Entry information : EsilGR03(Esi_0051_0039)
Entry ID 16969
Creation 2021-02-03 (Christophe Dunand)
Last sequence changes 2021-02-03 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2021-02-04 (Christophe Dunand)
Peroxidase information: EsilGR03(Esi_0051_0039)
Name EsilGR03(Esi_0051_0039)
Class Glutathione Reductase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EsilGR03
start..stop
S start..stop
MpGR01 282 6e-89 2..498 76..537
LeGR04 280 3e-88 2..498 68..531
HaGR02 280 5e-88 2..498 79..541
MpalGR01 280 7e-88 2..498 76..537
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 264469..264484 16 N° 2 262105..262199 95 N° 3 261658..261775 118 N° 4 261177..261316 140
N° 5 260264..260355 92 N° 6 259310..259496 187 N° 7 258655..258777 123 N° 8 258253..258396 144
N° 9 257704..257847 144 N° 10 257417..257503 87 N° 11 256982..257086 105 N° 12 255670..255768 99
N° 13 254876..254977 102 N° 14 254359..254469 111  
complement(join(254359..254469,254876..254977,255670..255768,256982..257086,2574 17..257503,257704..257847,258253..258396,258655..258777,259310..259496,260264..2 60355,261177..261316,261658..261775,262105..262199,264469..264484))


exon

Literature and cross-references EsilGR03(Esi_0051_0039)
Protein ref. GenPept:   CBJ26963.1
DNA ref. GenBank:   FN648719.1: (264484..254359) [3' end]
Protein sequence: EsilGR03(Esi_0051_0039)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   520
PWM (Da):   %s   55262.75  
PI (pH):   %s   5.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTANEAESASYDYDLAVIGGGSGGMAVAKKAASYGKVVLFDFVKPSPQGTKWGLGGTCVNVGCVPKKLMHYAGLLGAGMHDAKAFGWKVGNPEHDWEAMVETVQNHVKMLNFRYRVGLKSAVTYVNGLARLTGPHEVTCEKRGKETKHTAARVIIAVGGRPVIPDDVPGAREHALTSDDLFSLRTSPGKTLVVGASYIALECAGFMRELGLDVVAVRSILLRGFDQQVAEKLGDVMKDLGVKFVRPAVPSKIEKTSDGKLEVTLVDSKSGEEVSKGTYDSVFYATGRKADTSGIGLETAGVKVNPNGKIPVENEQTNVEHIFAIGDCTSVDVMFHESHWANPELTPVAVQAGELLASRLYARATEQMDYSLVATAVFTPVEYGCCGLSEEDAIRLYGEDDVETYLFGFGTLEQSAAHRVKHVEGEEEDDMPATNLSKLVCLKSQGEKVIGFHFVGPNAGEITQGFGLAVRLGAKKSDFNKLVGIHPSDAESFCAMGITRSSGVSFVAEGGCGGGVCG*

Retrieve as FASTA  
Remarks Annotated as Thiredoxin reductase
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGCTAACGAAGGTGAGATAGAGAGAGACAGAGGGCGGGAAATGCATACCGAGGAGAGGCAACAGCCGCCCTTTTTTTGTTCTCCAAGGACAGCAGACTTGCTGTGTGTGCTCGCA
TTTCGATTTGCATCTGCTGCATCTCTCTGGAGTTCTCTCCCTTCGACGGTGCCAAGGATCCCTACGCACTGCCGTCTTACATACGTGTGGTAAGGTGGTGAGCTGTGGCCTATAGGCAGG
TCGATGGGGGTGGTGCCCGCCACACGCTCTCTGCTCTTCGCTATGCGTGACCTGTGTGATCGGGGTAAAGCAGAGAAAAAGCTCCGCCTTTGTTGGTGGGTGATGTGACCAGGAGCAACC
GTGCCTTACAGCGGTACATATCAGAAGCCGCAGCAGAGCACAGGCGAAAAAGGGGCGTATCTACAACAGTAGCTGCAGCAAGAGTACAATCAACAGATATGCATTGGTGCTTACCATCAG
CACGCAAGTGGAAAACCAACAGCGAAAGAGGGAGCTTACATTTGTGACCACAACCAATAACTTTTCAATATTTGCAATTTGAAACATTCTCGAGACACACACGGCGATAGGGACACAGGA
CCAATCGCATGCACTCACACCAAGCTGACGGAGCACAGCTTGTTCATAGTGGCAGCGTCCGTTTTCGTAGTCTAGGGCTGCTGCTACCGCTGCTGCTGCTGCTACCGCTGCTACTGCTGC
TGCTGCCAGTATCAATCTCTTTCATATGCAGATGTACTTATCCTGCAGTTTTTTCCGTCTGACACAACACAGCAGCAACACAACCAGCACCGCTGTAGTTCCTGCTGAATCGTCCCGGCC
AACGCGTTCTAGAAGAGCCCGCCTTTCGTGGCACGGTAACAGCAGATCGGCGCAAACCTGGCACAGGAGTTACTATACTGTTGTGGGCCCCAGTCTATTGTTCGAGAGAGGGTGATACGC
GACTGCTACGTTCTTGATGTTGTTGTGTTGTTATTGTTGTCGTCGTCGTCGTTGTTGTTGTTGTGCGGAGATTGCGTAGATCTTTCAGGTTCGGCGGGAGAATATCGTGATGTTGGGTAC
GAACAGCAGTGCTCCTATTCGCTGCGCAACAGCAGACTACTACTGCTGTTGGCGACAAAAGACGTTCAGCTTCGGCAATGCGTGAGAAAACGACAAAAAACGGCGAACACGGCGTCAAGC
CTACATAACTCTATTTCTTGAGGGACCGGCCATTTCAGGCCGAGATATGTAGTCCGCATCATCGGTCAAGCGCGAGCAATAGCAATGGGCGAAGGAGCGATCGTTACAGCAACTCCCACG
TGTTTGTTCATGACAGCGTGCGTTCTGGTGGCCACACGTGGCCGGTTTGGGCCTGCCTCGAAAAAAATGTTGATCAGATTTGGGGAAAGGGAAAAAAAAGGCCGCGGTCCACGCGTGTGA
TTCAAAGCCTGGTTGTTGGTTGAGTTTCAGTCTCGAGCACCCGTTCGCGAAAACTGGCGGCGTTCATAGTACAGTCTGTGGGCATCCCTATGTATCCCGTGGCAGCCACAGCAACACAAG
GCCAGGTTGGGGCCCTCGACCCGCCTTCTTGTTTGCCCACTTGCTTGGAAACCTGTCCCTTGGCCCAACCTCGAGGCCAGCACTCCTTTTCCACAATGGGAGGATCGATGTCAACTGTTG
TGTCAAGTGTTGACCAGGCAGTGTCCAAGTGGATTGCGACGTCCATATGCACCCCCGTGTCCGCATCAGACGATCAGACTTGGTTAGCTTCTCCCGACGGCAGATAACTGCAGGCCGTGG
TGGCACACCCCCCACTGTCGATAACGTGCCGCTATTGCGGAGCCCCCCCCTACCTTCGCGTAGTTGCAGCAACTCACAATTGTCCCTCGTTCGTTCCCCCACCGACGAAAGGTCCATTTC
GAAATTTCGAAAGTTTCCCTTAGTCTTATGGTTACCGGCTCTGTTCTGATATCCTTTGTTCCCCCTCATTCTCTTCTTCCCACTCGGTACAAAAACATCGACAACCCTGTTGGGCAAAAA
CCCGGTGCCCTCCCCCCTTGTTTTTGTGCGGGACTGCCAAGGTTTGTTGTTCGAAGATTATACCCCCCCCTCCCCTCAAGGAACGATTGGCCATCGGTGATCGGTCCTGTGGGAACAGCA
GTGCTCCGTCCTCTCGAGGACGCGTAGTCAATGGTCTAACCGCTAAGGCATGCAAAACATAAGAGTACGCCCCCCCACCCCCCCACCCCCCCACCCCTCCTCGCCCTCTTGCCGGACTCC
CCTAGCGGAGAGCGCGTCATACGACTATGACCTCGCCGTTATCGGAGGTGGCTCCGGCGGGATGGCTGTGGCCAAGAAGGCCGCCTCCTACGGAAAAAAGGTGACACTACGAAGCCCCCG
ATGTACAACTTTGCCCTTGATGTGTGCGTCTTTTTTTTTTAACATTAGTTTTTTTCCTTCCCCGAAAGCGTACCACCTGGAGAATTAAGTGGAAGTATAAGTATCCTTCGGCCACGAAAC
CGTTTTTTCTCGATTCCTTGTGGGTGACCCCTCCCGTTTGCCTTGCCTGTAGTTCCCTTCCCTCCCCTCCTCTGTATCATATTTTCTTTTTCATGTGTTAATTTATCTCCCCCCGCCCCC
CCTCTCTCCGCAATTTATTGTTTCTTCCTTGTGGATGATGAATCCGACGCGGTGTGAATGTGAAAAAAGGTTGTCTTGTTCGACTTCGTGAAACCGTCGCCCCAAGGAACGAAGTGGGGG
CTCGGGGGTACGTGCGTCAACGTGGGCTGCGTGCCCAAGAAGCTGATGCACTATGCCGGCCTTCTCG
GTGAGGGGACTTACAGCATGTACAACAACGGCAGTGCGGGAACACGTCTCATG
GCATCTTAGGGGGTTGCGTCGCGTTCCAAGCTTTTTTGCCGGCGATCTTTTCGTTGATGGGTGGATGGTACGCAGGCCCGGCCTCCTATTGCGTCTTTTTCAGGGTGTTGATCAACGTGG
CTCTCTACGAAGATGTTTGGGACAACATAATGTAGTCTGTGTTGTCCTTGTTTGGTCATTCGAAGAAAATCGCGGGCTCTTGACGTTACCTTTCTCCTTTTTCACTCGCGCTGCGGCACA
CACGCTTGTCTTGGGGGTGCGTTGGGGACTCCCTTGGCGTGATAACAGGGGCCGGCATGCACGATGCGAAAGCCTTCGGCTGGAAGGTTGGAAACCCTGAGCACGACTGGGAAGCGATGG
TGGAGACCGTGCAGAACCATGTCAAGATGCTCAACTTCCGGTACCGCGTGGGGCTCAAGAGCGCACAG
GTGGGTGAATGAAAGAGCGATTTTTTTTCCTGTTTTTTTTTTTGTTGTGCTG
TTTGCCGCGTAATGTTTTTCTGTTTTCGTCGCCACTGCGCGTTTCGTTTGTGATACAGTTTTTGACCAATTGGCTACGTTGTTTTCCACTCGGTATTTGAGCCTGGTCTGTGCCCCTGTA
GAGGGGGTGACGCGGTTCCGGATGCGACGAGATATCGGCTGGTGTTCCGTTCGCGACTGAGGTTTATTTGTGTGTGGCGCCGGCGAGCCAGCGGCGTTCACTCCATTGTGTTGCCAAGTG
TGTGTTGGGCATTGACCGACGGACGACGTGGTGTCGTGTCACGTATCCTTAGGACACGTGCGTGACATTTGTATGGACCAGCCGACTTGTGCTCTCTTGTTTTTATCCGGACATGCGTCT
TTGAGGGTGACTCAGTCCTCGACTCAATCTATGGTGATGGTGATGGTGATGGTGCTACAACCACGACTTCATGCGCGGCCCTGCCTGCCTGCCATTGTGTATGTCTGTTTCCAGCCTGTG
AGAGTCTAAATGTGAGCTTCACTGCTGCTGTGTTGGTGCAACGTAGGGTAGTAGCTTTGTCAGGTGCCTTGTTGACAGCGCCAGCGCCCGGGATCATCATTACAGCAGCAGCAATCAGCA
CCGCAGGCCCCCTCGTCCGGCCCACCGCTTGTCTCTTCCATCGAACCACCTCTGCGATTGCCACAGAATACGTGTGGACTGACTTCACAGATGAAGACAAATTGTCCTGCCCTGTCCTGT
CCTGTCCTGTCCTATCCTATCCTGGCTTGTACTTGTATTTCCTTCTCAGGTAACTTACGTGAACGGTCTGGCGAGGCTGACGGGTCCCCACGAGGTGACGTGTGAGAAGCGAGGGAAGGA
GACCAAACACACCGCGGCGAG
GTGAATATTTTTTTTTCTCGTTTTTTCGGTGCGCCTCTCCTCAAGCGCACCACCACATTATTTGCCGCTAGTAGTAGTAAGAGGCACAGATACCGTAGG
TTGTATACGTGCCACACAGTCATGGACCGATTGTTTCAAAGCTCGATCGCTCGGTGCCGACAATGGTAGTGGCGACGGTGCCGACAATGGTAACGTCGGAACCATCTCGTCGAGAGCTTT
GCGAAAGGGCATCATGGGATTTTGTGTCCTCTTCATGGTCGAGCAGTAGAGCTTGAAGGTCGGGCTAGTCCAGGGGGTGTGGTATGTTACGCATGGAACCTACACCGCAACCTATACCGC
ACGGCGGTATACACCGTGGAATAGATTATGAAAGAATCCAAATGGACACTTGGGCTCCTTGACGATGGAAGGCAATGGTGCAGATCTTGCGTACCGCGGTAAAGGAAACGAGATACCTGC
CAGCAAGTATTACAATATAATAGACGAATTGGTTCACTCTTAAAGCCAAGGAGGCCAATCTGGCAAAGCGTCCTTCCTTGTGTTTGTGTTTGTATGTAGTGTTAGACTGTCATGCTTGGT
CGTGCGCCACTCGACCTTCTTCCGCACAGTCGGCGCGGCGGGCGTCACTGATGCCACTGATAACATTTTTGTTTTCTCGCCGCGGGACTGCTGACGTTTTTTTTCTGTTTGTTTTTTGTG
TGTGTCCATTTTCTCCTCGTCGTTCCTGTCTCGATGTTTTTCGCGTGCTGACATGTGCTGTACTGTAGGGTTATCATTGCCGTGGGCGGGAGGCCCGTGATTCCGGACGACGTGCCCGGA
GCCCGTGAGCACGCCTTGACGTCGGACGACCTGTTCTCCCTAAGAACATCCCCGGGAAAGACCCTTGTTGTTGGAGCGAGCTACATCGCCCTGGAGTGTGCCGGTTTCATGCGGGAGCTT
GGGCTTGATGTCACG
GTGAGGGTTAGTCGTGCTCCTCGGTTTCCTATGGTGAATAGATTCCTCGCCGCGGCCGGGGGGAGTACTCGTTTGTTGCATGGTTGAGCGGTTGGACAAATGACC
GCGCGTCCTCGAGAGGACGGGGCATTGTTCCCCCAGGCCCGATCCCCGATGGCCTATCGTCCTTTCTGCTTTGCCAAAGGTAGCACAAGAATAGTCGGAGGGGGGGGGAGGGATCACTGT
TTTTTTGCTTGTTTTGTCTTGTGGAACGGATCCCCTTGGTCGTCCTTTGGTGGTGCTGATGGGGTGATGTGGTGATGGGGACGGTCCGTACAGCAGTAGAGTTTTTGCTCCAGCTTTTCC
TGTTGCCGGTGCCAGCCGTTGGTTGTTTCTTGACGCTCCTGCCACCCGTGCCCCTGACGTGACACTGCTCTGCTAAACATTGCTGGTTTGCTGTCCCTCGGGTCTTCTAGAAGTACAACA
CCCGGCGTGTCTGTTGTTGAATGGGAAACGTGCAACATACAATTAACATGCAACATAAAAAATGCAGGTGGCGGTGCGATCGATCCTGCTGAGAGGCTTCGACCAGCAGGTGGCCGAAAA
GCTGGGTGACGTCATGAAAGATCTCGGGGTCAAGTTCGTGCGTCCCGCCGTTCCGTCCAAGATCGAGAAG
GTGAGGGCGCCGCAGTTTGCTGTCCAAGACCCCCGCTCCCCCCTCCGCAT
GCTTCTGTCCCGCGATGTGTCGCAGATTTTGGGGTAGAAGGGTCTCGTAATGTATCCCGTCTCGCAAGTGACGGATGTCGGGAACAGGAACCTATGAGATAGCCAACGGAAGCGGCGCAA
ACGCGGATGCCCCGCGCGCCCCTTGTCCCCGGTCTAACCTCTGGATGTTTTCGGATCGGGACATGCCTCCTCCAATGGGAAACACCAGACCAGCGACGGCAAGCTGGAGGTGACACTGGT
GGACAGCAAGAGCGGGGAGGAAGTGTCGAAGGGCACGTACGACAGCGTGTTTTATGCCACGGGCAGAAAGGCGGACACGAGTGGCATCGGCCTGGAAACCGCTGGGGTCAAG
GTCAGTGG
GCGGAAACAGTTTGGGGCTGCTGCGGCGGTGTGTATGTGTGTGGCAGACGCCGAGACGGCTCTCTCAACGACTCTTGTAAGCCTCTTGATGATCCTCTGTACGTGCATACACTACCCCCC
CCCCAAAAAAAAAGAAAGGCTCGAAAGGGGCAGCTGCCTTGCCGCAGATTCAAAAACGTTTCGAAGTACCACTACATATTTATAACGCAGTATTTTTCGTCCAGGAAAGATACCGAATTA
AGATTTGTTTGGCATGGGTTGACGAGGACGCGCGCCTTCGCTGACCCGTACCAATAAAGTTTGTTTCGTTTCTCAAATATCCTTGGATATCTTACACTGAAGCTGCGTGTACGTCCTGCA
AACTGTTTTGATTTGCCTCTCTGGTTCTCTGGTTCAGGTTAACCCGAACGGGAAGATTCCGGTAGAAAACGAGCAGACGAACGTGGAGCACATCTTTGCCATCGGGGACTGCACGAGCGT
GGACGTGATGTTCCACGAATCCCACTGGGCCAACCCCGAGTTAACGCCGGTGGCTGTGCAG
GTAAGATCTATGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTCTGCGGAGTTTGAAGTCC
ATACTTTTCGCCTCCTGTCCCATCTACAATATTCCTTTCCGTTTTTTCCATTCCGTAGTGATTCGGCGCTACCATCATCCGGGGAGCTCATGTTCCGCTTTCTCGGCTCGCCTAATTTTT
TGGAACGTTCCGCTGTAACAGGCGGGGGAGCTTTTGGCGAGTCGCCTCTACGCGAGGGCCACGGAGCAGATGGACTACTCCCTCGTCGCTACCGCCGTCTTCACACCGGTGAAAGGCGTT
GTCCTTTTCCTTATCCTTGTACAATACTCATCTGGATCGTGCGCGACGTGACGTGACCTAGTCGCGTTGGTCTTTTCTTGTCAAGTCGTCTTGAGCATGTGTTGTTTTTTTTCTGCGGAT
CTTACTATAGTAATGTTGGTCTTTTCTTGTCACGCCGTCTTGAGCATGTGTTGTATTTTTTCTGCGGATCTTACGCTTGTCTACTGAATGTAAACCAGCACACGACAATAGTAGTAGTTC
AACTGGCACAGCTGGCAGCAAACAACAACAACAACAACAACAACAACAACAACAACAACAACAACCGCGTGTTGGCAGGTGGAGTACGGGTGCTGCGGGCTGAGCGAGGAGGATGCAATC
CGCCTCTACGGGGAGGATGACGTAGAGACCTACCTCTTCGGCTTCGGGACCCTGGAGCAGTCG
GTGAGACTTGCAGGACTACGCGCTTGTGTTGAATCGTCGTCGAGGGATGTACGTTCA
TGACGATAGCATGTGGGTCACCGGTGGGAATTGCGAGCTATAGATGAGGGCGCGCTCTTTGTGCACTCGACGTCGCAGCAAATGCTAGGGGTGCAGACGCACGGGAAGAAGAGAGTGCGC
GGGACGCCTAAGGAGGTGCCTGAAATCGTGGACGTGTTGAGCACCGCGCAGCGCCACGTCATGGCAACTGTAGGGTGGGGTTGCATGAACCCGACGGGGCAGGCGGATGCAAAGCCTAGC
CCTGGCTCTCTACCCAGACCATGAACACAGGGAGGGATCCCCGCACCAGCAGCTGGGTGCTTCTGGCACAAGAAAGAATGTCGACTCCTCTTGTTGGTGGTAGATATACATGCAGCTACC
AGAGGATACCTCGATCCACCGACCGTGTGGATTGGTATACGTGTCCTTTCTACACGTGCAACAATGATGTTTTTGTGGATGACTGCCGTGTGGACAGCGATATCGGCACCGCAGTAGTGT
CCTTCCATCAGACACGGGAACGGATGGCACCATCTTTTTTTGATAATTCGGTCGCTGGGCGCAAGAAAAAGTTTGAAGTTTTTTCCGCCTTGGAGCCTAGCAATTTTTCAACTGTTGTAA
CACAGTCGGTTCCTCGTTCATCGTTTGTGTATAGCCGTGTTTTTCGCACAGCTAAATCATGGCGCTACGGTCCCCATGCTGGCCATTCTACTACACCATTCCGTTGGCACCGCTCTGCTC
AGGCCTGCTTCGATCGTGCTTCCAAGCTTTGGTTAAGTTGTCCGCAAAGTACGAGCCTGTTGTCGCAGAGCGGCGTAGAAAATGCGTGGAATACAGTTCGGGCAGACGTTTACCTTTTCT
CCGAGGCACACGGTCCGTCTCCCCCAGAGCCGGGAACATGCGTCCACGGTACATCCGGCACACACAAAAAAAGCGTTCAAGGCGCGTATTTGGGTCGCTTACCAGCTAATGGGAGAGGAA
GGTCGACCGCCCTGATGCTGTCATGTGTTGATTTCGAGGCACGTATTGCTACACGTTGTACATTTGCCACCACGGCAAATGTGACGATCGAAAGACATAGACCCCCACGATGTACGGGTA
CGTTCGGGCAACGCCAATCCCTTCTCCTATTGCCTCCGGTTGTGGATGAAATTTCCCCGACTGCCGCGTGCGCCAGGCTGCCCACCGTGTGAAGCACGTCGAAGGGGAAGAAGAAGACGA
CATGCCGGCGACCAACCTGAGCAAGCTGGTTTGCCTCAAGAGCCAGGGCGAGAAG
GTGTGGCCTTGTTGGTGGTGTGGTGAGGGACGCATCTGATCGGACGGTGGTGCTGTTAGTTGTTG
CGGGCGCGGCTTGTGGGCAGTGAAACACGGGGTGCGGCTGGTTTGCGTTGTGTTGTGTGTGTGTTGTCTTTGCCAAGGCGGTTTGGAGGCGTCATTGAGACGGATTTTTGTGAGTTTTGT
AGAGGCATCACATGAGTTTGACTCGTGCCAGATGTGCGCACAGTGTTTGTTTGCACCGACCGCGCTAGCCGGCTGACCAATAAATGACGTCAGTCCCAGTGCCACCCAAACTGGCGACAA
CTCCTGAAGGCCGTCAACTGGGGTCCCTTGTGTGCATGTATGAGGCGTGTTGCCGGAGCCTGTTGTTTTTGTTCCCCCCTCTGGAACTCGTGATTTTGCCTGCGTTCACGCGAAGTTGGT
GCAGTGATGCTTTCTTCTGCCCACGGGCCTGTCGGTGGTGGCCATGGCGTTGTGGTTGTAGGGGTCAGCTTTGGTGGGCGACGCTCAGCGGTTGGAAGACCCGACCGTGAGCTCGTGAGC
TGCGATACGCACGACTCAACGTTTGGTGCAAGGTTCACATGTTCCTCACGTGTTCGTACGTGGCTTTGCTGTACAAACATTACTTCACCCTGACGCCCCCTTTTCCCACCTTACATGTGC
TTTCGCTTCGTGTCTCTGCGTGCGAAGGTGATCGGATTCCATTTTGTGGGGCCTAACGCTGGAGAAATCACGCAGGGCTTCGGCCTGGCCGTACGGCTGGGGGCCAAGAAGTCCGACTTC
AACAAGCTC
GTGAGTATGCATTCCCTACCTCGTGCCTCCTTTTCTGTCGTAACTTTGGTTTGTGCGCTGGATATTGCTGCAGCTGACACACACTGCATCCGCACTCCTCTGCCGCTGTTG
TTCTATCACGACGTGTGCGAGGCATGATGAAATCATCGTTGTTGTGAGGTGTACGGTTATGCGCCAGCCTGTGTTCCCGAACGTTGTGAGATTGTTAATTTCTATTTTTTATTTTTTCGG
CGGAATCTGTAGGGAAGGGGAGTGGGCAGGGGGGATACAGCAATCCTGTCTGACCGACGTGACTTGTACTCCTGAATGCACACGAATCTGCTCCGTCGTCCCCGACCCTGTGCCTGCTAC
CCCCGCCCACATCACGTCACACGGACCCCTTGGAAAACCCCAACAACGATTATAGGTTGGTATCCATCCGTCTGACGCGGAGAGTTTCTGCGCGATGGGCATCACTCGTTCTTCCGGCGT
CAGCTTTGTGGCAGAGGGCGGCTGCGGCGGGGGTGTTTGTGGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGCTAACGAAGCGGAGAGCGCGTCATACGACTATGACCTCGCCGTTATCGGAGGTGGCTCCGGCGGGATGGCTGTGGCCAAGAAGGCCGCCTCCTACGGAAAAAAGGTTGTCTTG
TTCGACTTCGTGAAACCGTCGCCCCAAGGAACGAAGTGGGGGCTCGGGGGTACGTGCGTCAACGTGGGCTGCGTGCCCAAGAAGCTGATGCACTATGCCGGCCTTCTCG
GGGCCGGCATG
CACGATGCGAAAGCCTTCGGCTGGAAGGTTGGAAACCCTGAGCACGACTGGGAAGCGATGGTGGAGACCGTGCAGAACCATGTCAAGATGCTCAACTTCCGGTACCGCGTGGGGCTCAAG
AGCGCACAG
GTAACTTACGTGAACGGTCTGGCGAGGCTGACGGGTCCCCACGAGGTGACGTGTGAGAAGCGAGGGAAGGAGACCAAACACACCGCGGCGAGGGTTATCATTGCCGTGGGC
GGGAGGCCCGTGATTCCGGACGACGTGCCCGGAGCCCGTGAGCACGCCTTGACGTCGGACGACCTGTTCTCCCTAAGAACATCCCCGGGAAAGACCCTTGTTGTTGGAGCGAGCTACATC
GCCCTGGAGTGTGCCGGTTTCATGCGGGAGCTTGGGCTTGATGTCACG
GTGGCGGTGCGATCGATCCTGCTGAGAGGCTTCGACCAGCAGGTGGCCGAAAAGCTGGGTGACGTCATGAAA
GATCTCGGGGTCAAGTTCGTGCGTCCCGCCGTTCCGTCCAAGATCGAGAAG
ACCAGCGACGGCAAGCTGGAGGTGACACTGGTGGACAGCAAGAGCGGGGAGGAAGTGTCGAAGGGCACG
TACGACAGCGTGTTTTATGCCACGGGCAGAAAGGCGGACACGAGTGGCATCGGCCTGGAAACCGCTGGGGTCAAG
GTTAACCCGAACGGGAAGATTCCGGTAGAAAACGAGCAGACGAAC
GTGGAGCACATCTTTGCCATCGGGGACTGCACGAGCGTGGACGTGATGTTCCACGAATCCCACTGGGCCAACCCCGAGTTAACGCCGGTGGCTGTGCAG
GCGGGGGAGCTTTTGGCGAGT
CGCCTCTACGCGAGGGCCACGGAGCAGATGGACTACTCCCTCGTCGCTACCGCCGTCTTCACACCG
GTGGAGTACGGGTGCTGCGGGCTGAGCGAGGAGGATGCAATCCGCCTCTACGGG
GAGGATGACGTAGAGACCTACCTCTTCGGCTTCGGGACCCTGGAGCAGTCG
GCTGCCCACCGTGTGAAGCACGTCGAAGGGGAAGAAGAAGACGACATGCCGGCGACCAACCTGAGCAAG
CTGGTTTGCCTCAAGAGCCAGGGCGAGAAG
GTGATCGGATTCCATTTTGTGGGGCCTAACGCTGGAGAAATCACGCAGGGCTTCGGCCTGGCCGTACGGCTGGGGGCCAAGAAGTCCGAC
TTCAACAAGCTC
GTTGGTATCCATCCGTCTGACGCGGAGAGTTTCTGCGCGATGGGCATCACTCGTTCTTCCGGCGTCAGCTTTGTGGCAGAGGGCGGCTGCGGCGGGGGTGTTTGTGGA
TAA

Retrieve as FASTA