Entry information : EsilGPx05 (Esi_0049_0025)
Entry ID 16935
Creation 2021-01-29 (Christophe Dunand)
Last sequence changes 2021-01-29 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilGPx05 (Esi_0049_0025)
Name (synonym) EsilGPx05 (Esi_0049_0025)
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilGPx05
start..stop
S start..stop
OruGPx04 74 9e-16 50..252 38..233
SverGPx01 71 0.000000000000004 130..258 42..167
ReGPx_H16 70 0.000000000000005 101..255 14..162
CtaiGPx01_LMG19424 70 0.000000000000005 101..255 14..162
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 115855..116244 390 N° 2 117624..117698 75 N° 3 118238..118371 134 N° 4 118707..118851 145
N° 5 119412..119540 129  
join(115855..116244,117624..117698,118238..118371,118707..118851,119412..119540)


exon

Literature and cross-references EsilGPx05 (Esi_0049_0025)
Protein ref. GenBank:   CBJ48820.1
DNA ref. GenBank:   FN648696.1 (115855..119540)
Protein sequence: EsilGPx05 (Esi_0049_0025)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   290
PWM (Da):   %s   30920.76  
PI (pH):   %s   6.56
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQNAAGSQDAGSRRSSSNSSSSSSGASTRLEFGSGLGAAAAAIVIGGTSARGALAEDTTGDAATAVVATAGAEGAAPAASPAATETKPSLRELGFEVPYTGKSVPLNKFLGSRATLVVNGKLDDPEALHQMPGITKLASEYSKDGLNVLLFPTDQGTFEADEDRVIRIKFYQFYGFGQYPKAVVFDKIDIVGNTIHPFYRYLCRALKNPNGIARITLNYEKFLLDQDGKVVRRYPRKLEAADFEADVAVIAGDPLPAENRDYKLSWLKADQEATKSEYAFKLGLNYYNN*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAAACGCGGCGGGGTCACAGGATGCGGGCAGCAGACGTAGCAGCAGCAACAGCAGCAGCAGCAGCAGCGGAGCATCCACCAGATTAGAGTTCGGGTCGGGACTGGGAGCGGCGGCG
GCGGCCATCGTGATCGGCGGTACCAGCGCAAGAGGTGCCCTCGCGGAAGACACCACTGGGGATGCCGCCACAGCAGTGGTCGCAACGGCGGGAGCTGAAGGAGCTGCCCCTGCGGCTTCG
CCGGCCGCGACGGAGACCAAACCGTCGTTGCGCGAGCTGGGGTTCGAGGTGCCCTACACCGGCAAGTCGGTCCCGCTGAACAAGTTCCTGGGGAGCCGGGCCACCCTGGTGGTCAACGGC
AAGCTTGACGATCCGGAAGCGCTACACCAG
GTGATTGAACTAGAGCGTAGGCCACCGCTGTGTACACCCGCGGGGCGGTGTAAGCATCGCACCTTGGGAGGCCGAACAAAAAACGCCGGC
TGGGCAATTTGCCCGGTGGAGTTGACATCACGTAATATACCGCACCCCCGGGCCCGAATTCAAAAACTCGGCTGCACCATGGCGAAGAGGATGCATACATGAAGCGATGCGTTTGCGGAG
ACCTCCCGATGAGGAGGCTTCCACGCCGCCGTTTTCAGCGCTGCAAAGACAATACTTCTGCTGTGGACAAATCGAGCTTTGACAATCGGCCCAGGGAGTGTGGTATCTTATGTCATACCA
TCACCTTGTACCTTGTACGGTATACACATTTATTTGTGCCGGTCGTGGAGTGGAACATCCACCTTACCTCCCGGTGCTGTTCCTGGATATGTAGCGCACGGTGATAAGATCTGTGATGGG
GGTTGTCACGGGCACATAAATTGTCCTGCTGCGTTGTGTGCCTGTCTTCTCCGCGGGCACAGAATTGGTCCAGCTTCGTTTTGCAATCAATATCTTGCTTGTGGCTACACCTTCCGTACG
AAATAAGACTGCTGTTGTTGGGTGTTTGCCCTCTCCACCCCGCTGCTATGCTTTTGGCCCCAAACAAGGAATGCGAAAACACCAATCATCCGCCCAATCTATGCAACAGTGTAATAGTTT
CACCTCTGCAGAGTAGTATTGATCTTGCCGCTGCAGTCAGCAGCTCGATGTGTACAGCAGTGTGTTGTGCGATGAGCATTTCCCGTCGGACCGACAACGATATTGGCTCGCGCTCAAGAA
CGTTGTGAAGGTTTACAACCCAAGATTGCCGCATGGGGTGTTGGAATGATGGAAGGGAATGTCAATGTCGTCCGATGCCGAATGGCGTCATCTGTACCCATCCATACCAAGCGTAACGGG
GGATATGTTGCGCGGACCATTCTACTCGTTTGTTTTGGATATATCTGCACGTGGTACCAAAAGTGTCGGATAGGTCAACGCGTGCTGGGTGAAAAATGACCCGGGCTGTTGGCTGCGTTT
ACGAAACACAACTTCGCAATACCGGTCATGTCGACGCAGCAGTTACGGGTTTAGTGTCGTCCTGGCTATTCTGCCGGGGAAACCGAATACGTTCCGCAGGATACAGGCGATGAACGCGTT
TGATTTCGGTTGCTTGAACTGCCAGAACAAGCGCTGGCGATGCCAGAAGCCTTGCGCTTGCTCTTAGACGGGATGTATTGTTGGGACCAATGAACCGCGAGCCGCGGTTTGGTTCCTAGG
TGTACGGTACGGTGCCACGAAACGCGGGTTCTGATTGGCTACTTGCCCGACTGCAACGTTTGTTCCCCGGCGGTTGACGTACCTTGCAGATGCCTGGGATAACGAAGCTGGCATCGGAGT
ACTCCAAGGACGGGCTGAACGTGCTACTGTTCCCGACTGATCAG
GTGACTAGTCTCTGCCCCCGATGGGTTGCAGGCAGGGAGGGGGTCATGCCGAGCAGTGGCATAGGCATAGTGGTTG
TTGCTCTGCCGCGATCCGGAGACCGCTGTTGAGTGATTTCGTGGCCGACGGTGTCGTATCAAAGACAAGGCTAGGGAAGAAGCACGCAGGGGACCGGAGCGTTGGAAATGTTGGGTACGG
CAATTCATTGCGATTGTGCAGCAGGGTTTGTGGAATCGGGAATTGCCCGTATCCGTAGCTCTTTAACTGATGGTTCTGTTTACTGTGACGTATGATAATACAGTATTCCACACACACACT
CTTTCGTTCACGTGGACTAGGGGATGGAGGGCAGCCACGGAAAGGAACGGCAAGGTATTGGTAGCAAACACCATGCAGCAAGAATTGTGGTAGCAGTATTCAAGAAGAACCGAGAGTTGG
CAATGTGTTTGGGGTGATGACAGCAAGACACGGACGTGCCCCCCCCCACCACAAACACGGCGTTGCTTGCTTGTTTGCTTGCTTGACGCTGCTGTTACCACAGGGGACTTTCGAGGCGGA
CGAGGATCGTGTGATCCGAATCAAGTTCTACCAGTTCTACGGTTTCGGTCAGTATCCGAAGGCCGTGGTGTTCGACAAGATCGACATCGTGGGCAACACCATCCACCCCTTCTACAG
GTT
AGGGGTAGAACCCAACGCGATGATGGCGGTGTCCCAAGCGACGAGTGAGATGAAAAAATCTGTGCGTGAGCACAAGGCTGAGAACGCCGAAGAGTCAGAGATGGCAGCCAAGTGCCGCTG
GACAGGCCTCTCAGCCGTGCCACGCGGTGTCAACGGCACTATGTATGTGTCAACGGCACTATGTGTAACGGGACCACCTTGGCGAGGGTTTGGTTATTCATCTATGAAATAGAGAAGAGG
GGTTCGTCCCTGTCCCTAACCCCACAGCTAGCGAAGGCTGCTGGCAGGCACTGCATGTAACCGCCGGCCGGTCTTGATTGTGACGGCAACAGGTACCTCTGCCGGGCGCTGAAGAACCCC
AACGGCATCGCGCGCATCACGCTTAACTACGAGAAGTTCCTGCTGGACCAAGACGGGAAGGTGGTGCGACGGTATCCACGCAAGCTCGAGGCCGCCGACTTCGAGGCGGACGTAAAG
GTA
AAGGTACACTTAGTCGGGTAGAGGTCACGTAACGGTACCGTCGGTCACGGTATCGGTATGCGTTTTGGCGTAAATGCATAATTAGTTACGTATGGTAATCACGGAAATGTACAGTTATTC
GCGTAAAGGTACAGTTATTCACGTAAAAGGGACAGTTAGTGACGAAAAGGTACAAGTGGTGACGAAAGGTACAAGTAGTGACGTCAAGGTGCAGCAGTCAGTCACCAAGTACCGTGACAA
AAGCAACGGCAGGATGAGCAACCGAGAAATGCAGGAGTAACGCTCCAAAGATTGGCAGTCATTTAACCCCCTCGAAAAATTGTCACTTTCCGTTCGCTTTTTGAGGAAGGAAAGTGCAGA
CCAGTGACGGCCCAACCTGACGACCCGAATTATGCATGCGCTGCGCGGTCACAATGTTCCGTGCTTCCCGCGATCAAGCCGAAGGACACGCAATTCCCCTAAGAGTCGCCGAGTGAACAG
GCTGCATCGCGTGAATCCCCCCTCGTCCCCGTCCCAAACGGCGTGTTTTGGAACACCCGCATCCTCTTATCGTTCAGGCGGTGATTGCGGGTGACCCGCTGCCGGCCGAGAACCGCGACT
ACAAGCTGTCGTGGCTCAAGGCAGACCAGGAGGCTACGAAGTCCGAGTACGCGTTCAAGCTGGGCCTCAACTACTACAACAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAAACGCGGCGGGGTCACAGGATGCGGGCAGCAGACGTAGCAGCAGCAACAGCAGCAGCAGCAGCAGCGGAGCATCCACCAGATTAGAGTTCGGGTCGGGACTGGGAGCGGCGGCG
GCGGCCATCGTGATCGGCGGTACCAGCGCAAGAGGTGCCCTCGCGGAAGACACCACTGGGGATGCCGCCACAGCAGTGGTCGCAACGGCGGGAGCTGAAGGAGCTGCCCCTGCGGCTTCG
CCGGCCGCGACGGAGACCAAACCGTCGTTGCGCGAGCTGGGGTTCGAGGTGCCCTACACCGGCAAGTCGGTCCCGCTGAACAAGTTCCTGGGGAGCCGGGCCACCCTGGTGGTCAACGGC
AAGCTTGACGATCCGGAAGCGCTACACCAG
ATGCCTGGGATAACGAAGCTGGCATCGGAGTACTCCAAGGACGGGCTGAACGTGCTACTGTTCCCGACTGATCAGGGGACTTTCGAGGCG
GACGAGGATCGTGTGATCCGAATCAAGTTCTACCAGTTCTACGGTTTCGGTCAGTATCCGAAGGCCGTGGTGTTCGACAAGATCGACATCGTGGGCAACACCATCCACCCCTTCTACAG
G
TACCTCTGCCGGGCGCTGAAGAACCCCAACGGCATCGCGCGCATCACGCTTAACTACGAGAAGTTCCTGCTGGACCAAGACGGGAAGGTGGTGCGACGGTATCCACGCAAGCTCGAGGCC
GCCGACTTCGAGGCGGACGTAAAG
GCGGTGATTGCGGGTGACCCGCTGCCGGCCGAGAACCGCGACTACAAGCTGTCGTGGCTCAAGGCAGACCAGGAGGCTACGAAGTCCGAGTACGCG
TTCAAGCTGGGCCTCAACTACTACAACAACTGA

Retrieve as FASTA