Entry information : EsilGOX02 (Esi_0070_0142)
Entry ID 16941
Creation 2021-01-30 (Christophe Dunand)
Last sequence changes 2021-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilGOX02 (Esi_0070_0142)
Name (synonym) EsilGOX02 (Esi_0070_0142)
Class Glycolate Oxidase     [Orthogroup: GOX001]*
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilGOX02
start..stop
S start..stop
BstrGOX03 337 2e-114 17..374 5..358
HaGOX09 337 2e-114 17..374 5..358
PpaGOX01 335 1e-113 10..368 1..354
AtGOX05 334 2e-113 20..368 8..351
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 683069..683141 73 N° 2 681151..681213 63 N° 3 680638..680772 135 N° 4 679879..679941 63
N° 5 679440..679572 133 N° 6 678433..678565 133 N° 7 677938..678002 65 N° 8 677617..677677 61
N° 9 676789..676920 132 N° 10 676193..676286 94 N° 11 675617..675747 131 N° 12 675249..675326 78
complement(join(675249..675326,675617..675747,676193..676286,676789..676920,6776 17..677677,677938..678002,678433..678565,679440..679572,679879..679941,680638..6 80772,681151..681213,683069..683141))


exon

Literature and cross-references EsilGOX02 (Esi_0070_0142)
Protein ref. GenBank:   CBN75171.1
DNA ref. GenBank:   FN648927.1 (683141..675249)
Protein sequence: EsilGOX02 (Esi_0070_0142)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   386
PWM (Da):   %s   41859.52  
PI (pH):   %s   7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSPEKKVPVDLSRCISLDDFQRQAKPILGKALYEYVASGTDDEQTLSENRQAFKRMFLLPRMMRVVSDIDLRLDVFGQRLSMPVFVSPAGVHKLMHPEGECATARACAEAGTLMGVSQHATVSLEDVAAAAPRCARWFQLYILKDRELTAGILRRSEKAGYTAICLTVDSVRFGSREADWRNNFNGLPPGVTLANYPTDGYNDRVKDAWDQNTEKLFDERATWSDIAWLKSLTSLPILVGILTAQDAVSAVEAGASGVIVSNHGGRALDGSLSSIESLAPVVKAVRSVPTGANVPIFLDSGVRRGTDVLKALALGATAVLLGRPMFFSLAVGGQEGVQRMLSIIRDELEAAMALCGCRLQDITKDLVTDFREGGSTFHRPRL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAGCCCCGAGAAGAAGGTGCCTGTTGATCTTTCGAGGTGTATCAGCTTGGACGACTTCCAACGACAAGGTTAGCCAAACATGTCTCCATAATACAATTCCGAGAACGGATCTTTG
GTGTCACGGCGCCCGCGGATGCTTCCTTTCCCCTCCAACTGCGCGAACAACAGCCAACCATGTACCATTTTGAAAGCGTTTTGAAAGCTGCCTCAACTATTGATTGTATCACGTAATGAA
GTCTGTGGTCGCGGGCTTTGATGCGTGTGTGGTGGTACTCGGTCCGGCTGGGTGTACGTACGTATTGTACATGCAAGTTGAACACCGCTCAATACTGTGCGGTACCCGTAAACAGCTACT
ATATGTACAATTGTATACAACTTTTGATAAACGCACCCAGCAAACCTAACAGCGGCAGCAGTTCTTTGTTGTGCCCACAAGAGCAACACAAGCACAGCGTCCCGGTAATCCACCGCAGAC
ATCGGGGGTGACACAGCAACCCAGTCATCGGAGAAATCCTCTGTAGGGTAGAACAAGTACCATGTAGACTCTGTTTGTTTTCGTGGAATCATTGGCGCCTCGTTGTGTGCGTGTGGCGTA
TGGAAGTTCAGTCCCTTCCCTCGAGTCTTACTTGTAATTCCTAACTCTGTCGCGCTCTCTATGCATAAAAACACGAAGTAAATTTCTTTGAACTCCCACAACAACCCAATGCATGCAACG
CAAGCCCGTGCTCGTGTAAGGCAGGTCCGCCGCTGCCTGTTTTGTTCCTGCGATGCTGCTGACTCGAACTATTTTTAATTTTTCGACGCAACGAATCCATCGATATTAAGACATAATTAT
TATATGGGGGTGTTTGATTTAATTAATTGTTTTTGGGTTTTGGGGAGCATATAGACTATGTAGCGGCGAGAAACGAGATAGTCTACGAGACGCGGAACCACATCTCGACGGGATTCCATT
TCCCAACCTAGCCGGCAGCCGCAAGAAAGCTTGTTTGGGAGATTACTGCCACAGACAAATTAACACCAGTTCAGTGCGGGCCACTACCGTAGCTTGGCTCTCCTAAGCGAGATGACTCGC
CAAAGTTTTTGCCATCAACAACGTGCTTTTCGACTCTTCCCCTGAGCACGTAAGTTAGAGGCACGACTGCGGAGGTCTAGCTACACTTGTTCGTGACTATTTAAGTCTAACCGATGTTGC
ACTTTGCAAGGCTAGTTTCCTCACGCGAGCAAGGCTAGGTTCCTCACCCTACATCTACCCTAACCCTAACGCAAGGCCAAAGCACGGCCTGGAACGGCGAGAGGGCGCTGGAGAGCGTCA
AGGCTAGGTACCAACGCCGGACCAATCAGAGGGCGTGAAACTGCTTAGATAGGAAGAGTGACTGTTTAACAGGTTGCAAAATTACTGGCGGAACCAACCCTTTGGTTTTCCTAAAGCTTC
GTGGGCGTCGGTACACTGCTGTGTTGTTCCAAAAACCTTCGAGTCTACTTGATTGGTGGAGTATCGGAACAACCGGACTACTGCCTGGTATTGATTCTCGAGGCGGGACCGGAGCTTGTG
ATGCGCTCCACCCACACGGTCACAAAAGGCGTTAGTTGTGGTGCCTGCTTCAGTAATCGCTTCGTTTGATCTGCAAGGTCTTCAGACCTAGCGAGAAAAAGTGGGGGGAAGGGAGGGAAA
CAGGCGGCCCACCAGGCTCAACGCTATCCAGTGTTGCCACGTTGTAGGCTACCTAGCTGTGTGCCACCGACTGCTCTCTGCGGCCTGACAGTCCCATTCCCATGCATCGCGCTGTTCCTC
GACAATCTTCGCGGCGCGGTACTATCGTGCTGCTGCTGTGCACTGTTTTTCAGACCTCACGTTGTTCGTGTTTGTCTACCCGCCCCTCATACCTGCCCCTCTGCCACTACCGGACATTGA
TGTGCCAGCGAAGCCTATCCTGGGGAAGGCTCTGTACGAGTACGTCGCTTCTGGCACGGACGATGAGCAAAGTAGGTGCCAAACGCACCGGCGGCGTTTAGAACTTTTGAAGCACAACGT
ACATGTACATATCCCTAGAAGTGTTGATAGTCTGTTTTCCGACCCAGCTAAACAGCCTCGCGACGGCCTGTGTTTCCATTACCGTCGCGTTTTGACGCTCCTGTGTAGGCCAGTGGTTGA
GTGGTGGCGGTCAGAATCGACTCATATGTGGCACTCGCACCAACAGGCATAGTTATTGACTCATAAAAACATGTTTGCTTGAAACGGCATCTCCTACGGCCGCCATCACCTATTTAGTAC
TGCTGCCCACAGCCCACTCGAAGAGCGGCTGAGATGAGATATGTGATGTTTCACCAATTCTTCTTTTTCATACCCCGAAAATCACGCAGCGCTATCGGAGAACCGCCAAGCTTTCAAGCG
CATGTTCTTGCTGCCGCGCATGATGCGAGTCGTGTCCGACATTGACCTGCGGCTCGATGTTTTCGGGCAGCGGTTGTCGATGCCGGTTTTCGTGTCGCCGGCCG
GTAAGTGCGTGTATTT
GGACGGGGGGGGGGGGCAGCATACTTGCTTCGGAACAGAACCTCTGAAACTGTTTCTTCTGGATTGGAGGTGTCCTGATGGGGAAAATATAGCGTCGGTGTAAGTTTTTCTTTCGTTTGA
AGGGGGATGGCCGACGGTCTCAAGACGTGCGCACAAGTTGTTGTCGTTGTTGTTCTCGGCGATAAACGAGTACGGCGCGATAGAATGCAAAGGGTGGAACATTCCCTCACCCCCAATCCC
CTCAACGTTTTCCTCGTTCTCTCTCACATCGGCTCTTCTCTCGCCCCCCTTTTTCTGTTCTTGTCTTGTGGACTGCTTCATCTCTGCTACTGTTTATAAGGTCAATGAAGTATGTTCTTT
TCGAATGTAAGGGCAAACACTTGCCGTCTGGAAAGCTAGCTTTTCTTCCTCGCAGCAGTTGGCGGACGCGCGCACGGCGGGAGGCGGGCCCTATGGGGGGCACCTACGGCGCGGTTGCAG
ACCTACTCGTTTAATGCATGCCGTTAATTTCAAGCTTGGAGGTGGGCGCCACCGGTGTCAACGGTAGTTCCGTGCTCGGACTTATTTGTGTTAAGCGCTTCTTGTGTTCCACCTCCACCA
CATTACCAGGACAATGGTAACCTGAACCTTGTTGGTCGCTCCCGACTGTGGGCCGCTGCACTGTCCTACACGCGTTGCAGGCGTGCACAAGCTCATGCACCCCGAGGGGGAATGCGCGAC
GGCGAGAGCTTGCGCTGAAGCCG
GTGAGACAGATGACAAACCCCCCACTTACTTGTTTTTCGGGAAGCACCTCCAGCACAAAGCGTGTCGTGCACTTCACGTGATTGTTGCTTCGGGATC
GACCCCAACGCGTGGACCGTTACAGGTTGAACTGACCTGAAACGTAGATCCGAACGGCGACTTGGTGGAGAGATGTCAAGCATGGAGATGGTCCTCAAATACCGAGAATAGCTATTACTG
CTGTTGTAGTCAACTACACTTACTGGTACTGTATTCTAGTAAACTTGTTCCTGGGCCTTTCTTCGGTCTCTACCGTTGGATTGACGCAGGTACCCTCATGGGGGTCTCCCAGCACGCCAC
GGTGTCGTTGGAAGATGTGGCGGCCGCGGCTCCGCGGTGTGCCCGGTGGTTTCAGCTGTACATCCTGAAGGACAGGGAATTGACGGCCGGCATATTGCGGAG
GTTCGTACGTGCAAGCAC
GCCGGGAGTGCCTGCAGCGAGAATTAACACGATAGCCGGTGACTTGAATGGAAACGGGCGCAAGTCTCGGGGCAACAGTTGAAGGTAGACCTCGGTCTGTGCTCAGAGAAGTCGTGATGT
TTGTTCGGGTGAAAACGAAGGAGAGCTACGAAAAGTATCACTCATCCGGACAAAACTTCCGTTGACTGAACTGCGATGTACCAAAACGAGATTATGCTTTTTGTTTCGGGATGACACACT
TTGACTTTCTTGATCGTACAGGCATAGACGTGTGTTTGCCGTATGTTAGCAGCGTATTTCTCGTGTTGGTTGCGGGTGCATGTCTCGGCAAGGTGTCTTTCAGTTCAAGAAAGACAATAA
TTGTCGTCGTTCCACAAGAATGGAACCAACACAACGGGGGAGATGATACGATCATGGAATGTACAGGTAAGGATGACGGATTGAAGAGGAGCGAAAGAGGATCTGACCTTCGAACCCAAC
AGAAACCCCGAAAGCTCTCATCATAGCGTTGCGATCGTGTCTGAGGTACTTTTGGCAGCGTGCGGTACGCCGGGGGGAGCGATTGTTGCCACTTGTGTTGTTGCGCTGCGTAGACGGACA
CTAGGTCTTGGTCGGTTGTTGCATTGATAAAGAACTGGTTCCGATAGTTTCTTGGCATCCTTCATGGAACGCACAATGAGTCTGACTGCTCATGAAGTGCAGTTTGTACGTGTCATCTAC
TGGGTAGCCTCGCAACCACCGCATCAATGGCGGTGCCAACCATAGTGACCGCAACAACACCGGTTCAAAACACCTGTTTCTAGACTGCAAGTGAAAGCAAAATCAAAAGCAAATCTGGAA
CTACTTTGTCCACCAGGTCCGAAAAAGCTGGCTACACGGCGATTTGCCTGACGGTTGACAGCGTGAGATTTGGGTCAAGAGAGGCAGACTGGCGCAATAACTTCAACGGGCTCCCACCAG
GAGTCACGTTGGCCAACTACCCGACGCAG
GTGTGCACCGAAAAAGGAATCATCCCAGAACTTCGATCCCGATGTCGAAGCCCTTGCAATTTTCGTTTGGTATTGTGGTGCCTCTCTCCTC
ACCCTGCGAAACAGCCCGCGCTAGTCAAGAACTATCCCGGCAGAGTTGGCTGGCGCCGCAAAAGGGTTGGTTGAGCCTTTGAAGAACCACAAGCACTTACTGCTGTTCAATCCACCTACG
CCCTTCAATCAGTGTTACGAATGGCGAGGCATCTTGGTGTCTCGATACACGTCGTTGGTTCCCTTTTTCCTTTTTTCGTCAACATTTGTTTTGGTTCGTGCTTTCAGCTGTCGCTTCCTA
GTCAGGTTTGTTCTTTGGTCGCCTAACTTGCGACATCCCTTCCCCGCGAAACGACACCTTCCCTCCGAATAACGTCAAATCTCTCCGGGGAAAACTAAGGACGGCTATAACGACAGGGTC
AAGGACGCGTGGGACCAAAACACGGAGAAGCTGTTCGACGAAAG
GTAAGCCTTGCCGAAAGCAGCCGCTGTTCTGATGCCAACTTGCTTGTGTGTGTGTGGACCGCAGAACTCTTCGCCT
TCCAGCTTTCTGCCAGCGGACTTCAGCAATATCCACATGTGCGCTTGAAGTTGGCCGGGGGCGATGAGTTCGTCGATTGTTCCGAAGGGTATTGCCCCCATGCCCGATGTAACTCAGAGG
AATATGTCGTGCCACTCTCCTCCATGCCTCGTTTCTCGTTCTTTGTCCCGCTTGGCGTCGGAAGAGCTACCTGGTCGGACATCGCTTGGTTGAAGTCGCTCACGTCGCTGCCGATTCTGG
TCAAG
GTGACGTCACCTACACGTATGGGTCGAGAGTACAACATACGCCATGAATTTGCCTCACTATTAGGCGACCCAGGCGGTCAACAGCAGCAGGGTTGATGAAATAGCTCATCTGCCT
AGAACTGGTGGAGGGGGGTGTATCGCCAAGCGCGTTGGAAAGCACACCCAGGAGCCAATTCTGCCCGCGAACGCTTGCCGCTCTTGCTCTCTCTCACGTGCGTTGTGATGACAAACCAAC
GGAGACAGCCAACATCTTTGAGCAACACATCAAGCAGCAATGTCAGGACCGCAGAAATGGTTGGGAGGTTTTAGACCTGTCTCATGGACAAATTTCATCCGATACATTTTGTTTTTCTTC
CTGGCCTAAACAGTGCAAGACGGGGTGTGGCTTTCGTGTTTACCCGAAGATTTTGTCCCAAAGACAACTCACAGTTGCACGGCACGCTTCGTTGGGTTAATGAAGGGGTGGGTAACTCAA
CGAGGCGGGGGAAAATTCTACGCAGATTTCGGTGTTCCCACAAGCACTTCAGCACTTGGGCGTTGGTAGGGAAACTCCTTTCGCACAATGGGTCAAACAACAGGTGTAATATTCCCTCAA
CACTTCACTGCTGTCCCCTCATTCTCAACTCGACCGACCCCAAATTCCTGTCTTGTCCTTCATACCTCTGTGTTGTTGTGCTTCCTATGTGCTTCCTACAGGGGATTCTGACCGCCCAAG
ATGCCGTTTCGGCTGTTGAAGCCGGCGCAAGCGGGGTAATCGTTAGCAACCACGGGGGGCGCGCACTGGACGGATCGTTGTCTTCGATCGAGAGCCTCGCCCCGGTGGTCAAG
GTGAACT
TGTCGATACCATCTGTGAACCGCATGCGAAAACTTTGGCAAATTCCACGCGCATGATGTCGGGGGGGCCGTGCTTCGGATACCGGTATTGTTTCTGTCGCGCGCCGAGACCGGGTTGAAC
TTCACAAGAAGGCCACAGGTTCGGACTACATTGTCGGCTTGAGCCTACCCTACTAGTAGGACCTCGTGGCAAGCCAAGCTAGTAGTTGTACCAGGTATATACTTCTGCCCGATTGTGGTT
TCTTACAATCTGTCAGCTGTCCCGAAAAGCATGCTTGTTTGCGCTTTGTTGCATACCACGTGGCAGTCGGGTTTCTTTTGATTCGGTGAGGCTGGTGTCACGTAAACGAGTGTCCGTGCT
GTTGTGTGCCGCTCCTGCCACGGGCTTCGTGCATTGGGCGCGCCGGACAGGACCTCCTGTAGTACTGTCGAGTACTGTCGATGGGCAAGCAACGTACCTCCCCACCATTCCTGACGTGCG
TCTTGAACCTCGCAGGCGGTGCGGTCCGTCCCGACGGGTGCAAACGTCCCGATATTCTTGGACTCGGGCGTGCGCAGGGGAACCGATGTCCTCAAAGCGCTGGCGCTAGGTACGTCTTAG
TCGGCGGTGGCGGCGGCCCTAGCTCAATCCACCACAACAACCTCGAACCCGGACCTATTTTGCCAGCTTGTAAAATTTCGATGCATCTCGCACCTCACCAATTGGTGTAGAGAAATGCCA
GTAACACAACAGAGGCAACGAAGCAGTTGATCGTTTTCGTGTCGAAGACTGCCTTTGGGATACAGCTTTAACTGCCTAGTTCACGTCTGGCCTGTTACATGTGCACGCTAAGGGCGTGTG
TATTTGTCTGTTATACTAAACCTTAGGCCATGGCTGTTTCGCCACTGGAACCGTTGTGTTCTTACCCCCTCCCTACTTCTCTCGGCTCGCATGTACGCCACCGATTTCGCCTGTTTCCGC
AATTCTCTTTTCTGGTTTTCTCTCTTTTCCTTTGATCCCCCTTCCCCCTCAACCCCCCGTACGCCCCACCCTAGGCGCGACAGCTGTACTTCTAGGGAGGCCCATGTTTTTCTCACTGGC
TGTGGGAGGGCAGGAGGGCGTCCAGAGAATGTTGAGTATCATCAGGGACGAGCTGGAAGCCGCCATGGCGCTCTGCGGGTGCCAG
GTTCGTGGTGGAGAGGGAGTACTTTTTCTGCATGA
GCATGTCGAGAAGAGATTCTCCTTCTTGGCAAACGAAAAACTCACGTCCCATGCGCAACAACATTTGCCGTGTGTAGCGTTTACTTCAAACGCGCCAAACGCGCTACATCCCGCGATTCT
GCGCTCTCATGGCGCTTTCAGGTTTTATGAGTTCATGGGGGCGAATTAGTTCTGGTTTCAGTTGCGCCTACGGTGACCAATGGGAAAACTCTTTTCTTTTCTATCATCTCTGCTTCGGGC
TTTGTTGTCGCGCAGAGGCTGCAAGATATAACGAAGGACCTAGTGACGGACTTTCGAGAGGGTGGGAGCACCTTCCATCGCCCTCGACTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCAGCCCCGAGAAGAAGGTGCCTGTTGATCTTTCGAGGTGTATCAGCTTGGACGACTTCCAACGACAAGCGAAGCCTATCCTGGGGAAGGCTCTGTACGAGTACGTCGCTTCTGGC
ACGGACGATGAGCAAA
CGCTATCGGAGAACCGCCAAGCTTTCAAGCGCATGTTCTTGCTGCCGCGCATGATGCGAGTCGTGTCCGACATTGACCTGCGGCTCGATGTTTTCGGGCAGCGG
TTGTCGATGCCGGTTTTCGTGTCGCCGGCCG
GCGTGCACAAGCTCATGCACCCCGAGGGGGAATGCGCGACGGCGAGAGCTTGCGCTGAAGCCGGTACCCTCATGGGGGTCTCCCAGCAC
GCCACGGTGTCGTTGGAAGATGTGGCGGCCGCGGCTCCGCGGTGTGCCCGGTGGTTTCAGCTGTACATCCTGAAGGACAGGGAATTGACGGCCGGCATATTGCGGAG
GTCCGAAAAAGCT
GGCTACACGGCGATTTGCCTGACGGTTGACAGCGTGAGATTTGGGTCAAGAGAGGCAGACTGGCGCAATAACTTCAACGGGCTCCCACCAGGAGTCACGTTGGCCAACTACCCGACGCAG
GACGGCTATAACGACAGGGTCAAGGACGCGTGGGACCAAAACACGGAGAAGCTGTTCGACGAAAGAGCTACCTGGTCGGACATCGCTTGGTTGAAGTCGCTCACGTCGCTGCCGATTCTG
GTCAAG
GGGATTCTGACCGCCCAAGATGCCGTTTCGGCTGTTGAAGCCGGCGCAAGCGGGGTAATCGTTAGCAACCACGGGGGGCGCGCACTGGACGGATCGTTGTCTTCGATCGAGAGC
CTCGCCCCGGTGGTCAAG
GCGGTGCGGTCCGTCCCGACGGGTGCAAACGTCCCGATATTCTTGGACTCGGGCGTGCGCAGGGGAACCGATGTCCTCAAAGCGCTGGCGCTAGGCGCGACA
GCTGTACTTCTAGGGAGGCCCATGTTTTTCTCACTGGCTGTGGGAGGGCAGGAGGGCGTCCAGAGAATGTTGAGTATCATCAGGGACGAGCTGGAAGCCGCCATGGCGCTCTGCGGGTGC
CAG
AGGCTGCAAGATATAACGAAGGACCTAGTGACGGACTTTCGAGAGGGTGGGAGCACCTTCCATCGCCCTCGACTCTGA

Retrieve as FASTA