Entry information : ZmPrx92 ( GRMZM2G320269)
Entry ID 166
Creation 2006-06-05 (Christophe Dunand)
Last sequence changes 2011-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: ZmPrx92 ( GRMZM2G320269)
Name (synonym) ZmPrx92 ( GRMZM2G320269)
Class Class III peroxidase    [Orthogroup: Prx048]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx92
start..stop
S start..stop
SbPrx04 579 0 43..355 43..357
SiPrx146 560 0 28..355 23..345
OsPrx49 496 4e-178 5..355 1..348
NnPrx19 348 1e-119 40..355 27..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 222205430..222205696 267 N° 2 222204982..222205170 189 N° 3 222204684..222204882 199 N° 4 222204148..222204560 413
complement(join(222204148..222204560,222204684..222204882,222204982..222205170,2 22205430..222205696))


exon

Literature and cross-references ZmPrx92 ( GRMZM2G320269)
Literature Duvick,J.P., Maddox,J.R., Navarro Acevedo,P.A. and Simmons,C.R. Maize peroxidase genisease resistance and stalk strength
Protein ref. UniProtKB:   B6T6D4
mRNA ref. GenBank:   AX546794   AX546769 [Mismatch]
Cluster/Prediction ref. UniGene:   Zm.97921
Protein sequence: ZmPrx92 ( GRMZM2G320269)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (324)
PWM (Da):   %s   38372.78 (35235.0)  
PI (pH):   %s   9.34 (9.20) Peptide Signal:   %s   cut: 32 range:32-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYTAMAARPLLLPPPVLLLLVVLAASSAAHGYGAYGYGDAAAELRVGFYKDSCPDAEAVVRRIVAKAVQEDPTANAPLLRLHFHDCFVRGCDGSVLVNSTRGNTAEKDAKPNHTLDAFDVIDDIKEALEKRCPGTVSCADILAIAARDAVSLATKVVTKGGWSRDGNLYQVETGRRDGRVSRAKEAVKNLPDSMDGIRKLIRRFASKNLSVKDLAVLSGAHAIGKSHCPSIAKRLRNFTAHRDSDPTLDGAYAAELRRQCRRRRDNTTELEMVPGSSTAFGTAYYGLVAERRALFHSDEALLRNGETRALVYRYRDAPSEAAFLADFGASMLNMGRVGVLTGAQGEIRKRCAFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACTGCAATGGCAGCGCGACCGCTGCTTCTTCCCCCTCCGGTCCTCCTCCTCCTGGTGGTGCTGGCTGCTTCGTCGGCCGCCCATGGCTACGGCGCCTACGGCTACGGCGACGCT
GCTGCTGAGCTCAGGGTCGGGTTCTACAAGGACTCGTGCCCGGACGCCGAGGCCGTCGTCCGCAGGATCGTCGCCAAGGCCGTCCAAGAGGACCCCACGGCCAACGCGCCGCTGCTCAGG
CTCCACTTCCACGACTGCTTCGTCCGG
GTACGGGGTTCCGATTCCATTGTAGGTGTAGAGTGAGTAGTAATGTCATGTCCTGCCCTTTTCTTTGATGGCATCCAATCCAATGCAGCTTCT
GATGATTTTCACTCAGTTGTGCACGAACTGACCACCTTCCTTTTTCTGTTTTAAATAAACAAAGAAAAACAGATAATCTCTTTCGTGTTGGCGTGTTCCCTGACCCCCCCTCCCCTACGT
ACTGGGCATTGATTGGCCAATCGCGCGCCATTGCTGCTTGCTGCAGGGCTGCGACGGCTCCGTGCTCGTCAACTCCACCAGGGGGAACACGGCGGAGAAGGACGCCAAGCCCAACCACAC
GCTGGACGCCTTCGACGTCATCGACGACATCAAGGAGGCGCTGGAGAAGCGCTGCCCGGGGACCGTCTCCTGCGCCGACATCCTCGCCATCGCCGCCAGGGACGCCGTCTCGCTG
GTATG
GTAGTATCCATCCACGTACACTGCTTTATTGCTTCCTTCATTGGCCGTCCAAGCAAAAGCAATGGCTGGCTCTGAGACTCCAACACAAACACAGGCCACCAAGGTGGTGACCAAGGGCGG
CTGGAGCAGGGACGGCAACCTCTACCAGGTGGAGACCGGCAGGCGGGACGGCCGCGTGTCCAGAGCCAAGGAGGCCGTCAAGAACTTGCCGGACTCCATGGATGGCATCCGCAAGCTCAT
CAGGAGGTTCGCTTCCAAGAACCTCAGCGTCAAGGATCTCGCTGTTCTCTCAG
GTACAGTTACGTTACGTACCCTGTTACCGTTAATTGCCTTAGCAATTTCCACGGGCTTTGTTCGTTA
CACACTAGATTCCACTTCAGTTCGTACACTGTACTATATATATCTATCATCGACAGGCGCCCACGCGATCGGCAAATCGCACTGCCCGTCGATCGCCAAGCGGCTGCGCAACTTCACGGC
GCACCGGGACAGCGACCCGACCCTGGACGGCGCGTACGCGGCGGAGCTGAGGCGGCAGTGCCGGAGGCGCAGGGACAACACGACGGAGCTGGAGATGGTGCCGGGGAGCTCCACCGCGTT
CGGCACGGCCTACTACGGCCTGGTCGCGGAGCGGAGGGCGCTCTTCCACTCCGACGAGGCGCTGCTCAGGAACGGGGAGACCAGGGCGCTCGTCTACCGCTATAGGGACGCGCCGTCCGA
GGCGGCGTTCCTCGCGGACTTCGGGGCGTCCATGCTCAACATGGGCAGGGTGGGCGTGCTCACCGGCGCCCAGGGGGAGATCAGGAAGAGGTGCGCCTTTGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACACTGCAATGGCAGCGCGACCGCTGCTTCTTCCCCCTCCGGTCCTCCTCCTCCTGGTGGTGCTGGCTGCTTCGTCGGCCGCCCATGGCTACGGCGCCTACGGCTACGGCGACGCT
GCTGCTGAGCTCAGGGTCGGGTTCTACAAGGACTCGTGCCCGGACGCCGAGGCCGTCGTCCGCAGGATCGTCGCCAAGGCCGTCCAAGAGGACCCCACGGCCAACGCGCCGCTGCTCAGG
CTCCACTTCCACGACTGCTTCGTCCGG
GGCTGCGACGGCTCCGTGCTCGTCAACTCCACCAGGGGGAACACGGCGGAGAAGGACGCCAAGCCCAACCACACGCTGGACGCCTTCGACGTC
ATCGACGACATCAAGGAGGCGCTGGAGAAGCGCTGCCCGGGGACCGTCTCCTGCGCCGACATCCTCGCCATCGCCGCCAGGGACGCCGTCTCGCTG
GCCACCAAGGTGGTGACCAAGGGC
GGCTGGAGCAGGGACGGCAACCTCTACCAGGTGGAGACCGGCAGGCGGGACGGCCGCGTGTCCAGAGCCAAGGAGGCCGTCAAGAACTTGCCGGACTCCATGGATGGCATCCGCAAGCTC
ATCAGGAGGTTCGCTTCCAAGAACCTCAGCGTCAAGGATCTCGCTGTTCTCTCAG
GCGCCCACGCGATCGGCAAATCGCACTGCCCGTCGATCGCCAAGCGGCTGCGCAACTTCACGGCG
CACCGGGACAGCGACCCGACCCTGGACGGCGCGTACGCGGCGGAGCTGAGGCGGCAGTGCCGGAGGCGCAGGGACAACACGACGGAGCTGGAGATGGTGCCGGGGAGCTCCACCGCGTTC
GGCACGGCCTACTACGGCCTGGTCGCGGAGCGGAGGGCGCTCTTCCACTCCGACGAGGCGCTGCTCAGGAACGGGGAGACCAGGGCGCTCGTCTACCGCTATAGGGACGCGCCGTCCGAG
GCGGCGTTCCTCGCGGACTTCGGGGCGTCCATGCTCAACATGGGCAGGGTGGGCGTGCTCACCGGCGCCCAGGGGGAGATCAGGAAGAGGTGCGCCTTTGTCAACTAG

Retrieve as FASTA