Entry information : EsilGOX03 (Esi_0017_0040)
Entry ID 16942
Creation 2021-01-30 (Christophe Dunand)
Last sequence changes 2021-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilGOX03 (Esi_0017_0040)
Name (synonym) EsilGOX03 (Esi_0017_0040)
Class Glycolate Oxidase    [Orthogroup: GOX001]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilGOX03
start..stop
S start..stop
EsilGOX01 431 6e-151 23..404 11..394
MpalGOX01 345 2e-117 28..404 2..369
MpGOX01 345 2e-117 28..404 2..369
PpaGOX01 337 5e-114 36..404 8..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 242242..242317 76 N° 2 241739..241871 133 N° 3 240952..241070 119 N° 4 240283..240455 173
N° 5 239722..239928 207 N° 6 239303..239392 90 N° 7 238952..239086 135 N° 8 237921..238061 141
N° 9 237412..237552 141  
complement(join(237412..237552,237921..238061,238952..239086,239303..239392,2397 22..239928,240283..240455,240952..241070,241739..241871,242242..242317))


exon

Literature and cross-references EsilGOX03 (Esi_0017_0040)
Protein ref. GenBank:   CBJ25884.1
DNA ref. GenBank:   FN648214.1 (242317..237412)
Protein sequence: EsilGOX03 (Esi_0017_0040)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   404
PWM (Da):   %s   43314.29  
PI (pH):   %s   9.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRLEGQSATASAASTGMPLPTPKSDTARPGCTHVNVADYERRAKVVLPKGEFDYFAGGANDMVTLRENRAAYRRLRLRPRVLRDVSSVDTTRTVLGERMAHPIGISPAEHRAAHDDGELATARAAAGTCSMMVVSSSATTALEDVATAGGPNMQRWFQLSLSSRNRTVLAGLVRRAIAAGYTALVVTVDRPVLGRREADLRNCYELAPRLAEGRVVSATGARIGRRPDGTMDLGQASDARPEAGKSLNWDDVHWLRTICGDMKIVVKSVMTREAAEEALAHGVDAVWVSNHGGRQLDTVPATIEILPEVVQAVRGRCEIFVDGGIRRGTDVLKALALGASAVFIGRPVIWGLAHSGEHGVTDVINLLNEELVQAMRLMGCKKLGDIERSMVAHQSSYHAKL*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGGCTTGAAGGTCAAAGCGCTACTGCCTCTGCTGCCTCTACTGGTATGCCCCTACCAACGCCGAAGAGTGGTGAGGCTTCGGCATTAATTCTGAATAACGCTACCGTACCGCAA
GTGGTTAAACTGCGCATTCATTCGTAGAGGACCTTCGTTCTGTGTCGGCGAACGAAAGAACGGAATGAAGCGAGGACGTGTGGTTGGCGGTACTTGTCTACACTATCCTCGTTAGAGTAC
CAAACGTTTTGTTCTCAGCCATGTTGTAAACCTTACCCTGAACACACATCTGGTTGAGGAAGAAGCCATTCACGTACATAATTATATTTGCTGCATGTTGGCGGTGTACATACATGCAGT
CTACAGTACCAACGAGTGTGAGGTTCGCCGCAACTCTCGCGGTGTCGTAATGTATGCATACGCTGCTGCACGGTTCTCCCGCTAAGATACTGCACGACCAGGATGCACGCATGTCAACGT
TGCGGACTACGAACGACGTGCAAAGGTTGTACTGCCGAAAGGAGAGTTTGACTACTTCGCAGGCGGTGCGAACGACATGGTTACTCTCAGGGAGAACAG
GTGAGCAAGCACTGCACGCAA
TGCATCCTCACGATGAATGGTACAAGTCAATTGTTCGCGCTACACATCAGGTGGCACATAGCGTGCAGCATATCTATTGTAGTCTAGCGCGCGGCAACGCAGAAAAGAGCCACCCGAACA
ATAGAAGTGACACACAGACGGACAGGCTCCTTTCCCAAACGACTACTGTAACAAAGACGTGCGATTTGTTGATGCATTTAGTTTAGGTATACAAGGACCCAAATCCAAATCCTGGAGCTA
GGGACAGAAACGAAACATGGTTTGAAGAAGTTATCCTGTTGTCGATTTTGCGCAAGAGGAACTTCTCGGGATACCGCTATTTAGAGGTGAAAACTTCGAACATGGGCTGTGTGATGGAAG
TTAAATTTCAAATCTTCCGCAACGATGGGACCAACGCGGAACATCGAGATACTGGTTACCGATCGGCGTTGTTATGAGATTGAAGACATGGACAACAACTAGCAGTCCGAGGCAACCCGC
AAGTAAGCACGGAGAACCGAAAGAGTGGTAAGTGTCGCATGAATGTGGGGGTCTATTTCCCACCCATCTCGTCCACACAGAGCCACCAAGTGGTACTATAATACTCCTACCGTTTCACGG
CAAGGACGATAGGCGACTGGTCTCGATGTTTTTTCGCGTCGCTTCAGGGCTGCGTACAGGCGTCTACGGCTACGGCCTCGCGTGCTGAGAGACGTGTCTTCAGTCGACACCACACGCACG
GTGCTTGGTGAACGCATGGCGCATCCCATTGGAATCTCGCCCACAG
GTGATTAGGGGTAATAGTTTCGTCTTGCTTTTCCCGTACCATGTACCGTTGAGTTGTTTGAGAACAGTAAAACG
TGTAGACGCCGCTAGTCTAAGCTGAATACAGTGTCACCACATTCCTGCAGCAGAGCTAAATAGGTGCGACTGATAGCCACAAATTCGGTGGTAAGAGAAATAGAATGGTGCCGCATGGAG
GTGTATGAGCGAATTAGGTGCTTCGTTTTGTCACCGAAGCCAACCACAAGGCAATTTATTTTGCCTCAGCCCTGCCAGAGACTAGCAGACGTGGTCCTTGTTCCTAGCCCTCCCTCACAG
TACTCTTATGTGTCAATAATATGTGCATCCAATGAATACTCGCTAATCGCGCTTCTGTGTTTAAGCTCGATAAGGACTACAACATTTCCCCCCCGCGACTCCACTACGGCCACTATTACC
ATTGCCACTGCTATTGGTTCTTCGTGCTGCGCGTGCCGCTGTCTCATCACCAATGCTGCAAGCTGAACATCGCGCTGCCCATGACGACGGTGAGTTGGCCACGGCGAGGGCTGCTGCCGG
GACTTGTTCGATGATGGTGGTGAGCTCGTCGGCAACGACCGCCCTGGAGGATGTGGCCACCGCCGGTGGTCCCAACATGCAGCGCTGGTTTCAGCTTTCATTGTCATCGCGCAAG
GTGCG
ACAAAGATTGTTCATGTTGTCGTTTGCTGTTGTTGTCTTCACATCGATAAAAAAACCGTTCCGATCTCTCTACCCGGTACCGTCATCTGTCCATACTGGTCAAACACTTGACCTGTCGAT
ACCACGTCTTGATAGGGCATGCAGTATGCCATCGCATTGCAGTGTTACGAGCTTTGGTGTGCTTCCTGTACCCTGATGACCAAATGTCCCTGTTCTTATACTGCACAGCCTCAGGCAATA
TGCCCACTCGACGTGGCTGTTTACTCCCTGCCCCCCCCGCTCACCCCCTTCATTCGCTGTCGCCCTTTCAACATTTTGCACCACAATTTGATGATCTTTGAAACAAAAGAACAGAACAGT
GCTCGCCGGGCTCGTTAGGCGAGCCATCGCGGCCGGGTACACCGCGCTTGTCGTTACCGTGGACCGCCCCGTGCTAGGCCGGAGGGAGGCGGATCTGCGGAACTGCTACGAGTTGGCCCC
TAGGCTTGCGGAGGGCCGAGTGGTATCGGCAACGGGGGCACGCATCGGTCGCCGTCCCGACGGAACCATGGACTTG
GTCAGCAAACAGTTTGTCACAGTCAAAGCTGTTGTTCACGCCAA
ATAACCGGAAGCATACAAACTGCAGGTCATTTTGGATGACCGTTCCGAGCTCTGGGTCGCCTGGCGCTCTCGGAATAAGTTCAGTGTACGGCATGCCGTTGTTGTGCACGAATCGTGCTC
CACTCTCTTACATCCCATTACCCGGGAGGGAGTGTTCTGGCACATCAGAGATAGATGTGTCCCACATTTTTTCCCTTACACTGGCAGCTAGCTGCCTGTATGATACGTTTGTGTTCCCGT
ATTTGCTGTACACTGAACAGCTGCTGTTGTTCGTGGTTCTTGCAGGGACAGGCGTCTGACGCTCGGCCTGAAGCAGGGAAGAGTCTGAACTGGGACGACGTTCACTGGCTGAGAACTATC
TGCGGGGACATGAAG
GTATTTGCTGAACGGTTTCAGTGACCACCTGAGTTGTCATGTTGTCATGATTCCTTTTTTTTCCAAACTATCTGTAGGTTAGCTTTTGCACCGTATAGCTTTTGC
ACCGTATTTTACGTCTATCTATACGTTTTGCCCAGCCATGGCCGTTTTTGAACCGCCGAGAAACACGCCCAGTGGACGCGTGCTGAGCAGAGCATTCGTTCTTTTATCCAGATAGTGGTC
AAGAGTGTGATGACGAGGGAAGCGGCGGAGGAGGCACTGGCGCACGGAGTGGACGCGGTGTGGGTCTCTAATCATGGAGGGCGACAGCTAGACACCGTTCCGGCCACGATTGAGATCCTT
CCAGAG
GTGCGAGAAAGTGGGGGGCGGAAGGAGAGGATATAGATAGACGTTTCGCCCAACGCCGCGGGAGTCCCCGGTGCTGCTTCGGTGGTTACCTTCGAATGTTTAGACAGAGCGCAG
TCAGGTAGAAACCTCTTTCCCTCCAGAGTACTCACAAGAACGGGCTGACTGCCGTAATTGATGGGCCGGAACGAGTATCTCGGCGATGTGGGATAGGCTGCGAACCATTTTCTAACCATC
CGGTACCGCGTATAGAATGACACTTGAACCATCGGGTGACTTGTGCTTATAGACGACAGTCCAGAGGGTTAAGGTGGGACATTGAAAGGATGCTGGAACGAGGGATACTGAGATGGCATT
TCCATGCGGTTTTCATTGGGCAACGGCACCAACAGAGCGTGGCCTTGGATACAAGAAAAGTCTGACGTTCAAGACGACGTCCCCTCCGAATCCACGTCAAAAGTAAAGCTGACTTCTGAG
GTGGTATGGCTCTGTCTGTTGCTGCAGACGCGACATGGAACGGCCGCGAATTTTGATCGAATGCGTTTTCAACTATGCATGAGCACGTTGCAACGGCCAACGTGCCACTCGCGCGGGAAA
TGTTGATGTCGTCTTCACATGATCAATATTGACCTCGGATGGATCTAGTACCTGCTCGTCCATACCTTCAAAATGTATTGCCGTGGTCACAAGCTGACCCACCATAATAAGGAAGGTAAA
AAAAAGGCAGGCGGAGAAAAGGTCGTTTTCATTTCCTCTCATGCAACACCACCATTGCCTTTTGCGCTGTAGTAGATGCCGAACGTCCAAGAGAAGAGACGTTCGCCGACCTTGTTACCG
GCGTCGCTAGCTGAGATATTTTGCTGTGACCATTTTGTTGGCCCTTCCCTCACCAGGTGGTGCAAGCTGTGCGTGGACGTTGCGAAATTTTTGTGGACGGAGGTATCAGGCGGGGCACGG
ACGTGCTGAAAGCGCTTGCCCTGGGCGCATCAGCTGTTTTTATCGGCCGACCTGTCATCTGGGGGCTAGCCCACAGT
GTGAGTTTTGCGATGTACCTGTATTATTTGTCGCCCGGCAATC
ATTCCGTACCAGCAAACAGCACGTTTACGCGAGATGGATGGTAAGTATTCGATCATTCCTGGTTTGTGTTAGTTTAGACGAATGCGATGCCTCTCCACGAAGAAGAGCATGTTGGATGTT
TACCGTAGTTCGGATAGTCACGGATACCGTGGCGTGTCGCGGTGCGTGTTGGCTGGGCTATCTGGAGTGACCCATCCCCATGACTACAACATGAATTTCCATAAACAACGTGGCAGAAAA
GAACTGGTCACAGAATGATTCTCAGTCTCCTGCCTGACCACAGTACACGTCTGGTGACAATGACGCACTGCATGATGCATGCCAGGGCGAGCATGGAGTGACGGATGTCATCAACCTACT
CAACGAAGAGCTCGTCCAAGCGATGCGGCTCATGGGCTGCAAAAAGCTTGGTGACATCGAGCGAAGCATGGTCGCACACCAAAGCTCCTACCACGCTAAGCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAGGCTTGAAGGTCAAAGCGCTACTGCCTCTGCTGCCTCTACTGGTATGCCCCTACCAACGCCGAAGAGTGATACTGCACGACCAGGATGCACGCATGTCAACGTTGCGGACTAC
GAACGACGTGCAAAGGTTGTACTGCCGAAAGGAGAGTTTGACTACTTCGCAGGCGGTGCGAACGACATGGTTACTCTCAGGGAGAACAG
GGCTGCGTACAGGCGTCTACGGCTACGGCCT
CGCGTGCTGAGAGACGTGTCTTCAGTCGACACCACACGCACGGTGCTTGGTGAACGCATGGCGCATCCCATTGGAATCTCGCCCACAG
CTGAACATCGCGCTGCCCATGACGACGGTGAG
TTGGCCACGGCGAGGGCTGCTGCCGGGACTTGTTCGATGATGGTGGTGAGCTCGTCGGCAACGACCGCCCTGGAGGATGTGGCCACCGCCGGTGGTCCCAACATGCAGCGCTGGTTTCAG
CTTTCATTGTCATCGCGCAAG
AACAGAACAGTGCTCGCCGGGCTCGTTAGGCGAGCCATCGCGGCCGGGTACACCGCGCTTGTCGTTACCGTGGACCGCCCCGTGCTAGGCCGGAGGGAG
GCGGATCTGCGGAACTGCTACGAGTTGGCCCCTAGGCTTGCGGAGGGCCGAGTGGTATCGGCAACGGGGGCACGCATCGGTCGCCGTCCCGACGGAACCATGGACTTG
GGACAGGCGTCT
GACGCTCGGCCTGAAGCAGGGAAGAGTCTGAACTGGGACGACGTTCACTGGCTGAGAACTATCTGCGGGGACATGAAG
ATAGTGGTCAAGAGTGTGATGACGAGGGAAGCGGCGGAGGAG
GCACTGGCGCACGGAGTGGACGCGGTGTGGGTCTCTAATCATGGAGGGCGACAGCTAGACACCGTTCCGGCCACGATTGAGATCCTTCCAGAG
GTGGTGCAAGCTGTGCGTGGACGTTGC
GAAATTTTTGTGGACGGAGGTATCAGGCGGGGCACGGACGTGCTGAAAGCGCTTGCCCTGGGCGCATCAGCTGTTTTTATCGGCCGACCTGTCATCTGGGGGCTAGCCCACAGT
GGCGAG
CATGGAGTGACGGATGTCATCAACCTACTCAACGAAGAGCTCGTCCAAGCGATGCGGCTCATGGGCTGCAAAAAGCTTGGTGACATCGAGCGAAGCATGGTCGCACACCAAAGCTCCTAC
CACGCTAAGCTCTAG

Retrieve as FASTA