Entry information : EsilRboh02(Esi_0088_0079)
Entry ID 16962
Creation 2021-02-02 (Christophe Dunand)
Last sequence changes 2021-02-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2021-02-02 (Christophe Dunand)
Peroxidase information: EsilRboh02(Esi_0088_0079)
Name EsilRboh02(Esi_0088_0079)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh005]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EsilRboh02
start..stop
S start..stop
EsilRboh04 792 0 169..922 1..700
EsilRboh03 542 0 221..922 1..651
EsilRboh01 377 2e-118 237..613 122..502
EsilRboh01 74 0.0000000000001 769..922 586..741
PraRboh01 87 8e-18 283..518 385..654
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 448509..449225 717 N° 2 449690..449775 86 N° 3 454941..455131 191 N° 4 455612..455793 182
N° 5 455977..456122 146 N° 6 456692..456763 72 N° 7 457266..457395 130 N° 8 458019..458133 115
N° 9 458943..458979 37 N° 10 459410..459485 76 N° 11 460357..460803 447 N° 12 461234..461506 273
N° 13 461992..462090 99 N° 14 462652..462783 132 N° 15 463234..463299 66  
join(448509..449225,449690..449775,454941..455131,455612..455793,455977..456122, 456692..456763,457266..457395,458019..458133,458943..458979,459410..459485,46035 7..460803,461234..461506,461992..462090,462652..462783,463234..463299)


exon

Literature and cross-references EsilRboh02(Esi_0088_0079)
Protein ref. GenBank:   CBJ27980.1
DNA ref. GenBank:   FN649117.1 (448509..463299)
Protein sequence: EsilRboh02(Esi_0088_0079)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   922
PWM (Da):   %s   97803.06  
PI (pH):   %s   9.94
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLPDRRASNTDDLEMGNHTRSPSLESGSAHDGSSFSSSRYGKNNRGGDGRARHHRTPSSAGNVESTRRERSTRRATDGDGSGRGAPGHGRRRSGSHGSRGSRGGGGGGGVGGGSRSSSRSSSPDGGDRSGQKHRRGGDGSGSSRARTLGADTDNDAGGLLEGSSYSGMSGMVVVDRNNNDRGASSRNIGGAGKSASGRSVGGGGGLGADGGGSGMGGGGQEPAVQRNGCMKTSTALKLITLAIALLNVVALWGWHYDTRAGRLCSIRSRRACVSSGPEMALISVARLTAGALFPSIFFCVLSKCYATRYLLHHSWLTFIIDFEPSHKLHYFGVLILLCSVVHSVCHIAVGALQRRADHAFKDEINRSGLVAVLLLLPIALPMTMRLAKTLTFEARKYLHLLFIPFMIAVCFHGRALQILGAILLAWYLLDRLYFTTKMTFLLSSPVYKPVGRGTLVRFELPPGYQYKPGAYVQVNCPAISVSEWHPFSLFPVPGSRPRAGFHVEVGDWTNEMFRFCLENPQMPLWITAAQPSVVEKTMYFDNEPSISEAIELEPVFQKKKNIHLLWCCRDAGMVAMFEKLRRVKSTVYLTGKPTNKTKKRMVDLLAPSRSDVVAANAGTSTSRSSSLRGDPACALEDGRGGGGGGGGPEVSNLNADLDDYLGVLKDDFEGSGRTERGSLDRDDDGGDGSVMGYSAWGGDSILGGGEGSALGVSSAHGGSALGGMGRTEAAAARREEEEERTAASKKRHRGQPSAGQLQRARGYHPVSLNFGRPDIAAFITGTVRGTAVVAQWAPPVDSRPPAPSSSSPRQQPTAGGLRQMLTRLNTGQRISKRDLMEADLTVVDSSLAKSKKPSSVSGVTGFDMPNSDIPNNGSVGCVDEKSWLVLYCGANGKVEQAVQTASEGLNVAWRKEYFSKW*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTGCCGGACAGGAGGGCTAGCAATACCGACGACCTGGAAATGGGCAACCATACCAGGTCACCGTCGCTGGAATCCGGTTCAGCCCACGACGGCAGCAGCTTCAGCAGCAGCAGG
TACGGCAAGAACAACCGCGGCGGCGACGGCCGTGCCAGACACCACCGCACCCCGAGCTCCGCGGGCAACGTGGAGAGCACCCGCAGAGAACGCTCGACCCGTCGTGCCACCGACGGCGAC
GGCAGTGGCCGCGGCGCGCCCGGCCACGGCAGACGGCGCAGCGGCAGCCACGGCAGCCGCGGCAGCCGCGGCGGCGGCGGTGGCGGCGGTGTCGGTGGCGGCAGCCGGAGCTCCAGCCGG
AGCTCCAGCCCGGACGGCGGCGACCGGAGCGGCCAAAAACACCGCCGCGGTGGCGACGGCAGCGGCAGCAGTCGGGCCAGAACCCTCGGAGCCGACACCGACAATGACGCGGGAGGACTG
CTGGAGGGAAGCAGCTACTCCGGCATGTCCGGGATGGTTGTCGTCGACCGCAACAACAACGACCGCGGCGCGTCCTCGAGAAACATCGGCGGCGCCGGGAAGAGCGCGAGTGGCCGCTCA
GTGGGCGGCGGAGGCGGGCTTGGTGCCGATGGAGGTGGTAGCGGCATGGGCGGGGGGGGGCAGGAGCCCGCGGTGCAGAGGAACGGGTGCATGAAAACGTCGACGGCGTTGAAGCTG
GTA
AGCATATGTACGTGACGTGCGACGAATATGAATGAAGGCTGCACGTTTCTTCACGAGATGCTTGCTCTCTTGATCATACTCGGGCCACCCACTGGCGTGTGTGTAGTCGGCTGCCTCATC
CTTTAGCGCGCCGTGTGACCCTCCCGTGTATGTCCATCCGTTATCTTAGCTCTGACCTTTTTGAGAATCCCCCAAGCTCAGACCTGCCGCAGGGGCATTGGATCACGTGGTATGGAGATT
TGAATTTGAAGTGAAACTTGTCTTTGACGTGAAACGCTACTTCCGGCTGTGGTGGTTCGCTGCACCGCGTCGTGATTCCCATCCCTCACACCGCCTGCAGCCTTTATCTCTTTATCCTCC
ACCTTGACGCCCTCCGCCTGGCCCCTCGTCAAAGTTTTTGAGTGACCCCCGTCCTTTCTGTCCTTCGTTTTTTTTTTCCAACTTTCCAAACACCGCCAAAGATCACCCTGGCGATCGCGC
TCCTCAACGTCGTGGCTCTGTGGGGGTGGCATTACGATACGCGGGCGGGGAGGCTGTGCTCGATCAG
GTGAGCAAAACCCGTGTTATCTATCCAACCGCCCCACGGGGGGGCGCGAATGA
TTGTGCCATGTTTTGTTGCGCGCGCCTAGTGTGCCGCACCGGTCAGGCGTCGAGAGATCAGGGTATCGTCGACACCCACTAACCGACGGTTTGCTGTGGTTCATGCTTGGACTGGGCGAC
CCAATTGTCGAAAACCGGATACGTCGTAGGCCTCTATAAGGCGGGTTTTAGCGGGTACCCGCCATATGGTGGGTGAATCTCTTGGCACAGATGGAATATGCAAGACGGCGGTTAATGCAC
ACAATAGTGCGGGTGCCCTGTACCATAGGGCGAGTGAATCGGTTGGCGCATACCCGCCTTATAGAGGGCCTACGACTGAACATGAAAAATAGTTGGCCCGCCGCGCGTGCCATGACCCAC
TAGAAACGACAGAGAGTCGACATCGCACGGTAGTGTCACGAGAACATCTTTTGTCGTACTTCGGTCCGAAAGGCAAGCAGGCAACTAGCTCCTCGGTACGTTATCATTCGTACGTATGCT
ACAATTCCTGGGCGTCGACATGCTGTGTAGCAGTTACAACAGACCACGCGGACCATTGCCGGCCGATTGCCGAGTATTGTCCCGAACCGGTCATTTCGAGACGAAACCACCCGAGGACCA
CCGCCAGAATTGCCACGCGAAACAACGCGTTCAGCATGTCGTCTTTCATCGCCCCGGGGATGCCCGTATCGAACATTTCCGAAGGGAGACCACCTAATAGATTTCGTATCTGCTCTCGAT
TGTTTTTTCTGATGGTGGCGTATGTTGTAAGACACGTTCTTCGACCATATGATGTACTTGTACAACGACCATATGGTTTACAAGGAGCAGGAGAATGTGCAACCCTCATCGCGATAAAGT
TTGAAGGCTGGAATCTCCGACGGGGTTGTTCTTGTGTGACCCTGGCTTGGACGCCCGAAAATGATCACGCACAAGAAGTAAAGGTGCCCACAGGCGTCCAGTGTGGGTTGCATGAAGGAA
GAACCATCGGAAGTGGCAACGCAGGGTTGCAAGAAAGCAAGCAGAGAGCGAGATTGTGGCTGTGATAGATATACTTGTAGCAATGCCAAGTGGTTGTAGGATTGTGTGGTACGTGGAATG
TATTTCCAGGGTGTGCAAGGTACCCCTGTTGTATACTGCGTCGCCCCCTCATGGTGGTGCGTGCACGCGTGCGTGCAGTCCATGTCTGTCCATGTGTCCATGTGTCCATGTTCGTTCATG
TGTTCATGTGAGTCCATGTTTTTCATGTGAAGAAGAAGTCTATACAACAAGCCCAGCACATCTTTCCTCCTTGGCGCGAGTTCGCCGAGTTGCCGACACCCTATTCAACACACGTCTTGC
GACAAGCTACCCCCAGTTCGGATCATCCTAACACGCTAGCGTGTGATATCACACGGGATCCCGAGGTGAGGTTAGCTATAAAAGGGTTCGGCTAGAGAAGTAGATCATGGAAGCCCTCGA
CCTCAGCAGCTTAACTGAAGAGGACCGCCAAGCATTATCGGCGCACATCAAAGAGGAAGTGGAGAGAGGAGTACAAGAAAAAATCAAGTTTACCGAAGAGAAGCGTCCCGCATCAGAGAG
CGTGGACAAGCCCCCCGATGGAGGCGATCCCCGGCATGCTCGGCCGGCTGGAACAGCGTTAGACCCGCAACCTGAAGACCAGCCACGATCGTTGGAGGACCGTCTCGTTGAGTCCTTCGC
GCGGGCAATGCGGAGGACCAACACCCCGGGGGAAGAAACCAGGGAAGTCTTACCCCCTAAGGACACCATCCGTGTCAGTCCTGTATGTATTACATGTAGCCCCATTTACGGGTGTGTTTG
ATTCTAGTGGCGATGTCCAGGTTGGAGTACAGGTTTTTGAGAGCCAATTTCGAATGTTGTTGTAACACTGGAGATGCCGAGCAGCAACACCATCAGCATGCGCCTACTAAGGTCGTAGAT
CCGCTCAGGCACGTGATGATCTGCTCACCGTTTCACGTCTGAAGTGGTTTTGGTATATGCTTGCATGCTTGTCTTGGTCGATTTCGTTTGGGTGTGCTCCGATAAACCTACAGCACACCT
TGTTGAGTTCTGCATACATACGCGTCATCATCAAGCACATGTTTTTCCTGAAAGGTACAGCAGTAGACCCATCAAAGGGCGTTCTTTTCTTGATAAGGTTGCCAGTGATCCACACAAAAC
TGCGAGGTTAAATGGATATTGAGTCACGTAAGGTTGCCAGTCACCCACAAAACTGCGAGGTTGTATGGCTACTACGCCACGTAAGGTTGCCAGTCACCCACAGAAACGGAAAGAATAGAT
GAGAGTGTCAGCGAATCCTAACCAAGCTGCTGCATATACCTTCTTGAGTGCTTTGAAGTTGATGGGAATATTTTGTCCCTCTTGTGTTAAAATATAGAGATTGATCTCCGACTCATTATT
TTTGCGTTCACGTCGATAACGGGATATGCGAAGGCGTCATGAATCTTTGCACCCTCTACCGACAATGAGTTGCGTGTTATGAACAGGAGTCTGTTGCATGTCCAGCGGTAGGAGTGGTAG
GGGGATACACTTGGAAATTTGGTCAGGGGTCTGTGTAACTGACAGGACTACATGGAAATGATCTCCATTTCGTACCAGAACACTGTATGCACGAAAGCAGCGCAGTGGTTGCACACCAGT
AAGAAGAAGATGTGTTGGGTTGTTGATCAGAAACACAGCTGTGTAAGCTCTAACATGGATCCAACATTGTTGTTTGCGTGACCGAGGAATAATTAACCTTGTCAGACAAATCGCAAGAAT
CGTTGTGTCACTTTTACGAAAGAGGAGTAATTAACCTCAGTCGTAGATTGGCGTTCGATTTGATAGGTAACCATGATGTCGTACAGAATGCGAAAGACAACGGTCACTGCTGCGCAGAAC
AGGGGGCGTATTGCAAGGTATTCTCCCCAGCAGTGCCACGTGCTAAATTGACGCTTTGGGTGACTGATTTTGCCTGTGCCTTTCCCTTTCGGATGCGCAATCTCCCCTGCACTGCCGAGT
CAATCCCCCCGGAGAGACAGCTGCACCCACCCCACCCAGGCGGATACGTGGCACCTGATGAAGCCTGAGCCGCGGCCATGCCAGCAGAAAAGGGTGGCCGCGGCAGAGGCGAGGGTGGCT
ACCGCGGGGAAGAAGCAGTGGCAGGAGGGATGGATGAAAGCGCTGGGGTTGATGGGCCGGCAAAAATACTTCGTGTGACCAATGGTGTGACTTTTCTTATTTCGTGTTCTCATTGTTTTG
GCTTTGGTTTGTGGTGCTTCGGCTTTGTGTTTGGTCTTTTTGAGTAAGAAGTCGAGCCTGAACGAGTAGGATTTTATTTTCGAGGTTTTCACAGGATGTTTGGTTGTGAACAGCGATCAC
AACCTGAGGGAGCAGGTGGTAGAGGAGATTTTATTCTTGGAAAATTGGGATGCAGGGACTTTGAAGACCTCGAAGCAGACGTACGCTGAAGAGTTGGGGATGGAGTTTGGGGTAGAGTAC
GGGAAGGAAATTCCTCTTCCTGTAGGGTTGAAGCTTTCAGAGTTTGACCAGGATGAAGAAGTGGTATCAAGGCCTTTTCGTGAGCTGATAGGATCATTGATGCGGCTGGCAACGCAAACG
AGGCCAGATATCGCGAACGCAGTGAGAGCGGTAGCACGGTAGTGTGCTTCTTCCAAAGAAATTCATTGGAGAGCAGGTCTTGGTATTTTGGGGTATGTGGTAAGGACTAGTGACTTGGGT
ATTTCATTCAGGAGGGGTAGTGTAGCAGGGTTGAGCATGGAGGTGTTCGCAGACGCAGACTATGCAAGTAAGGCTGCCGATAGGAGGTCTGTGTCAGGAGGGTTGGTGATGTGTGGGGGG
GGATGTATTTCTTGGTTTTCAAGGACGCAGAAGTGCGTTACGTTAAGCACGACAGAGGCGGAGTATGTCTCTCTTGCGGATGTGATGAAGGAAGTGTTGTTTCTGAGGCAAGTATGGCGT
TTCATGTTGCCGATATGCCGTGTATTCCGGTGTTCGAGGATAACCAGGGGGCTATTCAGTTGGCGCAGAACCCGATTAGCAACAGTAACTCGAAGCACATCGACGTAAGGCACCACTTTA
TCAGGGATTTGGTATGCAGGAAGGAGATTTCGATTTTTCACGTGGAATCGGCGTATCAACATGCTGACTTCCTCACGAAGGCACTTAACGTGGGAAATTTCGAGTTTCATCGTAACTTCG
TAATGAGTATGGATTAATATTTTGATGTTTGGGTTTATTTTGTGTGTGATCAAACAACTAGGGCGGCAACATTTTGCATTTTTGCCTATGGATTTTCTCAATGGATGGTGTTCTAGGCTG
GGGGGCAATTAGTTCACTGAAGCTCGAAGAAGTATATCTGATATGACCGGGGATGGGAATTGATGTCTAGCCAGTGAGGCTATTGTTCTGGAGTTGAGTTGACTTTCTGAGTTTATTTTC
TTGTGTTTTGGAGTTCTTGAGGATCGAAAAAGACATGGCATGGTCACAAGCAGGGGGGCTGATAGATATACTTGTAGCAATGCCAAGTGGTTGTAGGATTGTGTGGTACGTGGAATGTAT
TTCCAGGGTGTGCAAGGTACCCCTGTTGTATACTGCGTCGCCCCCTCATGGTGGTGCGTGCACGCGTGCGTGCAGTCCATGTCTGTCCATGTGTCCATGTGTCCATGTTCGTTCATGTGT
TCATGTGAGTCCATGTTTTTCATGTGAAGAAGAAGTCTATACAACAAGCCCAGCACATCTTTCCTCCTTGGCGCGAGTTCGCCGAGTTGCCGACACCCTATTCAACACACGTCTTGCGAC
AAGCTACCCCCAGTTCGGATCATCCTAACAGGCTGAGGCATTTTACGTCTGGGACTAGAGGGAGGCGATTCTGCCCCTTGCCTCCTGAGCGACGACGTGAAGTCAATGGCGGGGTGAAAT
GGTCGCGTAGATCTATTGCCGCCCCCCACCTCGCCAGTGATGGGTCCTGTGGGAACAACTCTCGGCCCTCTCGAGGACGCGCGACCAAGAGGACGCGTGACCAGTGTTGTAACAGCTAAG
GCATGCAGAAGCTGAGTACGCCCCCCCCCCTACCCTTGTTTTCCCCCGGTTGCTGTACGTTGCCAATGCCAGGAGCCGGCGAGCGTGCGTGTCGTCCGGCCCCGAGATGGCCCTGATTTC
GGTCGCGAGGCTGACAGCCGGGGCGCTGTTCCCGAGCATCTTCTTCTGCGTGCTCTCCAAGTGCTACGCCACGCGCTACCTCTTGCACCACAGCTGGCTGACCTTTATCATCGACTTCGA
GCCTTCGCACAAGCTCCACACCT
GTGAGTTTTTTGTTTGGAGGGCGCGTGCCCTCGATGCTTCCGCCGTTTTCGGCGTGTTTACAGCCCTGCGCCTTTGTAATCGGTCTCTCGCTCGCTC
AAGGGTTGTCGCGAACCTCTCGGTAAGTTTCGTGGAAATTTCTTGGTGGTTGTGGTAGCGCTCGGTTCCGTTCGTGTCGGGGTTGGGGTTGTGGCGGCGGCGACAGTCTTTGGTTTTGGT
AAGTAGGGCAAGGGGTGACGCGTTGTGATTCAGGTATAGGGCACAGACGGTGTTTCGCTGACCACTTTGGAGCATGTTCACGTCCAAAGCAGCTCCATTGTTCAACGAGTTTCTCGTGTC
ACAAGAACACAGGAAGGCATACCAGTAGGTTATCCAATCTTTTGGGGTTGTGTTTTTCCCATTCTCTAACCCTCTGTCTGCCTGTCTGCCTGTCTGTTTATCTCTCTCTCGCTCGTTCTC
TCTCTCTTTCTCTTTGTCGACAGACTTCGGAGTGCTGATTCTGCTCTGCAGTGTCGTCCACAGCGTGTGTCACATCGCGGTCGGCGCCCTGCAACGCCGCGCGGACCACGCCTTCAAAGA
CGAGATAAACCGCTCGGGCCTGGTGGCTGTGCTGCTGCTCTTGCCGATAGCCCTGCCCATGACCATGCGGTTGGCTAAAACAAAA
GTGAGAAGTCGTTTTTCGTGCTGTCTTTGCTCTCT
TTCGCGGATATCTCCCGGTATCGTCTTGGTTTCCGAGCGTTGTGACACCCCAGGTCCCGCAAGAGGTTTACAGATCTGTGGCTCTAACCGGCTTTTCGCTGCCCCGTGTTGTCCCCGTTG
TTTCGCACGTGATAACGAAACACCCCAGCTCACGTTCGAGGCGAGGAAGTACCTGCACCTGCTGTTCATCCCGTTCATGATTGCCGTCTGCTTCCACGGGAGGGCGCTCCAGATCCTGGG
CGCCATCCTCCTCGCGTGGTACCTGCTGGACCGCTTGTACTTCACTACCAAGAT
GTCAGTGTCGCCGCCTTAGGCACGTGTTCTAGTCCCTTTTCTTTGACTGGTGATTGGTTGCGCTCC
TTCTAGCCGTCATTTTTTTTATTTTATTTTTCGAGGAAGCCATGCGCCTGGTCACGGGTGAAGAAGTAGTGGCGTCCCCGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTTTTCGAC
GGGTTTCCGATGACACACCATGTTGGGGTCGTCCGCCGGCCTGTCCTTGAGGTGACGTGACGCTTGTTGGCGTCGGTGTACCGACAGTTCATGAGCGTCTTCCTTCGTAGATCCGTCTAC
GCACTCCAGCTTCTACCAACCCCCCCCCCCCCCCCAAATGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGGGGGGCAGGCCAACAGGCACCACACGGAAGCAGCAGGGGGGATGGAAACCCCCCCCCCCCCCCCAACTGCCGCTCGCCCGCCCGCCCGCCCGCCC
CCTATTCGATGGAAACCTCGCAGGACTTTCCTTCTGAGCTCGCCGGTTTACAAGCCGGTCGGGAGGGGCACTCTTGTCCGGTTCGAGCTTCCTCCGTGAGTCAGGGTCCGCCGCTACGCT
CGGCGGACTTGCTCCTCGTTCCTGTCTGTGTTTGTTGTTACACCTGTGTGTATGTTGGAAGTGCCGGCATCACCCTTTTGTTGTTACGTCTGTCTGTGTGTTAGAGAAGTGTTGGCGTCA
CCCTTGCCTGTGTGTTGCGGTTCTCGGGATGGTTCGCCCGTCGACTGGCGGCATGCTGCTCGTGCTCCTTTCCCCCACCTGAAACCGGCCACTATAATTGGGGTAGAAACCTGGCGGGGA
AGTCTGCGAACTTATCGTGGGTGACCGTCATCGACAAGAGGATTGTTACAGGGGTACACGCACGTCGTAGAGTTCGGATTTGATATTCGTACCTCATGCCCCGCCACTATCCCAAACCTG
AGCATTGACGAAACACCGGATACATGACAACAACACGCCCACCTGTTTAGTCTAGGCTTCGACCGACTTATGGTGCATCGTCTCGATTTTCCGTGTTACTTGTTCGTGGTTCGGCAGCGG
GTACCAGTACAAGCCCGGCGCGTACGTCCAGGTGAATTGCCCGGCGATAAGCGTGTCCGAGTGGCACCCCTTCTCCCTCTTCCCGGTGCCGGGGTCCCGCCCAAGAGCGGGTTTCCACGT
GGAGGCG
GTGAGTGTGGAGGATAACGAAGCTTCTAGTAACGACCAACGACGAGGACGTGCGTGCTCTCCCATAACAGTGGGTGGGTACCGGAGATCTGTTCTACGGAGCCCCGGTTATTG
TACCCCAAGAAGGATGCATTTCGAACTCTTTCCCTTGTGCGAGAAGGCGTGAGGTTATTACATCGACAAGCTTAACTTTTCCGCATTGAGGTGTTGTAAACGTAGCCGCAAGCCAGACAG
ACACACGTGTGCGGGGGAATCACGTGCATTGCTGTAGGGGAACCTCTTCCGCGAGACACCGGCGAAACTTTCCCCCTTCGTCGGCTGTCGAGGGATGGAGTGTGCATCGATTGGCGTTGT
CGTTGCTGTCTTCCCTCCCTTCAAAACGGTAGGCCCTCTCTCCGGGCCGCTCTTGTATCTGAGGGTGGTACGTACGTACGGATATCTGTTTCGATGTTGGGCCTTGTACTTTTTGTGATA
GTTTTCCGACCCTGCGTGTGCGTTTTCTCTCGATTTTTTTTTTTGTAGGAGTTTTGTGCGCCCCGCGAATGACTGAATCGCATCCGGTGGGCGACTGGACGATTGATTGTTCTAAATAAC
TAGTAAGAGCGCTTGTACGTACGGCTTCAGGTGGGCGACTGGACGAATGAGATGTTCCGGTTCTGCCTCGAGAACCCGCAAATGCCGCTGTGGATCACGGCCGCGCAGCCCAGCGTGGTG
GAGAAGACCATGTACTTCGACAACG
GTAAGAACGCGGCGTCGATGGGGGCTTGAAGACGAATCGAGCGATGAAAAAGCGGATCGTGTGTGTGTCCCATGTCACCCCGCCCGCGCAAGGAG
GGCAGCAATGATGATAGCGTGCAGAGGCAGGCTTTCTCGAGACACAAACGCTTGCCCGGAGGACTGGACATTAGCGTTGCTCATGGACAGGGAACAACTAAGCCTGCCCTCTTCTCGCCA
ATAGAACTGGTGGTGCCATCCATGTAATTCAGCTGCCTGTGTTTTTTTTTATCGTCGAGGGGTTCCAACCCTTTTAATGGTCACCGTCTTCTGACAGCAACTCCCCCCCTGTGGCTGCCG
CGTCCTTGCTGTGTGTTTCCTTTTGCGCTGCTGCTGCTGCTGCCGCCGCCGCCGTTAACGAACGGTCGGCTATCCACCGGACCGAACGCCGCGAAGTGTTGCTCGTCTGTACTGGAGCGG
GCATCACTCCTGCCGTATCCGTCGCTGAGAGGTGACCGTCTATCTCGCTCTATGCAAGACCCATTAAACTGTTGAGCGAAATTCCGCTGCGAGCTTACGCTAGGATTGTGCCGCATACCA
CTCAAGAAAACACCCCCCGGTTGATATCTAACGTTTTGGCTTCTTAAGTTTTTTTTTTTCACGGGGTGTGTTACTGTGGGGAGGGGGGGTGGTATCTTCTGTCGCCGTATTGCATGGTTC
TGAGAGTTGGTCTATGTTTTGGGCTCATGTTGACCCGCAACATGTCTTTCGGGCGCCGTCATGTGCGCGCGCGCCGGGGGGGGGTGTTATCTCGTGTCATATACGACACTCCAGAACCGA
GCATATCGGAGGCAATCGAGCTTGAACCAGT
GCAAGCGTCCACCGTCGATGACGTTGATTGCGGTACACTCATCCCCCGCTCAACAAGGACCATCCGCTTCGACGCAGTGCGGCGCGCTA
CTACTATAATAACATCTAAAAGTTGCTCCATCGAATGGTTTTGCGGGTTGGCCTTCGCTCTTCCGGCTCTTGTTTTTGAAGTATTTTCCCTGCCGTGAGCGAGTGTGCATCGTCGAGATC
CGCGTCTCAGCGGTTCGAATATGCTACAGGGAATAGCATCACGAAAGAATGGGTACTGTGCATACCTCCCCGGCGTTTCTTCCCCCAAGGGTTCGGGGTTTCTCGCTTTGAGTCTTGGTT
TCTTAGCGTCATTGCGAACGCCACACACCGCCATCCGGTGCGTATGCATGTGTGCGTGTGACCAATGCTGATGTCCTAATGCACAATCTGATGCGTCTCAGGTTCCAGAAGAAAAAGAAC
ATCCACCTCCTGTGGTGCTGCCGCGACGCGGGGATGGTCGCCATGTTTGAGAAACAG
GTTTGTGTAGTGTGTTCGTGTGTTGTTGTTATTTCGCGTTTACTCCGAACCGATTACACCACC
AACACACCAAACCACTTAATGGATTTTCATTGGCATTGACCGCGCTAACCGGCCAACTGATGAAAATTCGTCAGTCTCGGTGCGGCTAAAGTCGAAAAGCGCTTCGCCATGACCCGAGAG
GCTTGGCTATTCTCCGGATTCTAGGACAGAAAATGCAGCAGATGAAGAGAGACGCACATGTGTCTACCGAGTGTATGTGGGCGTGCTTATGTGAAACAGGTGTTTCGTGCCGTGTCCATG
GACGCCGCAACGGACCAGACCCTCCGTTACCGGTGCTCTCTTCTTGGGGGTATTGTTTGGGAGAAAATCCCGGTGTTGGATAGACCTTCCATCGGTTTTTCCGCCGGAGCAAGCTTAAGT
TGGTGCTCGAAGAACGGGTAGATTATTTTCCTCTTATTAGCTAGAACGCGAAGTTTGTGGTGGGGACAAGGTAGCCAGCGCAGCCAAGGTGCTGTAGGCTGTACCCGTGTTGGGAGGCGT
AAGAACGTTTGTACGATAACCCGTAGTTGGTTGGCCAGGGCGTGCTCCTGTCGGGTACACCTCTCTCTTGTTTTTTTTTGTGGTTGAAGTATACTTCCTCGGCCAGCTATACCTTCAGTG
TCCATAGATTCGGGCATAGCGTCGTCGGCCAGCCATGTGGTTTCATGTTTTCATGCCGAGATGTTCTCGGGAGGGGATATGGATCGCCTCGCGGACCGCTGTCTGTCGCGCCCCCCGCCG
CCGCCCACACAGCGCCCCCCCCCCTCTCGACCCCTTCCCTGGTCTGTCCACCACCTCCTCAATCAATACTGTAACCGCCGAAACACAGTTGCGCCGCGTCAAGAGCACCGTCTACCTGAC
CGGGAAACCGACGAATAAGACGAAGAAGCGGATGGTGGACCTCCTCGCGCCGTCGAGGAGCGACGTCGTGGCCGCCAACGCGGGCACCTCCACCTCCAGATCGTCTTCATTGCGCGGGGA
CCCCGCGTGCGCTCTCGAGGACGGGCGCGGCGGCGGCGGCGGCGGCGGCGGGCCAGAGGTCTCGAACCTCAACGCAGACCTGGACGACTATCTGGGAGTGCTGAAGGACGACTTCGAGGG
CAGCGGCAGGACGGAGCGCGGTTCGTTGGACAGGGATGACGACGGCGGAGACGGGTCGGTGATGGGGTACTCCGCCTGGGGGGGCGATTCCATCCTGGGGGGAGGGGAAGGGTCCGCGCT
GGGGGTTTCTTCTGCGCACGGAGGGAGCGCTCTGGGGGGGATGGGGCGCACCGAG
GTGTGTTGGTAGTTCGCGAAGAGTTGTTCGGTGTGACGGAGCATCGCCCCCATGGTCTTTGGTGG
GTGTTGGTTGCTTTTCCTCCGAATAGAACGGTATGAGAAAATAGTGACCGAAGAGCAATAGAGTTGCAGGAGCTTGTGGACGTGGTTCTGTTCCGGTAACGTGTGTGTATCGCGCCTTCG
GAGAGCTCTCGTGGACAAACACAACACCTATCTACAACCCTGAGAAAAAGATGAAAAAAAAAAACTTTCGAGGGGAAGATTCGGCAAGAGGGGATATTGCCCTGCGAACTTCGTACTACG
CCCCACTGCCGGTTTTCGACTTCCGTAACAGGAGGCATGGTGATGCAAAGCGCTATTGAGCAAGCCCTTCCCTGATCGTTTGTTTCTCGCGAACGCATGCACACGCATGCACGTTCTTCC
CCCAGGCTGCCGCCGCTCGGAGAGAGGAAGAAGAGGAACGAACAGCAGCGTCGAAAAAGCGACACCGCGGCCAACCGTCCGCCGGCCAGCTGCAGCGCGCGCGCGGGTACCACCCGGTAT
CGCTAAACTTCGGGAGGCCCGACATCGCAGCGTTCATCACGGGCACCGTCAGGGGCACCGCCGTCGTGGCCCAGTGGGCGCCCCCCGTCGATTCGCGGCCGCCGGCGCCTTCGTCTTCGT
CGCCACGGCAACAGCCCACCGCCGGCGGGTTGCGACAG
GTGTGCGTCTCGGGAGTACAATGCGTCTCATGCTGCTCACGGTGGTTGGTTGGTTCGGGGGGGTGGAGACACTCGGAGAGTC
ATCAGTACCTGCTGTTTGTGGCAGGGATTGTTGGGGAGTTTGATACACACGCTCTCACTGGCTTTGCGTACCTTGGCCGTTCCCGTGCGTGCTGTAGAGTTGATGGCGGAGAAAAGGGTG
GTGACACGTGAGCGGAATATATGCATACCAGATCGCAGATTTAGCGACGGCCACACAGGCCAAGGTCTCATGCGGCGTTCCACGTCGTTCCAATGCGCTCCGGGTACGTTCATAGCTGTC
CTATGTGTCAACGCCTCGTAACTTCGAGGTCTCGAACGAACGTTATCAGTGGTGAGTTCCTCCCCGTGACACCCATTGCGTCCTGGGCCGTACCAAGCTGAGTACCAGGATCTTCTTCTT
TCCTTGAACCGGCTTGTGTGCGCGTGTCTGTCTGACTGTCCAGATGCTGACGAGGCTGAACACCGGGCAACGCATCTCGAAGAGGGACCTGATGGAAGCCGACCTCACCGTAGTGGACTC
CAGCCTTGCCAAGTCGAAGAAG
GTCAGCCTTTTCCCTAAACAATTGTTGAGAACGTAGCCTCGGAGGTTTCCTGACGTTATCCTTTCTGGTGCGAATGGAATAAATATTGATATGGACAG
AGCAGTAACGGCTCAGGCGAGCTCATCGCTCTTGGAAGAGTTGATTGATGAGGTGTTGCTTTGCTTTAGGATGGGGAAGGGAGGGCTTTGTTGCAGCTGCTGCGTGTGCGTTTGTGTGCA
TCGCGATCACCGAGGGAATACCTTGCCGCCCCTCAGGTCCCTATTGGCACGAAAATCGCCACTTTCCGGGCCATTTCGAACGCCAGTTCATCTTTTGAATGCACAGGTCATTGGTCTATT
ATAACAGCTTGGCATGCACCATATGGGCACGCTCCCCCTCGGCTACCCAAGGGGTGCTCTGCTCAAGGGTGTGCGATCGTCGCCTCGGCCTAGAACGCAAACGCTTCCTTTGGCCAGGAG
TTTCTAGCGTACTGGCCCTCGTGTCTCGGCCTTTAAAAATCCCGTTTTGTCCCCCCCCCGTTCTTGGTTGTCTCATGCTCTGCGTCATGGCCGCTGCGCGCAGCCGTCTTCCGTGTCCGG
TGTAACCGGGTTCGATATGCCGAATTCGGACATCCCCAACAATGGGTCCGTCGGCTGTGTGGACGAGAAGAGTTGGCTGGTGTTGTACTGCGGCGCCAACGGCAAGGTCGAGCAG
GTGCG
TTGGGTGTGTACTCATAGCCATGCATGCCGTAGTCGCTATACCATTGACCACACATCTCTGCCAATCCGGGAAAGAGCACGCCGAGGTTTCACCGGACCAGGCTATGTCATCACCAGGGG
CGAAGCGCCGCGAGGTATTTGGCGAGTCGCATGGAGGGTGCGCTGCATCCTGCTAAGGGTGGTTCGGCGTGGGGACCAATGAAATGGCCGCCGATGCGAAGCGTTTACATGGGGGACGGG
GGCAATCGTGTTTGCTCTTTGTGTGACTTGATGATGAGAAGATAGTTGGGGGTGCCGACGTATGCTTTTTGAGTACACACCGGGAGGTGCTCTTTGTGTGTGAGGGTCCAACAGGTGTGG
ACAATCTTGAGTGTTTAGTTGCAGACTGCAAAAACGCTGGTGCTGCTGCTGCCGCGCCTCTTCCTACTACTGTTCCCATCTTCAGGCTGTGCAAACAGCGAGTGAGGGGCTCAACGTGGC
ATGGCGAAAGGAGTACTTCTCCAAGTGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTCTGCCGGACAGGAGGGCTAGCAATACCGACGACCTGGAAATGGGCAACCATACCAGGTCACCGTCGCTGGAATCCGGTTCAGCCCACGACGGCAGCAGCTTCAGCAGCAGCAGG
TACGGCAAGAACAACCGCGGCGGCGACGGCCGTGCCAGACACCACCGCACCCCGAGCTCCGCGGGCAACGTGGAGAGCACCCGCAGAGAACGCTCGACCCGTCGTGCCACCGACGGCGAC
GGCAGTGGCCGCGGCGCGCCCGGCCACGGCAGACGGCGCAGCGGCAGCCACGGCAGCCGCGGCAGCCGCGGCGGCGGCGGTGGCGGCGGTGTCGGTGGCGGCAGCCGGAGCTCCAGCCGG
AGCTCCAGCCCGGACGGCGGCGACCGGAGCGGCCAAAAACACCGCCGCGGTGGCGACGGCAGCGGCAGCAGTCGGGCCAGAACCCTCGGAGCCGACACCGACAATGACGCGGGAGGACTG
CTGGAGGGAAGCAGCTACTCCGGCATGTCCGGGATGGTTGTCGTCGACCGCAACAACAACGACCGCGGCGCGTCCTCGAGAAACATCGGCGGCGCCGGGAAGAGCGCGAGTGGCCGCTCA
GTGGGCGGCGGAGGCGGGCTTGGTGCCGATGGAGGTGGTAGCGGCATGGGCGGGGGGGGGCAGGAGCCCGCGGTGCAGAGGAACGGGTGCATGAAAACGTCGACGGCGTTGAAGCTG
ATC
ACCCTGGCGATCGCGCTCCTCAACGTCGTGGCTCTGTGGGGGTGGCATTACGATACGCGGGCGGGGAGGCTGTGCTCGATCAG
GAGCCGGCGAGCGTGCGTGTCGTCCGGCCCCGAGATG
GCCCTGATTTCGGTCGCGAGGCTGACAGCCGGGGCGCTGTTCCCGAGCATCTTCTTCTGCGTGCTCTCCAAGTGCTACGCCACGCGCTACCTCTTGCACCACAGCTGGCTGACCTTTATC
ATCGACTTCGAGCCTTCGCACAAGCTCCACACCT
ACTTCGGAGTGCTGATTCTGCTCTGCAGTGTCGTCCACAGCGTGTGTCACATCGCGGTCGGCGCCCTGCAACGCCGCGCGGACCAC
GCCTTCAAAGACGAGATAAACCGCTCGGGCCTGGTGGCTGTGCTGCTGCTCTTGCCGATAGCCCTGCCCATGACCATGCGGTTGGCTAAAACAAAA
CTCACGTTCGAGGCGAGGAAGTAC
CTGCACCTGCTGTTCATCCCGTTCATGATTGCCGTCTGCTTCCACGGGAGGGCGCTCCAGATCCTGGGCGCCATCCTCCTCGCGTGGTACCTGCTGGACCGCTTGTACTTCACTACCAAG
AT
GACTTTCCTTCTGAGCTCGCCGGTTTACAAGCCGGTCGGGAGGGGCACTCTTGTCCGGTTCGAGCTTCCTCCCGGGTACCAGTACAAGCCCGGCGCGTACGTCCAGGTGAATTGCCCG
GCGATAAGCGTGTCCGAGTGGCACCCCTTCTCCCTCTTCCCGGTGCCGGGGTCCCGCCCAAGAGCGGGTTTCCACGTGGAGGCG
GTGGGCGACTGGACGAATGAGATGTTCCGGTTCTGC
CTCGAGAACCCGCAAATGCCGCTGTGGATCACGGCCGCGCAGCCCAGCGTGGTGGAGAAGACCATGTACTTCGACAACG
AACCGAGCATATCGGAGGCAATCGAGCTTGAACCAGTGTTC
CAGAAGAAAAAGAACATCCACCTCCTGTGGTGCTGCCGCGACGCGGGGATGGTCGCCATGTTTGAGAAACAG
TTGCGCCGCGTCAAGAGCACCGTCTACCTGACCGGGAAACCGACGAAT
AAGACGAAGAAGCGGATGGTGGACCTCCTCGCGCCGTCGAGGAGCGACGTCGTGGCCGCCAACGCGGGCACCTCCACCTCCAGATCGTCTTCATTGCGCGGGGACCCCGCGTGCGCTCTC
GAGGACGGGCGCGGCGGCGGCGGCGGCGGCGGCGGGCCAGAGGTCTCGAACCTCAACGCAGACCTGGACGACTATCTGGGAGTGCTGAAGGACGACTTCGAGGGCAGCGGCAGGACGGAG
CGCGGTTCGTTGGACAGGGATGACGACGGCGGAGACGGGTCGGTGATGGGGTACTCCGCCTGGGGGGGCGATTCCATCCTGGGGGGAGGGGAAGGGTCCGCGCTGGGGGTTTCTTCTGCG
CACGGAGGGAGCGCTCTGGGGGGGATGGGGCGCACCGAG
GCTGCCGCCGCTCGGAGAGAGGAAGAAGAGGAACGAACAGCAGCGTCGAAAAAGCGACACCGCGGCCAACCGTCCGCCGGC
CAGCTGCAGCGCGCGCGCGGGTACCACCCGGTATCGCTAAACTTCGGGAGGCCCGACATCGCAGCGTTCATCACGGGCACCGTCAGGGGCACCGCCGTCGTGGCCCAGTGGGCGCCCCCC
GTCGATTCGCGGCCGCCGGCGCCTTCGTCTTCGTCGCCACGGCAACAGCCCACCGCCGGCGGGTTGCGACAG
ATGCTGACGAGGCTGAACACCGGGCAACGCATCTCGAAGAGGGACCTG
ATGGAAGCCGACCTCACCGTAGTGGACTCCAGCCTTGCCAAGTCGAAGAAG
CCGTCTTCCGTGTCCGGTGTAACCGGGTTCGATATGCCGAATTCGGACATCCCCAACAATGGGTCCGTC
GGCTGTGTGGACGAGAAGAGTTGGCTGGTGTTGTACTGCGGCGCCAACGGCAAGGTCGAGCAG
GCTGTGCAAACAGCGAGTGAGGGGCTCAACGTGGCATGGCGAAAGGAGTACTTCTCC
AAGTGGTGA

Retrieve as FASTA