Entry information : EsilMSD01 (Esi_0091_0024)
Entry ID 16944
Creation 2021-01-30 (Christophe Dunand)
Last sequence changes 2021-01-30 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilMSD01 (Esi_0091_0024)
Name (synonym) EsilMSD01 (Esi_0091_0024)
Class Mn SOD    [Orthogroup: MSD002]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilMSD01
start..stop
S start..stop
CbraMSD01 242 4e-79 91..299 92..322
CbraMSD02 228 5e-75 91..298 3..231
CbraMSD03 185 3e-57 95..288 107..302
PpaMSD01 179 1e-55 95..287 36..225
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 107575..107659 85 N° 2 109146..109264 119 N° 3 109890..110030 141 N° 4 110709..110756 48
N° 5 111060..111141 82 N° 6 111566..111636 71 N° 7 112514..112664 151 N° 8 113368..113513 146
N° 9 114297..114356 60  
join(107575..107659,109146..109264,109890..110030,110709..110756,111060..111141, 111566..111636,112514..112664,113368..113513,114297..114356)


exon

Literature and cross-references EsilMSD01 (Esi_0091_0024)
Protein ref. GenBank:   CBJ28064.1
DNA ref. GenBank:   FN649149.1 (107575..114356)
Protein sequence: EsilMSD01 (Esi_0091_0024)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   300
PWM (Da):   %s   31713.34  
PI (pH):   %s   6.85
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLHSTLSYCSYQVHVTMKFTTSLVLSGAACASAFVGTPVSTRASLKSSAVRMSVSDSMGSLSRGDALAAAASAAAAGFVFSNSFPAFADGPYNLPDLPYSYDALEPYIDAATMKFHHDKHHAAYVGNANKALAGKTAPSLLDLQKDAIKTGVRNAGGGHYNHCLFWNTLCNHESSGAPSGLAKAIDEAFGSMDEMKAQFGTTAAGVFGSGWAWLGCTPDGKLAITGTPNQDNPLMEGAAGTAMVPILGLDVWEHAYYLKYQNRRPEYISAFWNVVNWAVSENYEMYASQGKGVPVQG*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCCATTCCACGCTTTCCTACTGCAGCTACCAAGTGCACGTCACCATGAAGTTCACCACGTCTCTCGTCCTCAGCGGTGCAGGTGGGTGCACACATTTTCCCGCAATCCTCGGTGCA
AGCGACAACGGGTTGCCAAAGAGCGTTCATCCAAAACTCTCATCCCGCCTCTTTGTCTCGCGCCCTCTGATTATCTGATTTGGGATTGGGTGTGTGCATGATGCAACGCCCGGTCGCGTC
TATACCTCTTCCCCGTGGGAAAACTACAAGGGCCTTACCCATGGAGAGTGCTCTGCCACGTTGCGGTGGTTGGAGTGATTGCGTTGCTGATTTCTTTGCAGTTTTCTGGATGCTCACAAA
GGTGCTCATGTGAAGCACGTGTTCTCGTTGCATGGCCTTTTTTGGCCCGCTCCTTTCGCGCATTGGCGCGGGATCCATCGCAACGCGCCGGGGGGATGTGAGGTAATCTAGTATGTTGCC
GTTGCGGATCGCGGCAGCGTGTCTCACGCTTTGTCCCGAGGGCAGAGAAATTGCATGTGTCCATGGTTGTATCCTCCGATCGAATTGCGTTGAACCCGGAATCATGAAATCAAACGAAAG
ACAGGCGGGAAGATATTGTGCGCTCGATTTACTCACCTACATACTACATGTAACCTAGCTTTTCATGTGCAAACCTCCTTGTACCCAAATGTACCTTGGCGAAAAATATACCAGCAGGAT
TTAGCGGGAGGTGTGAAGTCAGTCAACGTGTTTCTACGTTTCTACAACTTCTGTGCATCCAATTGTGTTGTGCGAAAATTGTCCAGCTTTCAGCAGATAATTGTCATCCTGTGATTGCCA
ACATGATCGCGGGAGACAGCAGCCAGTTGTTGCTGTTGGATTGCGAGCGCTTAACTCTTGCGCAGCACCAGACAAACCTCAACGATTAGATACGAGCGTTTTCGCCTGATTCTGCCCTGA
ATCGGCCACCCGCCTGTTCCAAACAAGCCCTGCTATACGTCGGGTCCTGCGCTTCTTTGGCATGAAGTACACAGACATGTGCACGCGACACTGACCACGTTTATGTGTGTATACGAATGA
ACAGCTTTTGCTGTTTGCATGTTTTCATCAACAGAAATGTAAACAAGCCAACACAGCAGCGTCCCTCCTTGAACAGCAGTAGTATCCTGTCTTTGTGATAATACATCATTGCAGAGGAGG
AAACTGGGTGGAATATATCTACCCAAGCTGACCGCCAGCATGTCAAACATGGACAGGGATCACCCCGGTTCTCAATCACGCCGGATCCATTATTGCCCCGTTTTTTGTTTGGAGCAGCGG
CACTGCTGTGTCGCGCTCCCGCGGTTCGGCCGTTGCCTGTCAATCCCCCACGGCAAACTCCCCACTACTTCGCGCTGATTTTGTTTTGGGCGAAGGCAAGAAATACACTCTGGCCTGAGT
CCAACACACACCCTTCCCGGCGTGGCGTCGCTCTACTCTTTCACTGTCTCTCTGTTGTGGTCGTGCTTGGGGTTGTACTAAATAATGTAATCCTCACCTCCGTGCTAATACAAAATTGTT
GATGTCTCCAGCATGCGCGTCGGCCTTTGTGGGTACGCCGGTGTCCACGCGGGCATCGCTCAAGTCGTCCGCGGTGAGGATGAGCGTGTCCGACTCTATGGGCTCCCTGAGCAGGGGCGA
CGCCCTCAAG
GTGAGTTTAGGACATGTCGTAGGTTGTGCTGTTGGGTTTATTTTTGGCGTCACTGGTTTTGCGGGTTGTTCCGACAAAAGGTGACAAACATGCCTAGTCGTAGAATGCGC
ATGACCGCGTGTAGTGATACAGACACATGGAATGACTTTTTGGGGTGGATCAAACTTTTTTTTTCCACGCACCTACACACACCCAGCCCAGTAATTTAAGGCGGCACCGCACGTTCTCGT
ATGGGGGACGCAGAGAACCTCCTAAACAAAGCGTCGTTCTGAAGTATGTGTATCCCACCGCTATACCGTACGAGTCGGAGAGATGGCACCCCCCTGGTAGCGTTTTTTTGTAGCGTATTT
CACCACAACCAGGGGGTACCAGTGCCGAAAAGGGTAGTTTTGGACACATCTCGTCGAGGGCTTTCCTGAGAGGTATCGGTCGGTGTTCGCACCCTCCTACTTGTGGAGAAATAGGCTAAA
CGAAAACGCTAACACGGGGGTGCCATCTCTCCGACTCTTACGGTATTCGTTTCTCACGTGTTGTCACGCAATGAAAAACAGTTCTCCCCCGCCATACAATCGTGCAAAGTACCTCGTGCT
ATTTTCTGTCGCTTTTTTTTTTCTGTTGACAACAGGCTGCTGCTGCATCCGCGGCCGCCGCGGGCTTCGTGTTCTCGAACTCTTTCCCCGCCTTCGCCGATGGGCCGTACAATCTCCCCG
ACCTCCCGTACTCCTACGATGCCCTTGAGCCGTACATCGACGCCGCCACGATGAAG
GTGACAGAATCGTCAGGATCTCAGTGAAGTTCAATCAGCGGTTGTTTTTTTCTTGTCGAGAGTT
GGGGCACAGTTTTGGTTCTTCAGCAACGGGGTTTCCGCGAGGCTGCAGGGAAGCCAGGCGGGGGAAGGGCGACCCGGTAATTTTTCTATTTTTTCTATCCCCTACAGACAGCGACATGGG
ACATGCCTCGACTTCGGAGGGTGGCTCACACCCTGCCTGTTGAACGGAGCAACCCGTGCACTTACTGTTCAGAAGATGCAGTGTCGAAGATATGCGCGTATTTCCTAGGGTGTGTATACA
AGTAGACCGCCTCTATGCCCGCAGGTACATCTAGTGCCCAACACGCATTTATGGCCAGCGGCATATTTTGACGAGGTCGAGTGTCAAGGTGGAACATGTCGGAATTTTTCGGCCTCGCAT
GCTCTTCTTGTGTTATCTTACGGCCGTTCCCTCTTGTTGCACCGGGTGTTGTCCGCGTGATCCTGCCGTCTCGGCGTGTGCCCTATCTTGCCGTTGTTTTTCTATCAACATGACACACTG
CCATTGTACTATGCCCTTTCCGGTGCTGGCGATGCATCTCTGCGTCTGCTACTGGATGTTTGGGCTGGGGGGCATTGACGCCTTTACAAACCAACACCCGGGTGCGGTTTGCCTGTCTTG
CTTCCTCGCGGCAGTTCCACCACGACAAGCACCACGCGGCGTACGTGGGCAACGCCAACAAGGTGAATCTGATTGGCCGGCAAGAACGGCATTCGGCCATGGGGAATAATTCCTTCGTCG
TCGTACAGTACCGGTCTAGACGCTATCCGGTGTTTGCAGCGCTTACTTTTCTCTGGCGTGTTGTGTCTGTAGGGCATGGGGATTGCCAGCAGGCCCCTTTCCCGTATCACCTGCAGTCCA
AAATTTCTCGCTCTTTGGTTACCTGTAGTCTTGATAATGCCTATTCGTTGACGCTCGGTGTTCATCTGTGTGATCATTTCGACCGACGTGATTCCATGTGATGTTGCGTGCTGCGGCTGG
AGCAGGCCCTCGCCGGCAAGACCGCCCCTTCGCTGCTCGACCTCCAGAAGGATGCCATCAAGACCGGTGTCCGCAACGCCGGCGGCGGTGAGAACAACTCACTTGAACTTTGCTGACTTC
TTGTATCTAACTCGTCGCGAACTTTAAGTTGCAGTTTATTTTCTTTTTTTTCTGCGTCTTCACGTGATAACAGCTCGCTCCGTTGCCTACGTTTCACGGCAGGCCTCATCGTTTGGTCTC
TCACTTGGGCGGCTTTTGTCGACTGGTTTTCTCGATGTGACAGCCGCAATTTATTTTTAACATTTACAGGTGCCTTGATCCGTACTTCGACCCCGCTCCATGCTATGACGCTCTCAGGAG
TATCTCCCAATCACCCCATGAATTTTCTTCAGCGCACGGTTTATTTTATTTTCCTGCTGCTCAACTTTGCCGCGCTTGGTCCCCGTCCCTCCTTTGCTGACCGGCTCCCACGTGTGTTTT
TGTTTTGTGTTTGCTGCGGGTGTTATTTCAGGCCACTACAACCACTGCCTGTTCTGGAACACCCTGTGCAACCACGAGAGCAGCGGCGCTCCCTCCGGCACGGTACTTGTTGTGTCTTTA
CTGCGATACAGGATTGCTATATACCCGTTAGTGCTTGTTTCAACAACAACCGTTCTGACGTGTTTCGCTCTGATCGACCGGTACAAACAACGACGAGTCAACCAAGAAAGTCCTGCCGTA
GATATTTACAAAAATGCACGCACAGTGTGTGTGTTCATTGGATCTTCTGATGGCTCTAGCATTTTTGTGACCACGGACCGAGTCTTCGCTAGATTTTGGGAATAGCATCTGACACGAGTT
TAATGTGAAAATAACAACCACAGCTACGCATTGACGAAAACGTGGATGCAGGACACGCACCCCGCACGAGGATAAAGCCCTCCGTTGTAACTTTCATTTTCACTCGCAACTTCAATCAAA
TATGAAACAAACGAAGTTACCGCATAGTTCGTTCTTTCATCACAACATGCCAGGGTTTTGTGATGTGTTTCATCACCGCCGTCGATGAGGATCAAGATTCCTCCTATGAATAGTTCAGAG
TGCCGTATCCCGTATGCCAGAGATGACATCTTCCATTCTAGCCTTTTCCGTGATCTGGATGCCCTCGGTGGCGTAAGAGGACACGACAGAAACTGCCATGGGACGTCCGTCGTATTTGGG
ATATTTAAGCAGGGGTTGGTGTTTCTTCGACACTCCATGGTGTCAACCCAAGCAGCACTTGCACTCCATCCACCTTGCGCTCTAACGAACGCACGAGAATTTCTGCTTCCTTACAATGTG
TTTTGTAGTCCGCCTGCGTTCCCGTCTGGTATCCTTTTCATTTCCTCCGTTTCGCTCTGTACCTTTTGCACTCGTTTCTCTCTCGCCGTGTACTGGCGACATCCTCTTAATCTCGGCCCG
TGGACATCGAAACCAAAAGCTGGCGAAGGCGATCGACGAGGCATTCGGGTCAATGGACGAGATGAAGGCTCAGTTCGGCACCACCGCGGCAGGCGTGTTCGGCTCTGGATGGGCCTGGCT
CGGTTGCACCCCCGACGGAAAGCTTGCCATCACTGGCACCCCCAACCAAG
GTCAGGCAGCGAGTGAGGAGTATCAACACATGATTGTGTTGTTGTGTGTGGAGCTTGTTTAGTTTGTATC
GACGGCGCGAACCGGCTGATCTATGAGTGTGTCACCTAACAAATCCACAACCAACATGTCCGATTTCATGACCCCTTACAAAAGATGATATAGCGGAGCTCGTGAGCTCAGGGCGTTGTT
GCAATTTTCTTTGGTAAATGCGATGGCTCGAGTTTCTGTCCCCTCCCCCTTGGTGTCGCATAACGGCTGGAACGTCGCTCGAAATATTGTACCGATTTTGCCGGTATCGAGCCAAGGATG
ATTGTTTTTGTCACGTACGAGGTGTGCGTCCATGAAGCCGTCTGTAGTCGTCGGTCTCGGCATGCATACTGACGGCACACTTTCGGCAGAAGTCCGCGGACCCAATGCTGGCAGTTTCAC
GACCCATGTGATGAGACTTGTTTCTCCTCGAATACCCCAGCGATGATTTCTCAGCGGCAATCTCTTCGAGCATGTTGCAGGCACCAGAATACCGTAAGCTCAAGATCGGTCATGGTCCGG
TGTTGGCGCCCCATATGTAGCTCGCGCGTTGCTATGGACGCGTAGGAGATGCTTGCCTTTTTACCGGAGAGCGTTTGCTCACACTTTTAATTTTCCTGCTGACCCTACTTTTTGTTGAAG
TCCCCCCCCCTTTCTTCCTCGCGTGAACGCTAGACAACCCCCTTATGGAAGGCGCAGCCGGCACGGCGATGGTGCCTATCCTCGGCCTCGACGTGTGGGAGCACGCCTACTACCTCAAGT
ACCAGAACCGCAGGCCTGAGTACATCAGCGCTTTCTGGAACGTAGTCAACTGGGCGGTG
GTAAGTTGATGGAACATAAACATTTGTAACGGAGCAGCACTTCGCTGTTTAGCGATCGCAG
GTGTATTTGTACAGCTTCCTTGGAGTGCTCGTGTGCCCGTGCTACATCAAGCACGTCCATGATACTTCAGTGATACCAACGCGTAATCTTGGGTACATGCGGCGCTCCCTGTGACGTCAA
CTGGGCGGTTGCGTTTCCATTTTGGACGGCGGTTGCATTTCTGGTTACTACATTTCCGGTGCTCCGGTTCCCGGAACGACCCTTCCGTGTGGCGTCCGTGAAACGATAGAAAATACGAAC
TTAGCCTGATGCTCGTGTCGCTCTACCAAGAAACCCCCCTCACATGGCTTGGCACTGAGGTTGATGGGGTGCTACTGGCGGATTGCCATGATCCAGTGTGATCGATCGCACGATGTGATT
TTGCCTCTGGTCGTAGTGTCGATGGGCTGGAATCAATCGTACAGCTGGCTTGGAATTGTGTGTAGAGTCGTGTTGTGGATTCAATTATTTTTCCGACTCAACTTTCTTTGCTGCGAAGAA
CGTATTGTCGCCACAGGATGACCCCGATAGTGTCTCATCCAAAACATTCCAAAAATGGGTTACGATCCAACGCCTGCCGTGCGACTCTAGGCAGGCGTTGCAGTAACTCTTTCTTAGCCG
GACGCGTCATGTCTTTTGGCGCCCCGCCTCCATGTCTTTGCCAACTCTGTATCTTACTGAATCTCGCCTCGTCCGCCCCATATCTCCTCGATCTTTTCTGGTATCATGCAACAAATTATC
AGGTGTCTGAGAACTACGAGATGTACGCATCCCAGGGCAAGGGTGTGCCGGTGCAGGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCCATTCCACGCTTTCCTACTGCAGCTACCAAGTGCACGTCACCATGAAGTTCACCACGTCTCTCGTCCTCAGCGGTGCAGCATGCGCGTCGGCCTTTGTGGGTACGCCGGTGTCC
ACGCGGGCATCGCTCAAGTCGTCCGCGGTGAGGATGAGCGTGTCCGACTCTATGGGCTCCCTGAGCAGGGGCGACGCCCTCAAG
GCTGCTGCTGCATCCGCGGCCGCCGCGGGCTTCGTG
TTCTCGAACTCTTTCCCCGCCTTCGCCGATGGGCCGTACAATCTCCCCGACCTCCCGTACTCCTACGATGCCCTTGAGCCGTACATCGACGCCGCCACGATGAAG
TTCCACCACGACAAG
CACCACGCGGCGTACGTGGGCAACGCCAACAAG
GCCCTCGCCGGCAAGACCGCCCCTTCGCTGCTCGACCTCCAGAAGGATGCCATCAAGACCGGTGTCCGCAACGCCGGCGGCGGCCAC
TACAACCACTGCCTGTTCTGGAACACCCTGTGCAACCACGAGAGCAGCGGCGCTCCCTCCGGCACG
CTGGCGAAGGCGATCGACGAGGCATTCGGGTCAATGGACGAGATGAAGGCTCAG
TTCGGCACCACCGCGGCAGGCGTGTTCGGCTCTGGATGGGCCTGGCTCGGTTGCACCCCCGACGGAAAGCTTGCCATCACTGGCACCCCCAACCAAG
ACAACCCCCTTATGGAAGGCGCA
GCCGGCACGGCGATGGTGCCTATCCTCGGCCTCGACGTGTGGGAGCACGCCTACTACCTCAAGTACCAGAACCGCAGGCCTGAGTACATCAGCGCTTTCTGGAACGTAGTCAACTGGGCG
GTG
GTGTCTGAGAACTACGAGATGTACGCATCCCAGGGCAAGGGTGTGCCGGTGCAGGGTTAA

Retrieve as FASTA