Entry information : ZmPrx20(Zm00001d014467 / GRMZM2G085967 / Peroxidase39)
Entry ID 165
Creation 2006-06-05 (Christophe Dunand)
Last sequence changes 2006-06-05 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2023-01-09 (Christophe Dunand)
Peroxidase information: ZmPrx20(Zm00001d014467 / GRMZM2G085967 / Peroxidase39)
Name ZmPrx20(Zm00001d014467 / GRMZM2G085967 / Peroxidase39)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Meristems
Mixed tissues
Roots
Silks
Inducer Constitutively induced
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx20
start..stop
S start..stop
SbPrx139 603 0 18..328 21..331
SofPrx01 587 0 18..328 21..331
SiPrx29 576 0 16..328 17..330
OsPrx89 504 0 24..326 30..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 47579516..47579722 207 N° 2 47579846..47580037 192 N° 3 47580137..47580299 163 N° 4 47581999..47582423 425
join(47579516..47579722,47579846..47580037,47580137..47580299,47581999..47582423 )


exon

Literature and cross-references ZmPrx20(Zm00001d014467 / GRMZM2G085967 / Peroxidase39)
Literature Duvick,J.P., Maddox,J.R., Navarro Acevedo,P.A. and Simmons,C.R.
Maize peroxidase genes and their use for improving plant disease resistance and stalk strength
Protein ref. UniProtKB:   B4FNI0   B6THU9
DNA ref. GenBank:   AC195863.2 (24939..27843)
mRNA ref. GenBank:   AY106450.1   BT038668
Cluster/Prediction ref. UniGene:   Zm.5808
Protein sequence: ZmPrx20(Zm00001d014467 / GRMZM2G085967 / Peroxidase39)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (306)
PWM (Da):   %s   35221.12 (33088.8)  
PI (pH):   %s   7.41 (6.50) Peptide Signal:   %s   cut: 23 range:23-328
Sequence 369
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVRRTVLAALLVAAALAGGARAQLKEGFYDYSCPQAEKIVKDYVKAHIPHAPDVASTLLRTHFHDCFVRGCDASVLLNATGGSEAEKDAAPNLTLRGFGFIDRIKALLEKECPGVVSCADIVALAARDSVGVIGGPFWSVPTGRRDGTVSIKQEALDQIPAPTMNFTQLLQSFQNKSLNLADLVWLSGAHTIGISQCNSFSERLYNFTGRGGPDDADPSLDPLYAAKLRLKCKTLTDNTTIVEMDPGSFRTFDLSYYRGVLKRRGLFQSDAALITDAASKADILSVINAPPEVFFQVFAGSMVKMGAIEVKTGSEGEIRKHCALVNKH

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 242 ESTs. Containing intron shift.

GeneChip® Maize Genome Array ID: Zm.5808.1.A1_at
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTGAGAAGGACGGTGCTGGCGGCGCTGCTGGTGGCCGCCGCCCTCGCCGGCGGCGCGCGGGCGCAGCTCAAGGAGGGGTTCTACGACTACTCCTGCCCACAGGCGGAGAAGATCGTCA
AGGACTACGTGAAGGCGCACATCCCCCACGCGCCCGACGTCGCCTCCACCCTGCTCCGCACCCACTTCCACGACTGCTTCGTCAGG
GTACGTACTATAGGAGTTAGCAAACAAGGCGCTA
GCCGCTAGCTGCGTGCGCGGCGACGAATGCCCGATATGCCGATGCCGACGATGACTGACCGCGCCATGCGCTCCCGCCGTTGCACGCAGGGCTGCGACGCGTCAGTGCTGCTCAACGCGA
CGGGCGGCAGCGAGGCGGAGAAGGACGCGGCGCCCAACCTGACGCTGCGCGGCTTCGGCTTCATCGACCGCATCAAGGCGCTGCTCGAGAAGGAGTGCCCCGGCGTGGTGTCCTGCGCCG
ACATCGTCGCGCTCGCCGCCCGCGACTCCGTCGGCGTCATC
GTCAGTGCTCCTGATCGAGTCCCCCCCCCACCCCATGCATCTGCGCTTCCTAAGCCGGCAAAACCTATATATAAACCGG
TCGAACGCGCATGCATGCAGGGCGGTCCGTTCTGGAGCGTGCCGACGGGGAGGCGCGACGGCACCGTGTCCATCAAGCAGGAGGCGCTGGACCAGATCCCCGCGCCCACCATGAACTTCA
CCCAACTCCTCCAGTCCTTCCAGAACAAGAGCCTCAACCTCGCCGACCTCGTCTGGCTCTCAG
GTACGTACTTCCCCAAACCAAACACCTGACCCCCTCCATGATCCGTTGACGCCACAC
CGTTCTGAGCAGAAGAAGAAGAAGATTATCTTTTCACCTGTCAATCAATCAGCTTAATTTACATGCCAAGGAAGAACTAGACAGATATTAGGCAGTGACAGGTCTGACTAGTCCTATGAT
TACAAGCCACGCTTGCGAGTTTATTAAACATTCCAACGGCACCGACACCCAGTGCTGCTACTTTCGCTTTCGCTGGGTCAATCATTTGTTTGGTCAGGCTGGCATAAGCAGTACCACTGC
TATGATTGTGCTAGAGGACTGGTAGCCTCGTGAGTCGTGACAAACTGTTTTATGATTTGAGAAAATAACTGGACAAACAGCAGGAGCCTAGAACGTTTTAGTAGCAGTTAGTTCGCTGTC
ATAGCCGGATTGGACAGACAACCTGAACATGCACAGAGCGGCCCTGCTAGGTAGAAGTACTGCTGTCTTCTCCGTTCCAAATTATAAGCTATATTCTAAAATTATAAAGTATAAGTTATA
TTCTAACTTTATAGGTTTTATTTTTTTAATTATAAGATAGTTTAAGATTTCTAAATTTCTAATTTTTTACTATATATCTAGACATAATATGTATTTAGCGACGTACTAGCATGTAGCAAA
AGCTATAAGTTTTAAAAAGTCAGGAAAAAAACTTTTTTGATTTAGAACAAAGGGAATAGCACGCGTTACTGAATAATGGCATCCATTTGTCCGTCAGAGCTATCTACCATATAAAAGACA
AAGTTCGTACTGTGGGTCAAGTCGACATCTAAAAGGCAAAAGTTGAGCACCTAACAGTATTTATTGACGGTGCGTGCATGCACGAATCAGCGTTAGGAAGCATAGTTCTGTCTTTCTAGA
TAGACTAATAACTAGAGTGAATCCGTAGCCAACAGAAATGGAGGCGATTAAATTGGGCAACTGCAAGTCTGTTGTCTCCTCATCTTTCAGTCTTCGGGTTAGTGCAGTAGTGTCAGGCAC
AGGCGCTGAGCCGAGTAGAGTAGCTAGCCGACAGCTGCACATCGTCCTTGAGGAGAGACACAGCATGTTAGTAGTTAGCATCTAATGGATGCAGCCGGAGTTTGGTACCCAGGAAATGAT
TCAGTACGGCAGAGATAAGATAAATTTGTGTAAGGAACCACTTTTGAGGATAACGGACAGAGAGTGTATCTGACCTTATTACGTCCCAGGCAGGCTTAACTTTCATCATCCTTCAGAGCA
GGCCGTCTTGCTGAAAGTAAAAGAAGAGACTGATGAGTGATGACACGTGGAGGAGAACTTGGAATCTGAATAATAATAATGCGTATACTCTTCATCATTTGAGGACGAGACTTGTTTGGG
CCACCGATGGGCTTCCATTTCTCGTATGTGCGTGCGTGACATTAAACGGCAACCTCTTCTGATGCAGACATGCTCGCTGCTGCCAACTGCTGCCTCGGTCTATATTCCAATCTATCATAG
AAGACGAGCCTTTATTGTGCATGCAGACTCCAGAAGTCCAGAGCGATACTTCTGAAATAGTAGTCCTTTTCGTAGAACATGCCCTCGATCCGTTGATGGTGCCTTAAAATACGTACCTGA
ATAGCTCCAAAAAAACCACACACACACACACACTGAACAGTTCACAGGCATTCCTAATCACTTCTCGCGTGTGTACGTGCAGGGGCTCACACGATCGGCATCTCCCAATGCAACTCCTTC
AGCGAGCGCCTGTACAACTTCACGGGGCGCGGCGGGCCCGACGACGCGGACCCGTCGCTGGACCCGCTGTACGCCGCGAAGTTGCGGCTCAAGTGCAAGACGCTGACGGACAACACGACG
ATCGTGGAGATGGACCCCGGCAGCTTCCGCACCTTCGACCTGAGCTACTACCGCGGCGTGCTCAAGCGGCGGGGCCTGTTCCAGTCCGACGCCGCGCTCATCACCGACGCCGCCTCCAAG
GCCGACATCCTCAGCGTGATCAACGCGCCGCCCGAGGTGTTCTTCCAGGTCTTCGCGGGCTCCATGGTCAAGATGGGCGCCATCGAGGTCAAGACCGGCTCCGAGGGCGAGATCAGGAAG
CACTGCGCCCTCGTCAACAAGCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGTGAGAAGGACGGTGCTGGCGGCGCTGCTGGTGGCCGCCGCCCTCGCCGGCGGCGCGCGGGCGCAGCTCAAGGAGGGGTTCTACGACTACTCCTGCCCACAGGCGGAGAAGATCGTCA
AGGACTACGTGAAGGCGCACATCCCCCACGCGCCCGACGTCGCCTCCACCCTGCTCCGCACCCACTTCCACGACTGCTTCGTCAGG
GGCTGCGACGCGTCAGTGCTGCTCAACGCGACGG
GCGGCAGCGAGGCGGAGAAGGACGCGGCGCCCAACCTGACGCTGCGCGGCTTCGGCTTCATCGACCGCATCAAGGCGCTGCTCGAGAAGGAGTGCCCCGGCGTGGTGTCCTGCGCCGACA
TCGTCGCGCTCGCCGCCCGCGACTCCGTCGGCGTCATC
GGCGGTCCGTTCTGGAGCGTGCCGACGGGGAGGCGCGACGGCACCGTGTCCATCAAGCAGGAGGCGCTGGACCAGATCCCCG
CGCCCACCATGAACTTCACCCAACTCCTCCAGTCCTTCCAGAACAAGAGCCTCAACCTCGCCGACCTCGTCTGGCTCTCAG
GGGCTCACACGATCGGCATCTCCCAATGCAACTCCTTCA
GCGAGCGCCTGTACAACTTCACGGGGCGCGGCGGGCCCGACGACGCGGACCCGTCGCTGGACCCGCTGTACGCCGCGAAGTTGCGGCTCAAGTGCAAGACGCTGACGGACAACACGACGA
TCGTGGAGATGGACCCCGGCAGCTTCCGCACCTTCGACCTGAGCTACTACCGCGGCGTGCTCAAGCGGCGGGGCCTGTTCCAGTCCGACGCCGCGCTCATCACCGACGCCGCCTCCAAGG
CCGACATCCTCAGCGTGATCAACGCGCCGCCCGAGGTGTTCTTCCAGGTCTTCGCGGGCTCCATGGTCAAGATGGGCGCCATCGAGGTCAAGACCGGCTCCGAGGGCGAGATCAGGAAGC
ACTGCGCCCTCGTCAACAAGCACTAG

Retrieve as FASTA