Entry information : EsilMDAR02 (Esi_0212_0027)
Entry ID 16939
Creation 2021-01-30 (Christophe Dunand)
Last sequence changes 2021-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilMDAR02 (Esi_0212_0027)
Name (synonym) EsilMDAR02 (Esi_0212_0027)
Class Monodhydroascorbate Reductase    [Orthogroup: MDAR002]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilMDAR02
start..stop
S start..stop
EsilMDAR01 179 2e-50 51..374 90..383
ThasMDAR01 91 7e-20 51..392 128..365
KflMDAR02 87 1e-18 51..374 69..302
ThasMDAR03 86 2e-18 51..374 70..301
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 106436..106585 150 N° 2 107798..107842 45 N° 3 108086..108202 117 N° 4 108652..108747 96
N° 5 108973..109131 159 N° 6 109433..109615 183 N° 7 109793..109990 198 N° 8 110529..110702 174
N° 9 111826..111918 93 N° 10 112408..112542 135 N° 11 112743..112889 147  
join(106436..106585,107798..107842,108086..108202,108652..108747,108973..109131, 109433..109615,109793..109990,110529..110702,111826..111918,112408..112542,11274 3..112889)


exon

Literature and cross-references EsilMDAR02 (Esi_0212_0027)
Protein ref. GenBank:   CBJ30700.1
DNA ref. GenBank:   FN648390.1 (106436..112889)
Protein sequence: EsilMDAR02 (Esi_0212_0027)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   498
PWM (Da):   %s   53882.75  
PI (pH):   %s   4.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSAHGRRRSSALAAQVLEAIRETDEEIFEEILQYDLVALGGGVAAGYWGEGSGGEAHDPEWYKTNGITILSRCQAVSVDLDQKFLKVKRVTASNGELVFGDTIKVVYGRLLIATGARPRKIADEIKSLDNISKGLQGSCCCTRHPDVDGSPLACTFPDRFGFGSVHYLRDFGDTVKLVHAMGRVEADGQDTCKEPVVLIGGGFISCEVAAAVATHCPGMQLVMVMPGEDVMSSSGFGKEVCHFYEKQLARVGVAFAKGYRVNRLWGIEEEGCFPTLERSLQGSSMKKTFPRTFGPADPHFTDCRGVVLSNTQTGEKVWLLARFVVVGIGSVPNSDLFLKSLVLSEDGGIITDSYLRTSHPSGDVFAAGDVACVPEDPSSGVDHSAILERMARERPAVLSIKRLRKCPLEKLLDNPHCLEPPKLGVGEFHADTDETSIEEAFRKRAGGASTAKRADMASIMQELGADWDEDELEDALRALDPSDSGSVNFSDFVEWWSN*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTGCCCACGGTCGACGTCGATCCTCCGCCCTTGCGGCTCAAGTTTTGGAGGCGATCCGAGAAACAGACGAAGAAATTTTCGAGGAAATCCTGCAGTATGATCTCGTCGCGCTGGGA
GGAGGGGTGGCTGCTGGATATTGGGGAGAG
GTGAGAGTGTTGAACGCGATTGTGTAGTAAGTTGACAGGGGACGGCTACCTGCTGTGTGTAACTGCTGTACTAGGTCTTCCTCGCGACTG
TAGGTAAATACGTGATTGCTCTACATTCTTTGCTACAGAGGCACAATCCGCTGCAGTCTGCTTCGTACTCCATATTTTATTACCGCACCACATATTTTTTCAAAACGGGGGGGACGGGGA
CGCAGCATCCCCGGCTCAAAAAGGTCTGAAAATAATGTGAAAATTTCCTCGATGTACGTTCGGCCTGGGCGTTTTGAAATAGACCAATAGTCTAGAAAAAAAAAATAGTGACCAATGTGT
TGCCGGGGTTCAACTGGTGAATTCGAAAAACGCGTTGAGCGGGGATGGGCAGAAAAAATCCCTCAAGTACATTGATTGTGCGATTGAGCTAAACTCCAGGCTAGGTTTTTTTTTGGCGAG
GGGAACACCAAGCCGTTGCCAGATTTTTTATACCCACTTCTCTACGCACAGGGCTGCAGCTATCTAAAACACCCCAACAACCCGGAATGTTGGGAAAATGAATAAAATTTGTCCTTGCTT
GCAACGCACAGGCCATCGCAGGTTCTCTTGGTGAGAACGATTATACAGCTGCAATCGTGAGTGGAGACCCTGCTGGCTTTGCTCCGTTCGAAAGGTATCATTTGTGATTTGTCCCCCCGC
CCAACCTTACCCCCTTTTGTCACCCCCCTAGGAAATGTAGTGAGTTCTTGTCATGGCCCCGGGCAAAAATGAAAGTGGATGTTGCCACCCTTCTTTCGTGACATTCACACCCCCTCCCGG
GGCATTCCGATATTTTTCGCACAGATCCCCGCCTCTTGCGTAGTTCTGGTGTTTCCAGAGTTTACAGTTTCTGACAGAAACAAATCTCCCCCGGGACCCAATGCAAGGAATATTTCAGCA
AGTATAGAAACAGAAAATTGCGGGTAGACCTTGGCGCCAAAACTCTCTTGTCCTTGAGAACAAAGGGTTGTCTGAGGGTGATGCCAAAACCATGCGGGCAACGACTTGTTGGTAGGGGAC
GTACTATTGGCGAACCTTCGAACACGATGCGCGTCCGCGGATTCGACACCATGCCTTTCTATACACAGGCCGGCACTGTCCAAGACATGCCTTAATCCGGGGGCGAAGGGTTCGCGAGAT
TTTTCCTGCAGCTCCTCCTCTGATTTCCCCTTCGTCTGCCAGGGGTCTGGCGGCGAGGCCCACGACCCGGAGTGGTACAAGACTAATGTGAGTAGGGAAACGATGGAGCATCGGGGAGAC
CGTTGGCGCTCACAGTTCTGCCTTCTATGATGGTTGCTGCTGGAACAGCTACGCGGCTATACGACCGGCGCTCTTCGCATAGCAATACGCCAAAGAACTTCAACTTCGCCGTAAATTTGT
ACCACTTGGTTGGTGCTTAGTCTCATGTCGTGCCCATACTCTGACCAGCGCAGGCGTGTCTCGCATGACGATCCTTGCCCTTGACCGCAGGGCATCACCATCTTGTCCAGGTGTCAGGCA
GTTTCCGTTGATCTGGACCAAAAGTTTCTGAAAGTCAAGAGAGTCACCGCCAGCAACGGTGAACTCGTCTTCGGGGATACAATCAAG
GTATGTGTTGGTTCCAAGGCATCACACTGGGCT
TCGCGATAGGTTCCGATTGTGCCAACTTAGATGACAGCTGTCTACTTCTTTTATTGTTCACAAGTGTATTTTGCCCTCCAATGGGTGTGGTCAGTCATCTGCAGCATTGCGTGGCCCACA
CATTGTCTCTCAGGCTTCTCAACTATTGTATGCGTGCGGATTCGACGGAATATGTGCGATTGCTGTGTCCGATTGAATGTTGGCTTCGTTCATTCACCCTTGCATGCCGAGGATGGTCAT
TTTTCATTTTCTTCTTGCCTGTGACAGCAAACACACAAAGGCGTCTGTGACTACGTTGACCTAGTTCTAACGCATTGGATCCTTGAAGGAATCGAACCCTCTGGAAGGATAGAAACGAAC
AGATAGACGATCAAGAAGATACCGCCTTCCAACACCCTAAACTGCCGGTCCTGCAGGTGGTGTACGGGCGATTGTTGATCGCTACTGGGGCAAGACCTCGGAAGATCGCCGACGAAATCA
AATCGCTGGACAACATCTCAAAAGGCTTGCAG
GTAGGCCTTCAAATCACGTGCTGGTAGCTTCCGGCAGGTACAAGGTTAGGCGATGCAGTAGAAGATAAAAACCTCATACCTTGGAGGG
TATCCGATACTCGTCACGTGGTGTTTTTTTCAACTCAAGCATTCAAATTCAGCCGACCTGGCGGATTGCCTTCGCTTTAACAAAACAAAGGCAAAGTCCGTCGTGTGTCAATGGTCCTGA
AACACCCAACCCCTCAGGGAAGTTGCTGCTGCACTCGCCATCCCGACGTCGATGGGTCCCCGCTGGCGTGTACTTTTCCTGACCGGTTCGGCTTTGGGTCGGTCCATTACTTACGCGACT
TCGGAGATACCGTGAAGCTCGTCCATGCTATGGGCAGAGTTGAGGCGGACGGGCAG
GTAGGCTAGATGATGCGGTTGTACGTGAACGAATCCATTCTGGTTTGAGTTTTGTCGGGTAGGT
AATGGAAGATTAGACGCCTTGTCCTCCCTTAACATGGGCCTGGTGTAACTCATGTATAACGTGTTTTGCAGCGTAGAAATCGAAGAATGCACCAGCAAAAAACATGGTGCGTCTGGCAAA
ACACTGCGCAGCAGAGAGCAGCTGACTTGATGGCGCTTTCCTGTTTCGTATCAACTTTTAAAAGTGCTTGATGGTGATGCAATGTTCTTGCTTGTTTTACGACGTGATGGCGCACAGGAC
ACCTGCAAGGAACCTGTGGTCTTGATCGGCGGTGGCTTCATATCTTGTGAAGTTGCTGCCGCTGTTGCAACACATTGCCCTGGCATGCAGCTGGTCATGGTGATGCCTGGGGAGGACGTT
ATGTCAAGTTCTGGATTCGGCAAAGAAGTGTGCCATTTCTACGAAAAACAACTTGCGAGG
GTAAGCACCAGGCATTTTTGAACTTGGCCTTCCCGTGACACTTTATCCGCTACCTGCTTT
GCCCATCTGACCGCCGTGAGCTCGTTGGTTGGCGAGCTGCCGCATCTTGCCTGTCCGCCAATCAATGTGGTCACTGCTCACCCCCCTCACACCCTCCACTCTCCGTGGTTCTCCAAGGTG
GGTGTTGCATTCGCCAAGGGCTATCGCGTCAACCGCCTCTGGGGCATTGAAGAAGAAGGGTGCTTTCCTACTTTGGAGCGGTCGCTGCAGGGGTCTTCCATGAAGAAAACGTTCCCGCGG
ACGTTCGGCCCGGCCGACCCGCACTTCACAGACTGTCGAGGGGTCGTGCTCTCGAACACACAGACTGGCGAGAAG
GTGAGAGCTCGGGGCCTCTGAGGATGATCTCCGCATTCCCAGGTC
GGTCAAGGGTTTGAAGTGCAGCCTACGCAACAAGACGGGACGTGAGGTGTACTCTGCCTACGGTCTCGATGTGATGCACGAGGGTTCTTGTGACACACCAAGTACTAACGCCATAGCATG
CATAGTGTTCTTGAAGGTTAATGATATTGGTGGTGTGCAAGGAGGAGAACAGAAAGCACCTGTCTGTTTGCGGAGAGGCTTCTACGCCAAGGTTGAAGGTGTAGGATGTGTGCATAGCTA
TACGCCAAAAAACGTTCATCAACTGCTTACACTCCGTTCGCCGAAGCTATTCACTCCCAAGGCGTAAGTTGACTCCAAATAGCCGGCACGCACAACGCCGACAGCAACTCAAGTTGTTCA
ACGTTCAGCTAGCAAGTGCCATTCGTGTTTGTTTAGTGCTTCGTGCTAGAGCCATCCAGCAAGACACTTCATGCACTGATGTAGCCGCCACGTGCCTCGTTCCGAGCCCGACATGAACCG
CTGCCCCGAACAGGTCTGGCTGTTAGCGCGCTTCGTCGTGGTAGGGATAGGGTCCGTCCCCAACTCCGACCTGTTTCTCAAGTCGCTCGTCTTGTCAGAGGATGGCGGCATCATAACCGA
CTCGTACTTGCGCACCAGCCATCCTTCCGGCGACGTGTTCGCCGCGGGAGACGTTGCTTGCGTACCG
GTAACTCTTGGGGGAAACGGCGACACAAGCTTCATGGCGATAGCCAATCGATC
AGAGCACGTCAAAGCTGCGAGGGACATGGGGACGTTTGTTGCTGGCATGATGCTGGGCGGTGACGATTCTGGCGAATCGTACAACCCTGTTCCACATATGTATTCAAGGTCGGGTCTCGC
AACCGGTGAAGTTGATTCTTGCGATTAATGCGGCATGCTTGGTAGAAGCCTGGTGTTGCAACCGTGAAAGGCTTGGTTTTTGCAGGTAAAAAGATAGACATAACAAAGGCAAAAGGAGGC
GTTCAAAACATAACATAACTGCAACTTTTCTGTTTTCCGACATTGCACGCACGTGTGGTGCACAAATACTCTTCCCTACAGGCTGCCGAAAGATGGATGGCATTGCTTCAACAAACACGT
CAGGCTGGATTCGTCTGATATTGTACGTCACCTATTGTACAGGTTCTTGGACATATCATGGAAATTTTACGGTTTCGCGAGGGGAGAAGTGTGCGTGCTCGGCATGGAAACCTTCCCGAT
GACAAGGACATTCGGAGCTTTCTGGCTGCATGGCGGGAAGATTGTTGGTGCTTTTCTTGAGGTGGGGTTGATACGATGCGCTATGTATGCTACCAACAGGTGCTTGTCGTCCTGTTTTCC
TCGAACATTGGCGTTCCATGCTACGTTCAATTTGTTTCTCCCTTGGCTAGTGGTAGACTATCGCATGAAGTGCCAGTATGTCCCTGCTCTGCAGGGGTTGGGCCGTCGAAGAGCCCCGAG
CAACGTGGACCTGAGAAAAGCCAAACCAACACCCCCTCAGACTCTCGTGCTGACAAGAGCTTCGTGTAGAAATCACGACTTCATCGCCAGATTCCGTGGGTCGGGACTACACCACTCGAG
ATGTTACCTGAACCGAGCAAACGACAGATGCGATACGAAGTGGAGGGTGACCTGACCTCCTCGCACCCCCTTTAGTTGGCGATGTGTGGCCAGTTCGTCGGGAGGTGTTCCTCGGGTAAA
GTCCTGGGCTGGCCCTCTCAACTCGTCAACGCAGAATATGTCGGACATTCAAGTTCACGGTACGTCGCTACTTGATGCTTCGTCTCTATCGTGATTTCTGTTGCGCACAGGAAGACCCAT
CGTCTGGAGTGGACCACTCTGCGATATTGGAACGAATGGCAAGAGAGCGGCCTGCAGTGCTGAGCATAAAACGCCTGAGGAAG
GTGAAAGAAATTGTGTTGATATATTCATGAGCGTTGG
GCATGCTTGGCATCGACATCCGACTCCTCCGGAGATGCGCTGCACCGAAGGAGCGGGGGCATGCTGCGGGGTGCGTTTGAAGAAATTCATTTCAGAAGTTGCAGTCGGTGTTAATTCGTC
GGGCCTGCAGACTAGTTGGCCAACCATTCAGACTACCTAGGTCGCAACGAGAGTTGGACCTTGGCCAACACCAAAGAGCGTTGTCGAAGGGTATGATATGATCTTGTCGGATGCGGGGTT
TCGCCCAGTGCACCCGCCCAAACAGCTTCCTCATATTGATTCGAGTTTTTAACGCTGCATATTGCAAGCTGCGTTCTTGTGCGGGTGAACGGCACTTATTAAAAATCTCCAGTCTCCTCT
CAACGTTCTCCTGGTATGTACTTGCCACCCAAACGACAACTGTGGCGCCTGTTCTAACAATTTGCTCGTCGTAATACCGCATGCACCCACAGTGTCCTCTTGAAAAACTGTTGGACAATC
CTCACTGCCTCGAGCCCCCGAAGCTGGGCGTTGGCGAGTTTCATGCAGATACGGACGAAACGAGCATCGAGGAGGCATTCCGCAAGCGTGCTGGAGGTGCCAGCACG
GTGAGGCGCCACA
CGGGCGGGGGGAGGGAGAGGGGCCCATTCTGTACTCAGCATTCCGACGAATAGACGGGACGGATGCGAAGTCTTTGGTTTATTTCGTTCAAGTATGACCGCTTCGGAAACGTGCTTTTGC
CTCAGGGCGCTCCTGTTGGTTGTAATTTTGAGCTAACACATCAATCTGCGTGCCGCCGAAAACACAGGCCAAGAGGGCAGATATGGCCTCCATCATGCAAGAACTTGGCGCAGACTGGGA
TGAGGACGAGCTGGAAGACGCCCTTAGAGCCTTGGACCCGTCAGACTCTGGTTCTGTGAACTTTTCTGACTTTGTGGAATGGTGGTCGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTGCCCACGGTCGACGTCGATCCTCCGCCCTTGCGGCTCAAGTTTTGGAGGCGATCCGAGAAACAGACGAAGAAATTTTCGAGGAAATCCTGCAGTATGATCTCGTCGCGCTGGGA
GGAGGGGTGGCTGCTGGATATTGGGGAGAG
GGGTCTGGCGGCGAGGCCCACGACCCGGAGTGGTACAAGACTAATGGCATCACCATCTTGTCCAGGTGTCAGGCAGTTTCCGTTGATCTG
GACCAAAAGTTTCTGAAAGTCAAGAGAGTCACCGCCAGCAACGGTGAACTCGTCTTCGGGGATACAATCAAG
GTGGTGTACGGGCGATTGTTGATCGCTACTGGGGCAAGACCTCGGAAG
ATCGCCGACGAAATCAAATCGCTGGACAACATCTCAAAAGGCTTGCAG
GGAAGTTGCTGCTGCACTCGCCATCCCGACGTCGATGGGTCCCCGCTGGCGTGTACTTTTCCTGACCGGTTC
GGCTTTGGGTCGGTCCATTACTTACGCGACTTCGGAGATACCGTGAAGCTCGTCCATGCTATGGGCAGAGTTGAGGCGGACGGGCAG
GACACCTGCAAGGAACCTGTGGTCTTGATCGGC
GGTGGCTTCATATCTTGTGAAGTTGCTGCCGCTGTTGCAACACATTGCCCTGGCATGCAGCTGGTCATGGTGATGCCTGGGGAGGACGTTATGTCAAGTTCTGGATTCGGCAAAGAAGTG
TGCCATTTCTACGAAAAACAACTTGCGAGG
GTGGGTGTTGCATTCGCCAAGGGCTATCGCGTCAACCGCCTCTGGGGCATTGAAGAAGAAGGGTGCTTTCCTACTTTGGAGCGGTCGCTG
CAGGGGTCTTCCATGAAGAAAACGTTCCCGCGGACGTTCGGCCCGGCCGACCCGCACTTCACAGACTGTCGAGGGGTCGTGCTCTCGAACACACAGACTGGCGAGAAG
GTCTGGCTGTTA
GCGCGCTTCGTCGTGGTAGGGATAGGGTCCGTCCCCAACTCCGACCTGTTTCTCAAGTCGCTCGTCTTGTCAGAGGATGGCGGCATCATAACCGACTCGTACTTGCGCACCAGCCATCCT
TCCGGCGACGTGTTCGCCGCGGGAGACGTTGCTTGCGTACCG
GAAGACCCATCGTCTGGAGTGGACCACTCTGCGATATTGGAACGAATGGCAAGAGAGCGGCCTGCAGTGCTGAGCATA
AAACGCCTGAGGAAG
TGTCCTCTTGAAAAACTGTTGGACAATCCTCACTGCCTCGAGCCCCCGAAGCTGGGCGTTGGCGAGTTTCATGCAGATACGGACGAAACGAGCATCGAGGAGGCA
TTCCGCAAGCGTGCTGGAGGTGCCAGCACG
GCCAAGAGGGCAGATATGGCCTCCATCATGCAAGAACTTGGCGCAGACTGGGATGAGGACGAGCTGGAAGACGCCCTTAGAGCCTTGGAC
CCGTCAGACTCTGGTTCTGTGAACTTTTCTGACTTTGTGGAATGGTGGTCGAACTGA

Retrieve as FASTA