTATACTAGCTGTCCCTGTTTTTTGT
TATAAATTGTTTTTTACTCTAAATCAGGGTCAAATTGAGCTTCACAACTATCTTACAAGTGTCTATGAAGAGGGGGATGCGAGATCAACCTTAATCACCATGATCCAAGCTTTGAACCAT
GCCAAAACTGGTGTTGATATCCTATCAGGCACTCGA
GTAAGATCTTCAATACTTGAAATTGTTAACATAATGAGCAAGTTTTTTTTTTTTTTTTTTTTTTGCTTAAGTTGATAATGATTA
CTCACCAAAATATGACACTTTTTTAAATTGTTTTCAACTATAGGTAAGGACACACTTTGCTAGGCCTAATTGGAGAGAGGTTTTCACCAAGATTGCCTCTAAACATCCATTTTCTACAAT
AG
GTAAATTTCTTGCTACAAGATGCAGAACACTTCCTCATAAAGGATATTTAATTTTCCTTTTCATCCGGTAATATTGGGACAACAAATGATTTTTATTCATTTGCCTATGATATGCTTC
ACATAAGGGTCAAGCCATAAGTCTTCTCCATTGATATCATTGGGTTCACAACACTACAAATATGGTGGTTACAATGAAAACGATTGATAAAAATGAAAATACAATGCAGTAGTAATTGAC
TGAAATTATGAATGATATCATGATATAGAATTGTGTAATGGTCAAAACAATCAAACTTATAAGGAATTATGAATCTATTTGTTCAATTGATCATGATGAAGAAATTGATATCTAATTAAA
CAATTTTTCAATTATTTTATGAAGACTAAATTTTATTGGTATAATTTTTTTTAAGAAAATAACACATATATAAAGATAGAGAAAAATAAAGAAAGAAGTAGGGGTATACCAACATTATGA
TATACTAAAGTATATATTAATATTTTTATATGAACAAAACTGAGTTGATTAGATGCATCGTATTAATAATACAAATTTATAATGTTTAGACTATAAATTCATTTCATGAAATTAAATTTA
TGTTAACAAAGATATTTCCAACACTTAAATCAAAGTAATCCTTCCTTTCAATTTTTTTTAGGGATTCTAATTGTTTTTTTTTTCTAAAAGAAAATGTTGTTTTAAAATTCCAATAACAAA
TTAGACTTTTTTCTCTCAATTATATCCCTATTTAATAATATTTCTCTCCACTAACTGCTCATTTAGTTTTACTAGAGGGTAAGCTACACAACCAATGAGCACACAAGTATTAATGTTACT
AATAGATATTAAATAAGGACTTTTTAGTCCAACATTTTTAGTCCATGTTCATTAACCTTAAGCCATTAAAGAAATGAGGGAAAAGTAGTTAAAATGTACTTGTAATAGAAATTAACCCTC
CTTTTGTATCCAAAAATAATCAATGTTATTTACGATTTACTACTTAAATAAGTTTGGTTGGTTAACTACTATAATGGAATAAACAGCCTTATAACCTTAATGACACAATTTTTTCCTTTT
ACTTTTAATATTTTGGAATGTATGTTCATTTTTTTTTTTTGAAACATTTTAAATGGTTTCTAAACATGTCCTTAGTCATTGACTTTATAACCACTGTTGGAATACGATTAAATAGTTGGA
TAGTTAATTATCCCTAAAAGATTTAAAGTATCAACAATTGAGAAATTGTGATTTAGAACAAACAAATGTCAATTATGAACCAACCTTATTTGTAAACAAAGAATATTGATAGGTACGGAT
GAACAATTGGTTTGTTTAAGAGAAGGAAACAAGTAGTTTATTATATGTTCACTTATAAAGTGTGATCCATTTTTTTTTACTTCTCAATATTAGTAAATATTAACAAGAAAATGATGTATA
AAAAATCCAGGTGTGTTCTATTGCGGGATGCCAATGTTGGCGAAGGAGCTAAAGAAGCTATCACTTGAGCTAAGTCACAAGACAACTACACGCTTTGAATTTCACAAGGAGTACTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGAACGGCGTCGTTCGGGAGGTGCAGCGCCGGAGAGCTCGAAGTGCCGGAAAGCTGCGGCACTTCGTCGCCGGCGGCCGGAGGACACGCCTACGGCGCCATGCTGCCGGTGTTCCTGA
ACGACCTGCGGAGCAACCACCACAAGGAGCTCGTGGAGATCACGCTGGAGCTGGAAAACGACGCCGTGGTGCTCTGCAACGTGGCGCCGGCGCCGTCTTTGGCTCCGAACGCGTCGCCGT
CGTCGAGCGGTGAGGGAGGCGGCGGAGCGGTGGTGGCGAGGAGCCTCTCGATCACGTCGAGGATTCGGAGGAAGTTCCCGTGGCTGCG
GATTCGGAGGAAGTTCCCGTGGCTGCGGTCGG
TGTCGTCGGCGTCGTCGGCGGAGAGTGCCGCTGCCGCCGTGGCCGTGGAAGATCCGGTGGCGACGGCGCGAAACGCGCGGAAAATGAGAGCGAAGCTGGAGCGCACGAGGTCGAGCGCGC
AGCGAGCGCTGAAAGGCTTGAGGTTCATCAGCAAGTCCGGCGAAGCCAGCGAGGAGTTGTGGCGAAAGGTGGAAGAGAGGTTCACCTTGTTGGCCAAGGATGGCTTACTCGCTCGTGAAG
ACTTTGGTCAATGCATAG
GGATGGAGGATTCGAAGGAATTTGCGGTGTGTATATTCGACGCATTGGCACGAAGGAAGGAAAGGAAAGTGAGTAGCATAAACAGAGAAGAGTTGCATGAGT
TCTGGTTGCAAATTTCGGACCAGAGTTTTGATGCTCGCCTTCAGATTTTCTTTGACAT
GGCAGACAGTAACGAAGATGGAAGAATTACTAGGGAGGAAGTACAAGAGCTCATAATGCTCA
GTGCTTCCGCGAACAAGCTAGCTAAGCTAAAGGAACAAGCTGAAGGATACGCCGCGCTAATAATGGAAGAATTAGATCCAGAAAACCTGGGGTATATCGAG
TTGTGGCAACTAGAAATGT
TGTTACTAGAAAAGGATAGGTACATGAACTACAGCAGACAACTCAGCAGTGCAAGTGTAAATTGGAGTCAAAATATGACGGACTTGAGGCCCAAAAATGAAATCCAAAGATTTTACAGGG
CACTCCAATGTCTTGCATTGGAGTATTGGAGAAGGGGTTGGGTTTTGATATTATGGCTGGTTATCACTACTTGCCTTTTTGCCTGGAAATTCTACCAATATAAAAATAAATCAACTTTTC
AAGTTATGAGCTATTGCATACCAGTAGCTAAAGGTGCTGCAGAGACACTGAAGCTCAACATGGCTCTCATCCTCTTACCAGTTTGTCGAAATACGTTGACATGGCTTCGTTCTACCAGAG
CTAGAAAGTTTGTCCCTTTTGATGACAATATTAATTTCCACAAG
ATGATTGCATTTGCCATACTTGTTGGAGTTGTTGTTCATGCTGGCAATCATCTGGCATGTGATTTCCCTCTTCTCG
TAAACTCATCTCCAGAGAAGTTTTCGATTATATCTTCAGATTTTAATGACAAAAAACCCACATATAAATCACTTTACATTAGTGTGGAAGGCATGACTGGAATCTCAATGGTTATTTTGA
TGATAATCTCTTTCACTTTAGCAACTCACCACTTCCGGAGAAATGCAGTGAAGCTTCCGTCACCCTTTAACAGATTGACAGGCTTTAATTCATTCTGGTACTCACACCATCTTTTTGGTT
TGGTCTATGTTCTACTCCTCATCCATGGGTCATTTTTGCATTTAACCCACCGTTGGTACCATAAAACA
ACATGGATGTATATCTCTGTTCCACTGTTGCTTTACGTTGCAGAGCGTACTC
TACGCACTCGTAGATCAACACATTATACTGTGAAAATTATGAAG
GTTTCAAGGTTGCCCGGAAATGTCTTCAGCTTAATCATGTCCAAGCCTAATGGATTTAAGTACAAAAGTGGACAAT
ATATATTTTTACAATGTCCAAAAATTTCTCCCTTTGAATG
GCACCCATTTTCCATTACCTCGGCCCCAGGAGATGAGTACCTAAGTGTTCACATTCGCATAGTGGGAGACTGGACCCAAG
AACTTAAGCTTCTTCTCACAAAAGAAGATGAGAGATTACCTTCACTTAATTGTCGTGCAACATTTGGTGAACTAATGGAACTGGATCAAACAAG
ACAACCGAGACTTCTAGTTGATGGTC
CTTATGGAGCTCCAGCACAAGACTACCAAAATTTTGATGTAATGCTCCTCATAGGATTAGGAATTGGAGCAACTCCTTTCATTAGCATTATCAGAGATCTCCTCAATAACACAAGAACAA
CGGATGAACTAGTG
GTGCAGGAATCAAACACAGAAACAAGTCAAACAACTAGATCAGACGAAAGCTCTAATAGTTTTACATCTTCAAATTTAACACCAGGAGGAAATAAGATATTAAGAA
GGACTACAAATGCTTATTTCTACTGGGTCACTAGGGAACCTGGATCTTTTGAATGGTTCAAAGGAGTAATGGACGAAGTTGCTGAAATGGACCACAAA
GGTCAAATTGAGCTTCACAACT
ATCTTACAAGTGTCTATGAAGAGGGGGATGCGAGATCAACCTTAATCACCATGATCCAAGCTTTGAACCATGCCAAAACTGGTGTTGATATCCTATCAGGCACTCGA
GTAAGGACACACT
TTGCTAGGCCTAATTGGAGAGAGGTTTTCACCAAGATTGCCTCTAAACATCCATTTTCTACAATAG
GTGTGTTCTATTGCGGGATGCCAATGTTGGCGAAGGAGCTAAAGAAGCTATCAC
TTGAGCTAAGTCACAAGACAACTACACGCTTTGAATTTCACAAGGAGTACTTTTGA

Retrieve as FASTA