Entry information : EsilFRO01 (Esi_0492_0011)
Entry ID 16966
Creation 2021-02-02 (Christophe Dunand)
Last sequence changes 2021-02-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilFRO01 (Esi_0492_0011)
Name (synonym) EsilFRO01 (Esi_0492_0011)
Class Ferric reduction oxidase    [Orthogroup: FRO001]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilFRO01
start..stop
S start..stop
AgluFRO04 83 1e-16 144..713 186..724
LeFRO04 76 0.00000000000001 144..471 180..478
AgluFRO01 74 0.0000000000001 144..505 171..492
BdeNOx03 73 0.0000000000001 151..591 95..521
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 60280..60707 428 N° 2 56628..57042 415 N° 3 55944..56026 83 N° 4 54520..55003 484
N° 5 53725..53898 174 N° 6 53096..53228 133 N° 7 52564..52757 194 N° 8 51476..51754 279
complement(join(51476..51754,52564..52757,53096..53228,53725..53898,54520..55003 ,55944..56026,56628..57042,60280..60707))


exon

Literature and cross-references EsilFRO01 (Esi_0492_0011)
Protein ref. GenBank:   CBN80509.1
DNA ref. GenBank:   FN648699.1 (60707..51476)
Protein sequence: EsilFRO01 (Esi_0492_0011)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   729
PWM (Da):   %s   79715.53  
PI (pH):   %s   8.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDKWQFDHTCMLLPMGGPTTTGVALVSLRFLASAVLLYSVFYLAMARGTWYREHFFVNDELDYDISSGANMSTSQNQRALFLLLLPVVAAALGGIYQAVWKYREGKATQDGLPASSSSKVQSFLKAYNSIIHFQFRPLGKLSPLSVIAAYFGFAASCHFAVILIPVARDSKLWSAVGIPFERAVLYHVIAGHLAFATMFLHAFLFLSSCVWENGWRHAWEVSTLQANDDYGDVDVPMGWAAGLCALPMWITSVNYVRRRWYSLFKASHWLFIGVFIFGALWDTNAIYFGGGLALYIMHVMSRLSAWKRWRYWNRWLKPAESPSPTSLLDVHTTENYTRLVLKNPKCDEPARGGSFVYISVPGALGTDEAHAMSVALRGSPPPSSFKTSVAPLSVPQEEIFTLYVKDLGPWTKALRRAAGNVADPGALLVDVDGFYSQVASFNTMMKRGASRVVIIAGGSGVTSVMGFIDWCVVAAAGSVVPEVHLAWCCRTMVEMQLVGESIPSMLASAGSKKGSHFTLSLYCTSKTGTDPLSVSWPVNCNAYGGLSMEQVMGKNPIAASLNHSVRILLAGGAAYGAYVLGTFDVARRGERGYHSGGTRLVLMIVCIVSALIVYDWLAYFVLTFPCKDSGFSSATHPSYASKAAVIHNEPKQDALESSATTAYDVLRQRVPTRALLVQEAELAKKKGHRSVKVLTSGPQALVDGVLADARAVDWQLFDTEELSYQF*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACAAATGGCAGTTTGATCACACGTGCATGCTGTTGCCCATGGGCGGGCCAACAACAACCGGCGTGGCTCTGGTGAGCTTACGCTTCTTAGCTTCCGCCGTGCTCCTGTACAGTGTC
TTCTACCTCGCGATGGCCCGCGGCACGTGGTACCGCGAGCATTTCTTCGTGAACGATGAGCTCGACTATGACATATCCTCGGGGGCAAACATGAGCACCTCTCAAAACCAGCGCGCACTG
TTCCTGCTACTGCTTCCCGTGGTGGCTGCGGCTCTCGGCGGAATCTACCAAGCGGTCTGGAAGTACAGGGAAGGCAAGGCGACACAGGATGGTTTGCCCGCATCGTCGTCTTCGAAGGTT
CAGAGCTTTCTCAAGGCGTACAACAGCATCATCCACTTCCAATTCAGGCCTCTGGGGAAACTGTCTCC
GTGAGTGCTTTCCTGCTTGATTACAGCGGTAGCGTGTGCTGTAAGCGCGTAC
AACATTTGCATGCTCATACATACATGCGCTTGTCATGGGATTTGAATGTTGGAAGTTGATCGTGTGAGTGTAGCGGGTTAATTAATTCTGCGTGCAACTTGCAGGCTTGTCATGGAATTT
GAATGTTGGAAGTTGATCGTGTGAGTGTAGCGGGTTAATTAATTCTGCGTGCAACTTGCAGGAGTTTCGTCTCTTTTGGACAGCAGCAGTGCAGCTGTTGCCTTGCTTTGTAGACTGAGA
GAAAGGGGGAAGGGATCGCTTACGCGCGGCTATCACATTTTAAACGATGCCCTTGACCCGGTCGTCATGCATGAGTAAATAGGTAGACACAGGGGTGTAGGTGAAAAAAAATGTATCCAA
GAGACATACATGTAGACCGGCTACAAACCGGAAATCGAGGTCCGTAGTGTGTATGTGTGTGTTTTTATTATTGGCATCGACCGAGTGTGTGTGTGTGTGTCTTTATGTGTGTGTGTGTTT
ATTATTAGCATCGACCGCGCTTACCGGCTGGTGGCCATTGGAAAGACGTCAGTCTTAGTGCGGTTGGAAACACAAGACACTTCTATCTGCCATGAACTGGGACCCCGTTAGGGGGCAGCA
TGGGGGAGGCTAAACTATCCTTCGAAAGACAGAAACGGCTGCAACAGAAGAAAACTGGACGCGTCTACCAAGGCTATTACCTTGTACTCTAATTCGTTTAGGAGTACTTTCACCATTCAT
TATCCTCCTTGTTTTCGCTACCATCATTCTGATAATCATTTTGACAACAATCTCTGGGCAGTTCTTCCCTAGCCCTGTTTTTTTGGGGGGGGAAGGTCATCTGGCTCAAACCCTTTGCTC
TCTTCCACTCCTCCTCCATGTTTTCCTCTTCCATCGTCGTCTTCGTCCTCCTTTCTTCCCTTTCCCTTTCCCTCGTCTCCGTCACTCCCTAAAGAATTACCCTCATTACTATCGTTGTCG
CATAGATCCCAACCGATTGGCCCTGGTGGAAGTTGGTCGATCAGTAGCCCATGACGTGTGTGTGTGTGTGCGTGTTTTTTTTTCCGGGGGGGGACTTTAATTTCTACATTGTTACGTCAG
GGGCACTGCTGCTGTCGATACAAACTCTGCCGTATGCATAGGGGGGTCAATGATTATGTTTCGTGAACAAAGCCCCCTATACTAATTCCAATATAAAACACAAATCGAAATTGCCGCCCT
GGAGGGGGCTATGTGTCCGGATTTTTTTTCACATAGACCCTTGGTCGACAGGAAAACGAGCAGCGTGAAGCCACTGATCATTGATACTATTTGACCTTTTGAGTATGGACGTGTCCACGG
ACGTCCGCGGACGTCCGAGGATGTGCCCGCAGGCGTCCTTGGACACCGGAAAGATGCCCGTGAAAGATGCGCGTGAAAGATGTCCGTGGACAAGTGCATGGTCGTCCACGGACAAAATGT
AGGTGGACCAAGGACGGTGGTCCACGTCCACCGACGACGACGCGTCCACCGACGTCCATGGACACGTCCACGACAAGGGGGGGGATAGGCCCGGGGAAATAATCAGAGGCGTTCGGCGGG
CCGCCGCCGCCGGAGACACCCTCCGGAGGGGCCTCCCTCCTGAGGGAATTTTTTTGGGTAAATATACAGTAGTAGTAGTAGCACGCGCCATTTGCGTCACTCTCTGCCGTAAGTTCAGTG
CACACGGGCAACTTCAATGTCTTTTTGGCGGCCCTTGTGCCGCTACTATTGACTGCTGTTCCGATGTTTCGTTCTGGTGGGTGAGTGTGTCTGCTTCGGGAAACACCCATCAAAATCAGC
TGACACACATTGCGGGAGGGAAAAACTAAAGTAAAAATGCTACTTGCATTTGTGGAAGAAAAGGAGCACATAAAAAACGGGATGGGATCATTAGAAAGTGCCACCATACTTTTCTTGCAA
ACAAGGAATTCCCATCTTGTTGCAACACAATAACATCTCTCTGTTTCTGGCACTTACTGAAGTACCTTATCATCCGGCTCAACCGCGCGTTCCCGAGATCCGTCACTTCGAAATGCGAAA
CTTATCCATGATGCTGCACAGCAGGTGGCGGCTTCCTGTCTGCTGAGATAGGAAACAATGCGGTCATCGTTGTGGGGCCATCATTTTGCGCAGGCCTGCTGAGCTGCCTCCACGAGAGTG
CGGCAGCCAGCCAAACAGCAGTCAATGCCACTTGCTTGAAATTGTTTGAAGCTGTTTTTCGAGTCTAACGAACGTGTTTTCTGTCCATGCTGTTGTGTTTGGTCGCCACCAAATTTCATG
ATTCAAGAAAGTGTACACCGAAAGCAACCAGCTTGCACCATCAGGATTGCAAAAAAGCCAAGCAGATTTCTAGACCCTAACCTCGAATGCTTGGCCAGGCTGGACAGTACAAAGTCTCAC
CCGAGGCACCGCCGAACCACCGACCAAAATGTTGATTTTTTTGCGCCGACGTCTGGACTGACGTCTCTGTTCACGTAGGGAGGGGGCGACAACAATTTTGTCCTTAGTACAACAAGCCTT
ACGTTCTCCTCCTCACTCCTTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTCCCTACCTCCCTACCTCCTCACGGTCCTGTTTTTTTTTCATGGACGGACCT
CGTTGTTCCTCGCCTTCCGTCTTCTGGTTCATCTTCTGCTGGCCTTCTTCGGCTAGATGGATGAGTGTGGGAGAGTTCGCCATTTTGTTGCTGTGGGTGGGAGCCATGGCCTCTCACTTC
TGGCAGGGTGCATACCGCAGCATACAGAGGTACCACGTCGGCACCGGCCCCTGCCCTGACGATCCCACCTCCAAGTGCTTCCTCGACACCCGGGGCGACCCCGAACCTGCCGAAACAGCC
GGCCAAAATAGGTACAGGAAGCCTTGTCAGTTAACGTATTGGCGCTTGGTCACCTGTGTTGTCCCTCATATATTAACAAAAAGTTTATCGTTCATTCAGACCTGGTGCTTACCAGTTAAC
TACAGGGTATTCATGTTTTTTTTGTCGCTCTTCTCCACCTGACGGAAATCTCGGCGTGCACGGGCTGCCTATCGTTCTCATATGCAAGTATCACCGTCTCCTTCTCCCTCTGGCTTACCC
GCCCTATCTGGCACACGCGCCCGCCCACGCGCCCGCTCCGTCCGGTATACGCTACCCACATGCAGGCTGTCTGTCATCGCCGCGTACTTCGGGTTCGCGGCCTCCTGCCACTTCGCCGTC
ATCCTCATCCCCGTCGCCCGCGACAGCAAGCTCTGGTCGGCCGTCGGGATCCCGTTCGAGCGGGCCGTCCTCTACCACGTCATCGCCGGGCACCTGGCCTTCGCCACCATGTTCCTGCAC
GCCTTCCTCTTTCTGTCGTCCTGCGTGTGGGAGAACGGCTGGAGACACGCGTGGGAGGTGTCCACCCTCCAAGCCAACGACGACTACGGAGATGTGGACGTCCCCATGGGGTGGGCCGCG
GGGCTGTGCGCGCTGCCCATGTGGATCACCTCCGTCAACTACGTCCGTCGCCGCTGGTACAGCCTGTTCAAGGCCAGCCACTGGCTGTTCATCGGCGTCTTCATCTTCGGAGCCCTGCAC
GTGAGTGTCTTGATATCGCCCGTTTTCCCTCTTGTTCCTTCGGCGACACCATTCACACTCGAGAGTGAGTGTGCTCTTTTGGTACCGCACAGGGAGATGGCCAGCAGATTCCCCGGTGGG
ACGACCGGTCAGACCCCCCCTCTTGTTTCCGAACAAGTTGCTTCATAGATTCCGAGTAATTCGTTGCCCCAAAACGACGGATCACAGCAGTCCTGACGAAGAGTTGAGGCATGCATTGTG
GCCCAACATGATTGCGTGCTACCCAAGCTGCCGTAAAACTGCCAGTGAAGGAATCACCGGTGCGATCGGTTTTTAATCCTTTTAGCCCTGGGCTTGTTTCAGCATCGATACCTTCCGGTA
TGTACGTCATTGAATGAAACACGGCGCCCGAAACGACGACTGCCTGTGTGTGTTTTTTCGCACACACGTGTGAGAACTTCCATCCACGTTTTTTATCGCTAAGTCAGATATATTTTGGAA
TTGGTTGTCAAAGTCTCGTGAAGCCCAAGCTCTCTTCCCGCCGCGGTAGTTTTTATTCTAGCCGTGTCCCGCTCGTTGTTGTTCTCGCCGTGATGTTCCTGCCGCTTCTCTCCGAAACAA
GTGGGACACCAACGCTATCTACTTCGGTGGAGGTCTGGCGCTGTACATCATGCACGTCATGTCAAGGCTTTCCGCGTGGAAGAGGTGAGCACGTGCAGTGCTACTGCTATCATACATGCA
TGCACTGTTGGGCGGCGTTTTATTTGTATTCTTGGGTCCCTCGCTGAGTGATTGATCAGACTCAAGTTCACCTTCTCAAATCGTGGGGGTTCTACCAGTGGAAGTCTCGTCCTTTGGTTT
TATCAACGGTCATGTCGGTATCGGTTTGATGAGGGGAACACAAGCGGGCGGTATTGCCTTTCAGTGGAAATTTTCTTATTTTCGGCGGTAGCGGTTTCACATTTTTGGTGGTAACGATTT
GGTGAGGTGGTAGCACTAAACTATGCATATGGCCACACGTTTTTCGTCGGTGATGCCATATGGCAGAAATGGTTTGGTGACGGTAGGCGGTTTTGCATTGATCGGCGTTAAACATGTTGG
CGGAGGTGGTAAACTCAAAAACTGTCGGCCAACTGTTGCAGGGTGATGTCTTCACGGCGGCGGTAGAACCCCCGACATTATCATGGTTTTGAATGCGTCATGTGTGTGTCTTTATTGGAA
TGCATCGACCCAGCAAAACGGCTGACCAATGAAAATACGTCAGTCTCAGTGTGGTTAAAAACACACAACACTTCTAAATGCCATTATCTGGGACCCCCGTGAGGGGGCGGCATGGGGGAG
GCTAAGCTATCCTCCGGATGAAAGACAGAAGCGATAGCAACAAAAGAAAACTGCACGCGTCTACCAAGGGTGCTACCTTGCACTCGAATTCGTTTTAGAGTGCTTTCACCATCATCCTCC
TTGCTTTCACCACCATCATTCTCATCATCGTTTTGACAGCAACTTTTCGGCAGGTCTTCTCTGGCCCTGCGTCGTTGGTTGTGGTGAAGGTCATCTCTGTGTGTGTGAAATTACCCGTCG
ACAAGATGCCCTCCCGTCGACCATCTCTTTTTGGGCCTATGTGCCACGTATTTTCTACCGTCAGGTGGCGCTACTGGAACCGCTGGTTAAAACCTGCCGAGAGCCCCAGCCCCACGAGCC
TGCTCGACGTGCACACCACCGAGAACTACACCCGCCTGGTCCTCAAGAACCCCAAGTGCGACGAGCCAGCCAGAGGAGGGTCGTTCGTCTACATCAGCGTGCCGGGTGCGCTTGGAACCG
ACGAAGCCCACGCCATGTCCGTCGCCCTTCGCGGGAGCCCCCCCCCCTCCTCTTTCAAGACCAGCGTGGCCCCCTTGTCAGTACCGCAGGAGGAGATTTTCACGCTGTACGTCAAGGACC
TGGGGCCGTGGACCAAGGCCCTTCGCAGGGCGGCCGGCAACGTTGCTGACCCCGGGGCGTTGCTGGTGGACGTGGACGGGTTCTACAGCCAAGTGGCATCTTTCAACACCATGATGAAGA
GAGGCGCATCTCGCGTGGTTATCATTGCTGGCGGGTCTGGCGTAACCTCCGTGATGGGCTTCATCCAG
GTGCAAAGAAATGGCAAACTAAGTTTTGTGTGTGTGGTTTGTGATGTGTTTT
GTTGGCGAACGGAGCTAGATTGCCCAACAGGTTGCTTCACTGAAGTACGGGACCTTGATCGTTGTTGTACGAAGGTCGCTTGCGGCCGGAATTTCACCGCTATGGGGACCGTCTTGCTGC
AGACAGCACAGCTTGTTATTTTCAGGGTTGGGGGGCAAGGCAACGAATGGCGAATGGATCTCCATCGTTTACCTGGTGGCTGGTTGAGGCAACGAGTGGCGAATGAATCTCCACCAGTAC
CCTGTGGCTGTTTGATGGCCGGGCGAACATTCCAACGCATGTATGCCAATTATCTTTTAGGTGGGGGCACGCTTGTTTCGTGGTGCTTCTGCGTGTTTCTGAAAGAGTAAACAGGTGCTT
GGTGGCTTTTGTACCACTTCCGGCGTATAGCGACTAAACGTCGTGTTCCAAGTCCTTCTTCGTGCAGGCCACCAAAACAGCGCCAGCTCCCACCTTCCTCTCTCTATGCATCGAACCATG
CCCATGAAGTACAATACCGCGTTAACGTCGCCCTATTCTTCTTCATCTCCTTCCTCGTTTCCTGTCCGTGTCTACTATGCCACGCGCAGGACTGGTGTGTGGTGGCTGCGGCCGGGTCGG
TGGTGCCCGAGGTCCACCTGGCATGGTGCTGCCGTACCATGGTGGAGATGCAGCTCGTCGGCGAATCCATCCCGTCCATGCTCGCCTCCGCCGGAAGCAAGAAGGGCTCACACTTCACGC
TGTCGCTCTACTGCACCAGCAAG
GTCAGAGCATCGATACAACCGCGCGACAAAAGCGTCAAGTAGCCCCGTCTGTACCCAGGAAGAATAACTTTTTCCGGTACTGATGTCCTATCTTCTC
GTTAATTCTGTTATTGGCTCGCCCGCGGGTGGGTAGGTGGGTGCAACGTACAGGCAGGGTCTGGCATCGATGCAAAGTTCGTTGTGCGTTGTTGAAATGTTTATTTTCGCCAAACCCTCG
CAGGCACGTCTATATAGAAAAATCAAATTTGAAGTTAAAATAATGTTGTGGGCATTTGTGCAATGAACAATTGCAGAGGAAGTCGCCTAGGGAATGGCTATCACGCCCCCAGCACCGTTT
CACGCTGTTTATTGCACCAGGTATCCAACGTGTAGCGGCGATAAGAGCGTTATTAAGATGAGCGTACTGTACTGTAGTACTCAGCTCACGACACCCCCCTCCCTCAACGAATATGCCAAC
TTTACCTTTTGGGTCAATGAATCAACTACTGCTGTGCAGACCGGTACGGACCCTCTGAGTGTATCATGGCCTGTGAACTGCAACGCCTATGGCGGCCTCTCCATGGAGCAAGTCATGGGC
AAGAACCCCATCGCCGCGAGCCTCAACCACAGCGTCCGCATCCTTCTCGCAG
GCACGTCGGCCGGCCTTTCGCCAAGGAGTGCAGACATTTCCCCATACGCGTTCAAATCGATTGCTCGG
TGTTGTTGTTTTTTTGTGTGTAGCACGGCATTCCTCTTGGACAGTCGACAAAGTGTGTGCGTTGCCCTCGGTAAACGCGTTGCAGTTCTAATAGCGGACGGGGCGTGTCGCCGGACTCAC
ACTGTTTGTTGACGTAGTGCCTCCCTTTTCCTTGCTTCTTGTTGTCGTCGTCATCATCTGTTATCTCTATTGTTCCTGTTGTCAACACCTGGCGACAACGACTCCCCACCCGCTCGGTCT
GATGTGCCGCTGCTATTTGTGTCGAGACAGGCGGTGCCGCGTACGGCGCGTACGTCCTGGGCACGTTCGATGTCGCCCGTCGTGGGGAGAGGGGGTATCACTCAGGTGGCACCCGACTGG
TGCTCATGATCGTGTGCATCGTCAGCGCTCTCATCGTGTACGACTGGTTGGCTTACTTCGTCCTAACGTTCCCGTGCAAGGACAGCGGGTTTTCCTCGGCTCAG
GTAGAAGCGCTATGCG
CGTGTTTTCCCGCCATTTTTTCCCTTCTGTTGTGTTAGAATCTTGTCAGTCTGCAACATTAGGACTTTGGCCATAGTCGCGGGACGTACAGAGTTTTTGAGGGTTTTCAATTCACCGGTT
GTTGCTGCCTTCTTTATTAATACCGTGGACAACGAAAGCATTTTGACCCTCTAAGTCAGAGGTGGATAAACTTGTGGTAGTTTTGTGTTTGCACCACCCGGAGCAGCATTCGTACGAGGA
TTGATGGTATGCCCAGCACTTTGAAGGGCTTGCGGTAACGGGAATTCGGCACGGTCCCACGCATCGTCCGAGGGATACAGGGGTTATCTCAACCATGTCTATTATGCGTGTGTGTTCGTC
CCCATCTGTTCTGGCGCCGGTTTACAGGCGTTTCGGCGTACATACCTACCTGACGTATCAGCCCGGGTTACACAAGAGGAAGGTCACGCAGGATTTTCCCATTTTGTGTTTATGTTTTAT
TGCCCTACCCTTCCCCCTCCGTCGACAATAATACATACCGTGGTACTCCGGAGTAAAAAATATCAGAAATGCTATTGTACAGTAGTACCCGTTCGAGATAACACCGCAGTCGAAGGGGAT
TTATTTGTTGAATGAAGTCCGGTTGGAGCCTAGGCCTATTTCGAGTGGGTTCTCTGTTGTTGCTTGCTTCTTCTATGGCCGCGGCGCGCTCGATCGTGCGTGCCATAACTTGTACAAGAC
ACCAATGAAACCAACCAAACGAATTCTAACGCCTCGTACACCGCAACATGTAAAATCCGGCGCGAAATTCCAGACACACCCGAGCTATGCATCGAAGGCGGCGGTGATTCACAACGAGCC
CAAGCAGGACGCCCTGGAGTCCTCCGCCACCACCGCCTACGACGTCCTACGGCAGCGCGTTCCGACGAGGGCCTTGCTCGTCCAGGAGGCCGAGCTCGCCAAGAAGAAGGGCCACCGGTC
GGTCAAGGTGCTCACCAGCGGCCCTCAGGCCCTCGTCGACGGCGTCTTGGCCGACGCCCGCGCCGTGGATTGGCAGCTGTTCGACACAGAGGAACTCTCGTACCAGTTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACAAATGGCAGTTTGATCACACGTGCATGCTGTTGCCCATGGGCGGGCCAACAACAACCGGCGTGGCTCTGGTGAGCTTACGCTTCTTAGCTTCCGCCGTGCTCCTGTACAGTGTC
TTCTACCTCGCGATGGCCCGCGGCACGTGGTACCGCGAGCATTTCTTCGTGAACGATGAGCTCGACTATGACATATCCTCGGGGGCAAACATGAGCACCTCTCAAAACCAGCGCGCACTG
TTCCTGCTACTGCTTCCCGTGGTGGCTGCGGCTCTCGGCGGAATCTACCAAGCGGTCTGGAAGTACAGGGAAGGCAAGGCGACACAGGATGGTTTGCCCGCATCGTCGTCTTCGAAGGTT
CAGAGCTTTCTCAAGGCGTACAACAGCATCATCCACTTCCAATTCAGGCCTCTGGGGAAACTGTCTCC
GCTGTCTGTCATCGCCGCGTACTTCGGGTTCGCGGCCTCCTGCCACTTCGCC
GTCATCCTCATCCCCGTCGCCCGCGACAGCAAGCTCTGGTCGGCCGTCGGGATCCCGTTCGAGCGGGCCGTCCTCTACCACGTCATCGCCGGGCACCTGGCCTTCGCCACCATGTTCCTG
CACGCCTTCCTCTTTCTGTCGTCCTGCGTGTGGGAGAACGGCTGGAGACACGCGTGGGAGGTGTCCACCCTCCAAGCCAACGACGACTACGGAGATGTGGACGTCCCCATGGGGTGGGCC
GCGGGGCTGTGCGCGCTGCCCATGTGGATCACCTCCGTCAACTACGTCCGTCGCCGCTGGTACAGCCTGTTCAAGGCCAGCCACTGGCTGTTCATCGGCGTCTTCATCTTCGGAGCCCTG
CAC
TGGGACACCAACGCTATCTACTTCGGTGGAGGTCTGGCGCTGTACATCATGCACGTCATGTCAAGGCTTTCCGCGTGGAAGAGGTGGCGCTACTGGAACCGCTGGTTAAAACCTGCC
GAGAGCCCCAGCCCCACGAGCCTGCTCGACGTGCACACCACCGAGAACTACACCCGCCTGGTCCTCAAGAACCCCAAGTGCGACGAGCCAGCCAGAGGAGGGTCGTTCGTCTACATCAGC
GTGCCGGGTGCGCTTGGAACCGACGAAGCCCACGCCATGTCCGTCGCCCTTCGCGGGAGCCCCCCCCCCTCCTCTTTCAAGACCAGCGTGGCCCCCTTGTCAGTACCGCAGGAGGAGATT
TTCACGCTGTACGTCAAGGACCTGGGGCCGTGGACCAAGGCCCTTCGCAGGGCGGCCGGCAACGTTGCTGACCCCGGGGCGTTGCTGGTGGACGTGGACGGGTTCTACAGCCAAGTGGCA
TCTTTCAACACCATGATGAAGAGAGGCGCATCTCGCGTGGTTATCATTGCTGGCGGGTCTGGCGTAACCTCCGTGATGGGCTTCATCCAG
GACTGGTGTGTGGTGGCTGCGGCCGGGTCG
GTGGTGCCCGAGGTCCACCTGGCATGGTGCTGCCGTACCATGGTGGAGATGCAGCTCGTCGGCGAATCCATCCCGTCCATGCTCGCCTCCGCCGGAAGCAAGAAGGGCTCACACTTCACG
CTGTCGCTCTACTGCACCAGCAAG
ACCGGTACGGACCCTCTGAGTGTATCATGGCCTGTGAACTGCAACGCCTATGGCGGCCTCTCCATGGAGCAAGTCATGGGCAAGAACCCCATCGCC
GCGAGCCTCAACCACAGCGTCCGCATCCTTCTCGCAG
GCGGTGCCGCGTACGGCGCGTACGTCCTGGGCACGTTCGATGTCGCCCGTCGTGGGGAGAGGGGGTATCACTCAGGTGGCACC
CGACTGGTGCTCATGATCGTGTGCATCGTCAGCGCTCTCATCGTGTACGACTGGTTGGCTTACTTCGTCCTAACGTTCCCGTGCAAGGACAGCGGGTTTTCCTCGGCTCAG
ACACACCCG
AGCTATGCATCGAAGGCGGCGGTGATTCACAACGAGCCCAAGCAGGACGCCCTGGAGTCCTCCGCCACCACCGCCTACGACGTCCTACGGCAGCGCGTTCCGACGAGGGCCTTGCTCGTC
CAGGAGGCCGAGCTCGCCAAGAAGAAGGGCCACCGGTCGGTCAAGGTGCTCACCAGCGGCCCTCAGGCCCTCGTCGACGGCGTCTTGGCCGACGCCCGCGCCGTGGATTGGCAGCTGTTC
GACACAGAGGAACTCTCGTACCAGTTTTGA

Retrieve as FASTA