Entry information : EsilPxd02 (Esi_0083_0090)
Entry ID 16971
Creation 2021-02-04 (Christophe Dunand)
Last sequence changes 2021-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilPxd02 (Esi_0083_0090)
Name (synonym) EsilPxd02 (Esi_0083_0090)
Class Peroxidasin    [Orthogroup: Pxd003]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilPxd02
start..stop
S start..stop
EsilPxd03 2540 0 1..1489 1..1490
EsilPxd01 1052 0 282..1268 356..1344
EsilPxd01 296 7e-82 14..220 86..302
EsilPxd01 62 0.000000002 1332..1489 1445..1627
EsilPxd04 823 0 17..885 1..805
EsilPxd04 256 1e-69 1007..1268 849..1095
EsilPxd05 513 2e-164 14..678 91..763
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 501712..501752 41 N° 2 502283..502679 397 N° 3 502949..503068 120 N° 4 503624..504154 531
N° 5 504484..504900 417 N° 6 505194..505295 102 N° 7 506981..507184 204 N° 8 507452..507672 221
N° 9 508088..508343 256 N° 10 508684..508818 135 N° 11 509213..509461 249 N° 12 509966..510154 189
N° 13 510529..510756 228 N° 14 511210..511347 138 N° 15 511662..511850 189 N° 16 512422..512478 57
N° 17 513295..513405 111 N° 18 513652..513756 105 N° 19 514191..514305 115 N° 20 515025..515121 97
N° 21 515951..516125 175 N° 22 516975..517049 75 N° 23 517241..517462 222 N° 24 517779..517874 96
join(501712..501752,502283..502679,502949..503068,503624..504154,504484..504900, 505194..505295,506981..507184,507452..507672,508088..508343,508684..508818,50921 3..509461,509966..510154,510529..510756,511210..511347,511662..511850,512422..51 2478,513295..513405,513652..513756,514191..514305,515025..515121,515951..516125, 516975..517049,517241..517462,517779..517874)


exon

Literature and cross-references EsilPxd02 (Esi_0083_0090)
Protein ref. GenBank:   CBJ27733.1
DNA ref. GenBank:   FN649064 .1 (501712..517874)
Protein sequence: EsilPxd02 (Esi_0083_0090)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1489
PWM (Da):   %s   162486.93  
PI (pH):   %s   4.78
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTILLGALQGQPRELMTDVFLSSPPSVSDMNAVAIAWGQLLLLDLSYTVDNSSEPFDIACDDGGGSVDVWCPLGEASDPIPFFRSEATVTDSVRNPINYASSFIDLDFVYGRSEDAADALRTFEDGMLSMADDNMPIKNDDGTWIADQRTARFPLTFALHVVLLLEHNRCCVDVAPGENYTGDEDIYQACRGWTIATFQHITEDELMILLMGRSIGDWTVYQDDDDGGRRRLSPEQRRELLFTFDYYNDTVDPSADVFVTVAMTAAFESALPSTLRIVSEGYVATDYDHLELTVAAEDITGLFEHSAIGDILRGAVLSPAMAVGAHYASAVSNASPLFKLPVDMVQRGRDHGVPSYNDVRGAYGLPEATDFSDVSSDGDVVQLLDAAYGGEIDNLDACTGALAEDKEASLGGIFGYLLHTAWVDQLYRSLFGDRYHHLHSRPIENVSLVSISQLLNRTLGLTALPESGFTVPEVTVCTGQCEATGTSGVSLAERYGISWEVEDETLLISLSVLGIGDSGMIGIGFGGLSMTDAQDFIICEVFSTGGAECTDRSPTGGRSEPQPDTFQLGLEVTNVTTGGGWTTVKFSRERATLDAEDYDLFEDIENEADTLVIYSFKKGEGVGQHPNTNRGAATINFVTGDVDTQCDGETSFVSLHGALMLIAWMIIAPWGIYYARYRKGDAIKWAGREWYEMHEEIMIVASEAVLPLGITAVFASRGRTSEAHARWGYYMIAAVAMQIFTGWMRTKGLEAKHSNFSLFHFNKFFHIWAGRFAYAAGVVQCYRGLELVSSDDELIFSAGDGLDLQLGSFGWVKDILFPAWFALIAGSFLILETQKQYHRFFKKGAANVCGVVSIVNELHDTSIRNNGGRLIPRTLDLPIYSISAFNDKVLSGQTWLMVDEAVLDVSDFAQRHPGGRRLILNALGTDVTQELLGQENSVGHAMSFPPHVHTGSAWRIIRSLVVGYIEEKDVGEPAAALEDQQEQEEAEEKVEPSTGDPACSGTNNRKIRVAGRAVMLTNRLALGDDNLATKAMRLNDLAAIPACIPAPTRRPTNLVATSSSASRFGNQPKEIDAPQRVDDKEGVLGSNTDLFERFQVCPLLFRERMGAASAVGRGHLPSKRPVYRYIFSCPANGQAQAQAVSGVCYFNMRAQEEGKGVVQRAYNAFAVRLLDVEPPTPGGRVAWTKGFAKLPKIVPAGETTEGILCIEMRIRMYHDGAMSKLLEKLSQDTDNAAVQLQGPFLINKLAPPPVYRNVIMIAAGTGVNPRTPRSPRGRGWSSCGRARPRPTSTVPMKSRPCKFNLDSSSGKPPPYRTPSRTGHGDEQPPPYRTPGRDGSRPADGKEKRTTTGVGKLLPKKTWRNLRRSDSSTPGAHRRPPIQDSSTYQVGDGLVRGKVNREILETVFGEALTTPIAADNRQREVKSLLRSDSDISDEKEGQDEDDGDLTSTDQTSRKLQVVVSGPSEFVANVWQLLDQMGVPSGCMVLLD

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACAATCCTACTTGGGGCGCTGCAGGGACAACCCAGGTGCGGCGACAATCAACAACAATGCGTCCATAACCTACCACATTTGCCCCTTGTTATCGCATGTCTATCCTAGAGTTGC
ACATTGCAGGGATCGATGATCATCGTGCTCCTCCTCGAGAGGAACATTACCAGAGGTTGGGGTTTGTCAACCCTGTTTCCGAATCTAGCCAAGTCATGGTCCTTCTACCTACCCACCTCG
CGTTCGGCTGCACCTGCCTTCTCTTGAAATTTCCCCGCGGCCTATTTTGCAGATCCGTGCGGAAGCTACTGATTTATATGCGGACGCTGCATTCACCCCGCTGGAGGAATTTAGGCCGAC
TGCGAGGCAAGTACGGCCGTAAGAGTATTTTGTTTCATGTGAGGTGTCATGCCAAGAACCAGTTGTTTCTAACTTTGGTTTGTTGGCCCTACCCTAACTCGGCGTTCGGTTTGGAAGGCG
TCGTGGCATTTCTCCGCTATTTGCACCTCACCCAACCATTACCACCCCTTCTCTGCTCCACCCACCACTTTTGTCCCACAACCGCTGACAGGGAGCTGATGACGGATGTATTTCTGTCGT
CTCCACCATCCGTTTCTGACATGAACGCGGTTGCCATCGCTTGGGGACAGCTGCTGCTTCTCGATTTGTCCTACACCGTCGACAACAGCTCGGAACCCTTCGATATCGCTTGCGATGACG
GAGGGGGCTCCGTCGATGTTTGGTGCCCTCTGGGGGAGGCATCTGATCCAATCCCTTTTTTCAGATCCGAAGCTACGGTGACTGATTCTGTGCGAAACCCGATCAATTATGCGTCCTCGT
TTATCGACCTGGACTTCGTCTATGGAAGGAGCGAGGACGCTGCCGATGCACTTCGTACCTTTGAAGACGGAATGCTGAGTATGGCAGATGACAACATGCCCATCAAGAACGACGACGGGA
CTTGGTTG
GTAGGTTGACCAGGCCCGTGTACTAGTAGAAGTCTCGAACAGCAGTGTCGAGCGCGCTGCAGAAGATTATCCAAGTCGCCAGAACCAACATGGCCTATGCGTCGTGTCTGCG
ACGAGGAACGAAATACATCGGCGCTGCGGTGAATAAGACGTACCGACGTTATTCTATTGCCGGGGGCCATCCACCGATAATTTGCTAGCCAGCTACCCCCTCTATTGACCGCCAAGTGTT
CTTCATCTTGCCGCTACCACCTTGTCACCGACGGTAGATCGCGGATCAACGTACGGCGAGATTTCCACTGACGTTCGCTCTTCACGTCGTTCTCCTTCTCGAGCACAACCGCTGCTGCGT
TGACGTCGCGCCCGGCGAGAACTACACGGGCGATGAG
GTTAGTCCTGCTAGAGACAGCCTCTTCTGAGGAACCATGCGGTCGTCCGAGTGACATGTGATTGCTTGTTTGCCGCGGTGTGA
TAGAGCGCCGTCATGTTGGCTTTGAGCCTGGATAGGGCGGTTGTCTGTGAAGCAATTGGTGCCACGGCGATTTTTTCCGAGAAAGTGGTGTGATGTGAGTTGCCTTACCCACCCCTCCCT
CCATTCCTAACAGCAACTATTGTCAACAGTGGCGGTGGTCAGTTGTTCCTTGTGGTCGTATCAGATGATGTGGCCATGCCCCACTGACGAATCGTGTCGATGACAACATTGGAAAGCCCA
TAGTACGTTTTCGACGAAGACCGCCAGATAGAGTAGCAACTGTACGACCCAGCAAGCCCCCGTCTGAAATCGCCAGTATTGCGGTTGAATGCTGAGTATTGCCCCTTAAACAAAGCCCAC
GAACACTTTGCAAAAAGAACCGCTGATTCCTCTCTTTCAGAGTTTCGTTCGCAGTACCAGGTAGGACGAACCCTCTTGTACGCACACAACGATCCCCTTTTGGGCCATGCAGGATATTTA
CCAGGCTTGTCGAGGCTGGACCATTGCAACATTCCAGCACATAACTGAAGACGAGCTTATGATTCTACTCATGGGAAGAAGCATCGGCGATTGGACCGTGTACCAAGATGACGATGACGG
CGGCAGACGAAGACTATCCCCAGAACAGCGGAGGGAGCTGTTGTTCACTTTCGACTACTACAACGACACCGTGGACCCGTCCGCCGACGTCTTCGTGACGGTGGCCATGACCGCCGCGTT
CGAGTCGGCGCTGCCTTCTACCCTCCGCATTGTGAGCGAGGGGTATGTTGCCACTGACTACGACCACCTTGAGCTCACCGTTGCGGCGGAAGATATCACGGGCCTGTTCGAGCACAGCGC
GATCGGGGACATTCTGCGTGGGGCGGTTTTGTCGCCTGCGATGGCGGTGGGGGCGCACTACGCTTCGGCGGTGTCGAACGCCTCGCCGCTGTTCAAACTCCCTGTGGACATGGTGCAGCG
GGGCCGTGATCATGGGGTGCCATCGTACAACGACGTCCGGGGG
GTGAGTCCTAATTTTGCTCAAAACGTTTGTGAGGCACCGGTCCCACCAACCTCGCCGTTTGCAACAGCCAAGGTGAG
GGTGAAGAGTGAGCGCTCGGTCGTACCCGTCCGTCCGTGGGATCTTGACTATCCCCTGTGTCGAGGACCTGACTACCACACAAAGGGCAGAATGGCTCGCGCATCGACCGGGGGGAAACG
TTGTAGTGCAAACCCAAGTCGTCAGTGCCGCAAAGAAGCCCTCCCACCCAAAACACGTGTTCCCTGTAGTACTGCGGGGGGAAATGACTTTTTCGGAACACTTGCTGTCGGCGTTCGCGC
GCGCCACAACAGGCGTATGGTCTTCCGGAAGCCACGGACTTTTCAGATGTATCGTCGGATGGAGACGTGGTGCAACTCCTAGATGCTGCGTACGGTGGAGAAATCGACAACCTCGACGCG
TGCACAGGAGCCTTGGCGGAGGATAAGGAGGCGAGCCTAGGTGGTATATTCGGCTACCTGCTGCATACCGCATGGGTGGACCAGTTATACAGATCTCTCTTCGGGGACCGGTACCACCAC
CTTCACTCGAGGCCGATCGAGAACGTGTCACTCGTGTCTATCTCGCAGCTACTCAACCGCACGCTCGGCTTGACCGCCTTGCCGGAGTCGGGGTTCACGGTGCCGGAAGTCACTGTTTGC
ACCGGGCAATGCGAAGCCACGGGTACATCGGGGGTCTCGTTGGCTGAGCGCTACGGCATATCGTGGGAG
GTACGCGACGTCGTGGCCGGGGCTTCACCTTTATGTGTCGACCACCCATAC
TTGACCAGAGTACCTTATGATGATGGGGATGGTTACGCAGAGGAAATTCTCCGCCATTTTTTGGCAAGCTGTCGTCATCGTCGCGAAAGGGGTTCACCTGTTTCCTGTTCGTCGGTTGCT
TTACAGTGTACTTTCCAGCGGATTTTCTCCAGGTTGCTAAGAAGCGTCAGTCATAGCGAATGAGGAGCTCTGGGCGCGACTCCCTCGGCCATGTACCGCTTGAAACCCTCATCCTTGTAC
AGGTGGAAGATGAAACACTACTGATTTCTTTGAGTGTCCTGGGCATCGGCGACAGCGGGATGATAGGAATCGGCTTTGGAGGCTTGTCCATGACGGACGCCCAGGTGGGAGAAGCAGGCT
GCAACATACATGTCGATAATGTCTGAACATAAGTCGCTGCCATCATCCCCCCCCTCACCCCGTTGAGCTGCTCGCCCCGTCCTCCCCGTAATCGTGCCGGGATATCGTCAAAGCTTTGAA
AGGGTACCTCGGCCAATGTGTCTGTTCTTCAGAGGGAACCTATTTTCATGTCACAACCGAACGAGGCGTTTGTCAGTGTTGAGATCAGCACATGTCGTTGCCGTTGTGTTTCATGTCGTG
GCTGAAAATCAGTGCTGTGCAATGAAGTCGACTGCAGGGATTGACAGAAATTCTGCGCAAATAGGTTTGTTTTCCAAGCGGGAGGGCATTTTTTCCCGTCCGGGATGTACACGGATGTTT
GATGCTCCCCGTTTTGTCGGTGTGTCGTGGAGGCAAGCCAAACCTACCCACATGTCGTGCGACGTGCCTCCCCAAAACGGCCAGGTCAACCCTGGTTTCGACATGAATACCGTAATTGTC
CGTGTTATGGCACCGAAATGCGATAGTTTTTTAAATTATTCCCATTTTGGTTTTAATAGCACCCCGGTGCCATAATGCCGATGGGTGCCATACCAGCGATACCTGTGCGGAAATGGAATT
ATTTAGTTCTAGATTTCCAACGCACCCCCGGTGTGATGACACCCATGGGTGCGATACGGAAAAAATCACGTGAGTGGCCATTTCACGGTGCTGAGTGAACGCACCCCGGTGCGATGACAT
CGATAGGTGCGATACTCAAGAAACGAGTACAGCCGTTTCCTGGTACGAGTACCAAAATTTTGCGTGTTACGGTACTTAACAAATATCAAGCGGCTGATGCGAGTTTGGGGTAGTAGCATG
TGCCAAATATAACAGACGCTGTGGGGAAATTATTGCGGTACGGTATCGTTTTTCTTTCAACCTCTTTGTTGGTCGCAAGCCCCTCATTTTTTGGCTGATGCTTCCATCTGTCTTTGTCTG
CCTCAAGGAGCACGGTACCGGTACAATTGTAGTGCCGTTTACAAACTCCTTCTTGTTTGGTTGGTTGGAGGTGCGGGATGTGTTCTGTGTGCTTGGCTGAGTGAGTGAGTGCATTCGATG
TACGGATAACCGTAGAAAAAAACATGAATCATTTCTACCGCACACCTCGACGGATACATACATACATGCATGGCGCCCCAATTTTTACCTATCGGACCCTCTCAGCCGTTCGCTACATGC
AGTTCGACACGTGGCCTGGTACCTTTCGGAAGCACACAAATATACGTCCTAAGCAGATTTTATTTCGTTGATATCGCACCGGGTGCGTTACACAGACACCGGTGCGGAAATGCAATCATA
TCACGCAGTTCTCGATATTTTTGCGCCCCCCGGTGCCATAACGCCGATGGGTGGAAAATCAACGATGGGTCCCATAACACGCACACGGCATTGTCTGGTCATTACGTCGGTGTTTGCGAT
TTTTCCGACAACGGACTTTCGTCTCTTTGACGACCGTACACTCAATCGTACTCCGTGCACGATGGGAAATAGCCTGAAGTACGAAGTCATCAATCAGGTTGTCTACCAGCGCGCGGCAGC
TCTCTAATCACGTCTTGCAGCATCCTGTTCAACACAATAGTCTACTTGCCGCCGCCTGCTCCGCTAACGCTCACCACTGGTGTGTTGATGCATATGGTGCCCTCCAAAGGATTTCATTAT
CTGTGAGGTCTTCTCAACGGGCGGTGCCGAATGCACTGACCGGTCTCCCACTGGAGGGCGATCGGAGCCGCAGCCGGACACTTTTCAATTGGGCCTCGAAGTTACCAATGTAACGACGGG
GGGAGGCTGGACTACAGTGAAGTTCTCGAGGGAACGGGCGACGCTGGATGCAGAAGACTACGACCTCTTTGAG
GTGGGTACTACACCTGCTGTGCGTTTTATCCTTTGTGTTGACGCGCC
CGTTGATGACCGTCTTGTCTGTTGGGGAGTTCGTAACGCGGGTTCCGGTATTCCCTACCTACCGCCAGTGATGCGGCCGCTGTGAATACATCGCCGATGTAAGGAAGAGCGTGCCCGGCC
TATGTCAACCTGCATGCATGAACGTTTTGATGTCAGTACAAACGAGATCCGTTTTGCGGCATGCATGTCGCCCCGCATGCTGTATGTTCGTCGCTTATAGGATATCGAAAACGAAGCAGA
CACCCTCGTCATCTACTCGTTCAAGAAGGGAGAGGGCGTGGGCCAACATCCCAACACCAATCGTGGAGCGGCCACGATAAACTTCGTCACGGGAGACGTAGACACTCAGTGCGACGGCGA
GACCAGCTTCGTTTCGTTGCACGGCGCGCTGATGCTTATCGCGTGGATGATCATCGCACCGTGGGGTATCTACTACGCGAG
GTGAGCTGTATCGATACGATTTACCTGCCTTTGATTTTG
TGGTAGTCACTGTCTGAGGCCAGATCGCGACCTGAAAGCATGCCATAGCATCCAAATCTTCCCGTTCTCGTAGCTGGCTAGGTGAACTGCAACATCACCTTTCCAGCCGGGAGTGGGCAG
TATTGGGTGACTGGGCAAGACAACTCAGGTCGAACACATTTATAGCTTGCATATTAGGGACTGACCCGCCATACAACATATGCACCACTTACCCAATCATGGCGTGTTTCCCCGGCGTAC
CGATCGCTCAGCTGTAGTTGTATCGCGCGTGCTCTCGAACTGAAAACCACGGGGGGCGGTTGCCTCACGCACAACTATTTTCACTGAGACCACTCTTGTCCGAATGTTATTCATCATGCC
GTACACATCATCCCAGGTACCGCAAGGGCGACGCGATTAAGTGGGCTGGACGTGAGTGGTACGAGATGCACGAGGAAATCATGATCGTTGCCTCCGAAGCCGTGCTCCCCCTCGGGATCA
CCGCAGTGTTTGCTTCAAGGGGCAGGACCTCGGAAGCACACGCACGCTGGGGGTACTACATGATCGCCGCGGTAGCAATGCAGATCTTTACGGGCTGGATGAGGACCAAGGGGTTAGAGG
CCAAACACTCGAACTTTTCTCTCTTCCACAGG
GTGAGATGAACACGACATGGCGGTTGTACGCAAGGCGTGTGCACAATTTTGGTTCAACGCGTCGAGCCTGATGCGATTGCGCACACCA
ACAACGTCGAGGCTATTCTGCTGCGTAGTTAGATCGACTCGGACTAGTCGGGTACCTTGTTGGAGGAGAATCTGTCAAGTTTCTGGCAGCCGCCGTACGGTTCGACTGATGCTTTTGCTA
GTCAGATCGGCCTTGCTGCAGTGCTTGAAGATACGCCCTTTTCTTCTGAATACCACACCAAGGCTAGGCAACGTTAGACACGTTGGAGGGCATTGGCAACAAGTCGAAACTTCTCCTTAC
TAACTTGCACAGTTCAACAAGTTCTTCCACATCTGGGCTGGACGGTTCGCATACGCAGCCGGCGTGGTGCAGTGCTACCGAGGGCTGGAGCTCGTGTCCTCGGACGATGAGCTCATTTTC
TCAGCAGGCGATGGCCTTGACTTGCAG
GTGAAGCCATGGGAGCGACTCGTCAACCGCCGTCACCAACAGTGCAAGACGCCCTCCTTGTACCTGCAGTGAAATACCTGCGGCGACTTTGGG
TGTTCCCAGAATGCCGGGGTATGCTCCAATGGTATTCTAGGGTGTGTGGGACAACTTGTGTCGTTGAGAGGTACTGCGATTACGTACAAGAGCAAAGGACATGGCAGCGACCTCGTTCGC
TGGAAATATTCACCTGCTTCAGTATCGTAGAAGCGTGTCAAGCACATTTTTGTTTGCCTTTTTGGCATTCATGGATATTGTAACAATCTCCTATCGGATCATGCTGGTGGGGTCACAAGC
ACTTTCAACTTCACTCAACTCCTGCTGAAGTTCTGTTGCCCCTGATTCGACCGTCTAACAGCTCGGCAGCTTCGGTTGGGTCAAGGACATCTTGTTCCCAGCCTGGTTTGCGCTCATCGC
GGGCAGCTTTCTTATCCTAGAGACACAAAAGCAGTACCACCGGTTCTTCAAGAAGGGAGCTGCTAACGTGTGTGGCGTTGTGTCCATTGTCAACGAGCTGCACGACACATCTATTCGCAA
CAATGGTGGCCGGCTAATTCCGAGGACTTTAGACCTGCCAATATACAGCATATCGGCGTTCAATGACAAG
GTGAGCGATGACGATGGAAGTGTGACGTGCGGTTGTATTGGGAGGCGTGC
TTCGAATCGCTGGGTGTATGATTCGAAGAGTTGGTTTGATTCCGATGAACATGTTGAGACATCGACAATGGTAACAAGTTTGCGAAGAAGGGTTTCACAGTGCGCCCGGCTATAACAAGG
GCCGTACGTGGGGATATTTATCGCGGTGTCGCGTGTCGTGCCCTACCAAAATTGTTTCGGTGTATGTCGCGACGCAATGAACCTCAAGAGCGAAACCCATCCCATCGTTCCAAACAAGAT
GGTAGAAAGCCCCTTGACCAATGCTACCCACAGCATGCTTGTCTTTGAGCTTTCGAGACGCGCAATGACTTGAAACGATCCCATCGTCCAGTATCGAAACTTTCCTTAGGGATTTCATAC
GGACCCCAGCTCTACCACTACATACCCTGTGTGGTGCACATATCTCTTGGAGCCCGAAGCCCACCTGCCTTCGTGACCACCTCTTTCCGGCCAGGTGCTGAGCGGCCAGACCTGGTTGAT
GGTGGATGAGGCAGTTCTGGATGTGTCCGACTTCGCACAGAGGCACCCAGGGGGCAGGCGACTCATCCTGAACGCCCTGGGAACGGACGTTACACAGGAGCTGTTAGGACAAGAGAACTC
CGTGGGGCATGCCATGTCCTTCCCGCCCCACGTGCACACCGGG
GTAAGTGAGCGCTTGACAAAGCCAGGGTACCCTGGTCTTGAATGTGCGTACAAGCTTAGCGTCAGGTGCGTCGTTGT
GTTACCCCCCACCCAACAGCACCAGAAGATGCTGTACGTGGCGAAGCACTACGAACCGACTCGATCATTGCACCAAATGTCCACCAGAGCGTGAGACCAAGCCTATAGCAAAACATCCAC
CAAGCGACCACCTTCGCCTCCCTCTATCCCGGCAGTGATGTCTTGTTCATGGCGCAAGGGGGTCGGATGCTGCGATATCTCTTGGACGAAGTAGAAGGTATTTTTGTCGCCAACCAAGAA
GTGGGCCCTCTCGCTCACCTGTTTCGCCCACACCTTGCCGTGCCTTCTGACCGGCAGAGTGCATGGCGAATCATTCGGTCGCTAGTAGTCGGCTACATCGAGGAGAAGGACGTCGGGGAA
CCTGCGGCAGCCCTGGAAGATCAACAGGAGCAGGAGGAGGCAGAAGAGAAAGTCGAACCCTCGACGGGAGATCCTGCCTGTTCTGGCACCAACAACCGCAAGATCCGTGTCGCGGGCAGG
GCGGTAATGCTGACCAACCGGTTGGCCCTGGGCGACGACAATCTG
GTAAGTCACGAATCTACGTTATGGATCGTTGATCATTGGACAGCAGAGACTGAGAAGTGCATATGGCCGACTCAT
GTCTCGGAAGATCTGCGTGTTTATCGTTTTCTATTATTGTGACTGGGATGTTGTGAGCCGACGGGAAGCTGAATACGCCCAGCCCATTGTTCACATTCCGTAGGTGCTTACGCGACAATT
AAGTCTTATGGGTGAAAATCTAGGAAACGCGTATCGAAAACAGTTGTTGACGTGTTTCTATTTCGACGACCAGTGCGTGAGGGGGGGGGCAGCAACTAGGTCCCTGTGACATATACTGGC
AGACGCAGCTATCGCCCACGAATTGATGTTGATTTTTTCCAATAACACATGGAACGAACTAGTTATTTACCCGTTTGCACGCGGCCGACCCGGCCGTGGGGGTTGGCACGGAAACATGCT
CTGCAACGTCTTTTCCAGGCAACCAAGGCGATGCGGCTGAACGACTTGGCGGCTATTCCGGCATGCATTCCCGCTCCAACCAGGCGCCCCACGAATTTGGTGGCGACGAGTAGCTCGGCA
AGCCGCTTCGGCAACCAGCCCAAAGAGATCGACGCT
GTAAGTCTCCCAGTCGCTCTTGTTTTCGGTTTCATTGACTGTAGTCGCACTCTGATCCCTATCAAATGTAGGGCAGTCAAGGAT
GATGAATGGTGATGTAGTTGTACATTCAGATTGCCCCGCTGGTTCTGCGGCGGCTTCCCCCCCGACGTTTAGCCAACACATCGTGTGGAAAAATCCGCGTGGGAACACGCGGCGTTGCTC
GAGAGAAACGCCCGCAGGTTATTTGCACCTGCCATTCAAGTTGAAGGCTGACGTTACCCATGTGTTTTGTCTTTCATAACTGAAACGATTGTATTTGTAATGTTTCAAAGCCTCAGCGCG
TCGATGACAAGGAAGGCGTTCTGGGAAGCAACACGGACTTGTTCGAGCGGTTTCAAGTATGCCCCCTGCTCTTCCGAGAGAGGATGGGAGCCGCCAGTGCCGTGGGCCGTGGTCACTTGC
CCAGCAAGCGCCCGGTCTACCGATACATTTTCTCGTGTCCCGCCAACGGACAAGCCCAG
GTATGCACACCTTCGTTTCCCTTCAAGCGGACGTGCAGTCTTTTATGTTTAGCGTCCAAGC
TCCCCTCCGGCATGCTTACTATACGAGGTCACGCCCGCCAAGGCAGAATTTGTTTCAGCCGCTCCCTGTGCCCTCTGAAGAGCCGACCCGCTAGCGCAAAGACGCTCGAAGGTACGGTCG
TCGAGCCTGTCTATGGACAGATAATCGACAACAGTATGGAGAAATCGACTATAATATTAGGGTCTGTCGAACGCATGCCTTTGAGTACGACACGCATGACATGTGTGGGGTCGGACTATC
AAGTCCTGCCGTTTGCGAACCAAACGGCGTCGAATCCCATCAACATGTGACAAAAAAAATGCGCTTTTCTCCATGGCCTTTTGCGCTGGTGTCGTTTTTTCTTGCAAGACATACGTATAC
GGTCTCTGATGCTCTCTTGCGCGGTATTCATGTTGAGCATGCCCCTGGCCAAGAGAAAGTTCATGCACGGCTCAGGTGGTTTGGAAGCTTGCCTTCGGCGAAGTACATGTCGAATCAACA
CCCTTTGCCCCATTGTTTCCGGTGCAACAGGCACAGGCGGTTTCAGGAGTCTGCTATTTCAACATGCGCGCCCAGGAAGAGGGGAAGGTGAGAAATGGATTATCTCAGGATGAAGCTCTG
CAGCAGCACTCCCGTAGACCTGTACTGCTTTCGGATGAATTGTGGCAATATTGCTACTTGCACCGGCTAGCTGACCACACGATTGGAGACGATGCCTTCAGTGCTGGCCTTATTTTTATA
TTTTCTTTGAGCTGCGTTCTGCGTCGCAAGGCAGCGATGCTAAACTTTGAAAGGTCAACAGTGTTCGGGTCCGTTCAACCGCAAGGCTGTCTGCCAAGAATGTTTCCCTGTTTGCCGTAT
GAATGCTCAAGACTCCGCTACGGATACTTGCCTCCACAAAGTTCTTCGAGCAACACATGAGTGCCACCCGTGTTACAGCGGGCAGTTGTGTACCACCATCCAGGAAACGATGAGGGTTGC
CTGGCGTTTCCTGTGCGTGAAATATCAATGGAAGTTCCTCAATAACCAAGCATATTGTGGGTGGCCGGAGTTACGGACCAAGATAATCGATTTTGGTCGTTGGGGGCAGCCTCGTGTGAT
ATGGAGAAAATCACAGAGAGCTCCCGAAGTTGAAAGTAGACAAGCGGATTGACGACTGCATTTGCTGCATCAGTGAGTGAGGCATCCAGTTATTTTTTGCCCAAAAACAGCGAGTGGCGG
AGCCCGAAGCTTCATGGAAGAATCTTCTTTGAACCGTGTTGTTCGAGCACTACAGTTACTTTCCTTCTTGGGTCCAAGCCCAACTGCCCGATCGAGTATGTGTGATTCGCTTTCTATTCA
GCGGCCTTGTCTTTGATCGAGTACAAGCAACTAACCAAGGTGTTGTTTACATCTCCGCAACAGGGTGTAGTACAGCGGGCGTACAATGCCTTTGCTGTCAGATTGCTGGACGTCGAGCCT
CCCACACCAGGCGGAAGGGTGGCCTGGACCAAGGGCTTTGCCAAGCTGCCGAAG
GTATGCACAAGCGAGACGAAATTACCATCATATTCGGGGTCGATGAAGCATCTCGCTCTTTGAGTG
GTTCGGTAGAAGACCTGGACCTGAAGTTTGTTGCACAATCGATGGGCACGCCATGAACATCTGCACCGCAGGACAAGCGACGAAATGTGTGTCAATAAGCTCTCGACTTGTTTGAGCCCA
GCATCGATACCGAGGTTTAACGCGTGTTGCACTCGTGACGATTTCTCCTTTATTTGGAAGATTGTACCGGCGGGAGAGACTACGGAGGGCATACTGTGCATCGAGATGCGCATCAGGATG
TACCACGACGGGGCCATGAGCAAACTGCTAGAAAAACTCTCACAG
GTGAATGGGGTTCGCGCGAAGTTGTCTTTTTTTGCTGATAGTTTTTGCCGCCCAAATTCATATGGTTGGGACTTT
TTCGCGTTGCATAGGCTATTTTTATTGGAGGCGCGTGTTTTTCCTGATACATGTTCAAGAAATTTAGGAGACCCCAAAGATGTTCGGTACTGTTGTTGCATCGTCTTCTATGTTAACGAA
ACGGCATCTTTACTACGGGTGTAACGGGTACCAACAAATCTCCGTCATGGTCGTAGATGAAGATGCGCCACCAGATTAACTCCCGTAAACTTCACCCTATTCTGGATAGAACGGGTTGTA
ATCCGAACATGTGTCAAGAAGCTACTCCAGCACATTGTTTTTTCCCGTTAGATGAAGAGGGTAGCCGACCCATGTCATGCTTCTTTTTCGTCCTTTCGTCGGCTTCAACTCTTGTCCAGG
ATACGGACAACGCCGCCGTCCAGCTGCAAGGACCATTCCTCATCAACAAGCTTGCCCCACCACCCGTCTATCGCAACGTTATCATGATTGCGGCAGGCACGGGCGTCAACCCGA
GTGAGT
ACGATAGTTTCGGACTCATGGATTGTCTCGTGCATACTTTTTCCCAACTTTCGTGTGCAAGTAATGCCGCTCCATTGGAGCTTACAAACCATCATGGTTGTTTTTTGGCAATCAGAACGT
ATGTCTTTCGCTTGCATCGTGTTTCAGAGCTTGGTGTGCGATACGCGAAACTTGCCGAGGAGTTAGTGCACGCCCATGCGTTGCAAAGGGTGCCGGACATCGCCTCCTTCCTCGACATGT
TCTCGTGGAACGTGTTCGTCAGTGCAAAATTAACAACTTGCGCCTTCGGTACACATCGATTTGCCCCCCACGACATCAACCGCGCTACCACCGCCCGACACGTGAAACGACCTGGGTGCC
AGAGGTGCTCTCACGATGCTGGCGACGACCCTCCGCAGCCGATTGCTGCCCTAACCCGACGCCCCATTGCAACCTTCGCCTTGTCTCTCGTTTCTCCTACGTGGACTCACTCTCGATGGA
ACTTCCCTTTACTGGTGGTCTTCGACGGTCGAACAAACGGCCCACGGCATCGACAGTGGTCCAGCAGATTCGGAATTATCTAAGTATTCCCAGGTGGGCGGCAAATCGTAAACAAAGGCC
AGGGCTAGCACTATTCCGGCGTTTCCGAAAGCCTCTGGGTTGCGGATGTGTCGCATGAAGCAACTCGCACGTTAACGCGGGATCCCCTCCCTTCGTATTTTCAATTACCCCAGGGACACC
ACGTTCTCCACGAGGTCGCGGCTGGTCCTCGTGTGGCAGAGCACGACCGAGGCCGACTTCTACGGTACCGATGAAATCACGGCCATGCAA
GTGAGTTGGTTGCCCTTGCAATCATCAGTC
TGGATATGTAGGGGACATCTCGAATCGTCAAACTTGGTGATAAGGACATGGCCGATCCATCGGCATTACTTCACAACAAGCAAAACGTCTCAATACCTTCAAACCGTTGCTGTATCCGCT
CGACCCTTGCTTCTTGACACTGCGACACCAGGAGAAGAGCGATGGACTCCTCGAAGTGACTGCTCTCGTTAGCGAAGGAGGTCGTGCGCGGAATGCTCCCGGTGCAGCCTTCCGTAAAGC
GCGTGACATGGCCCGGAACGTCTTCGCTTCACCAGCGCATTCTAACAGCAGCACGCTCAATCCCTTCACTCCTATGGGGTATGACACCACGATGAGTTTGGAGTCATCCGATTCTCTTCC
CCAGACCCAGCGCTCACGTTTGTTGCGAATTTCGACCTAAACCTCTCTTTCGCCATTTGCAAGGTTAGGCGTATCAAAGACAAAGAAACCGATCTTGGGAGCTTGAAATCCGAGATAATG
TCTTGGCCCTCCGGTTTTTGCACGTGTCCAGCCTTCCCTTGCGTGCTCACTCTTGTACTCCGAAGTTCCTGTGAGCAGATGCCAGAACGCCTTGTGGCCGCGGTGTGATTCTGTGCCGCC
GTGTTCGATGCTTGATTGCCATTTTATGCGCTTGTTTCGTTGGTGTATTTCATACTTACAAGGATTTGCCATGGAATGATTCTAGCAGATTCCTCCCTCAAAGCCAGGTTACGGCAGCAA
TCCCAGTCGCAAACGGCAGATACACAACTACGCAGCAGTCCCACGAATGCTGCCGCTACCTTTTCACAACCGTCGCCAGGTTCAACTTGGACAGCAGCTCCGGGAAACCTCCGCCTTACA
GGACGCCGTCCAGAACTGGTCACGGGGATGAGCAGCCCCCCCCGTACCGCACCCCGGGTCGTGACGGGAGCAGGCCTGCAGATGGGAAGGAAAAAAGGACCACGACTGGCGTTGGCAAGC
TATTGCCCAAGAAG
GTGAGTCGTGAAAAGCACGGCCGGAAGCAGGCACATGGGTGCATTTGTGGAATTGCCCCAAATTGATTAACGTGAGGGCAGGATGGTCATGTCGACCTTGACTGAC
AACCACTCGGCGTTGCTCGCACCCTCAAAAACGCAGCTACACCAGATGGAAACCACCAGCCGCATCTCGTTGGGCTGATTGGTTGCCTCGAATACCTTTTGGCACACGGCCGTTGTTCGT
CGTAGCCCTGCTGAAAGTGCAGTGAGGACCAATTCTGAAGAACGGCGACAGCGGGGGGTCGTTTGGTGTGGTTTATGGCAGGTGTGATGATCATGCCAGTTCGCAACAAAACGTCTGGCT
GCGTCGAGGGCATGAGTATGTTTGCTGGATTGAATGAGGTATTCGCACGAGCGCGGCGGGATGGGTTGCCGGACGAACGTGAAGGAGACGCCTACCGGCAGCTGTAACGCATGGGCGCAG
CCCGAGTATTCTCCGCGGGGCATTGCTGATCGTCTGGGGCGTGCCATGTGTACCACAACTAGAGGGGGCTCCGTACAGTATTTGGTACTCGAAACGTATGTGGGCCGCGTGTCCATTTCT
AGATGGCTTATTTGGCTCCATCCTCACACATATATCTATCTACCCCTGCTTCTTACTCTCCGCCCGTTCTCTTTGGCGCTTCGAGCGAAATCATTAAAAAAAATTGTTGGGCCTCTTATG
TATGGGAGGCGAGCTGTTTTCTAAGCCTGCGAAAGTACTGATATTGTCGGCATCATTTCAACCTGCGCATAGACCACATGTTGGACTTGATGCCTGTGGCTCGTGCATCTTCCGATGGCC
TGTTGTTCCCCATGCTGCTGCAGACCTGGCGCAACCTGCGGCGGAGTGACAGCTCAACGCCAGGTGCTCACCGTCGTCCACCTATTCAAGACAGCAGCGTAAGTCCGTCGACATGTACAG
GAGTGCGAAGAAACAGACGACAATAGATGCAAATGCCAGAGAGGAGGCTTCTTGTAAGGTTTTGTGGGACCACTGGGATCTGCATCACCTGCGTAGTAGAAGGTTTGTCACCATTGAACA
TACAACGCGTCCGTCCAACTTGTTCGCTGCTCTGGCCTGTGATTGCCAGACCTATCAAGTGGGAGATGGCCTCGTCCGAGGCAAAGTGAACAGGGAGATCCTCGAGACGGTCTTCGGCGA
AGCGCTGACGACCCCGATAGCGGCGGATAACCGCCAGCGAGAGGTGAAAAGCCTTCTTCGAAGCGACAGCGACATCTCGGACGAGAAGGAAGGACAAGACGAGGATGATGGGGATCTTAC
AAGCACCGACCAGACCTCACGGAAACTTCAG
GTGACAGTGAAAAATTGTTTGTTGGATCGAGCGTATCTTTCTACGCTCCTTTCGATGGAAGGTGTGCTGCTGCTCCTTTGTCGTGCATG
CAGGCATGGGGATGGCGAGTACGTGCAACGCGTTTGAACAGGTGCTTTCCTGAGAAGGAATTTTCCTCCTCGCCGGCAGTCCCTCGAAAGGCACAGTGGTGGTCAGTATTTCTATGGCTT
TATCGGATATTCGAGTCGGACAGCGGATAGTCAGGTTGAGACAGCTGCCAGCAGCAAGACTGACGAATGCTTACACCCCCGTCATGTAATACGTGCTCTGCCGTCAGGTGGTTGTATCAG
GGCCTAGCGAGTTTGTGGCCAACGTGTGGCAGCTCCTCGACCAAATGGGGGTCCCCTCTGGCTGCATGGTGTTGCTTGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACAATCCTACTTGGGGCGCTGCAGGGACAACCCAGGGAGCTGATGACGGATGTATTTCTGTCGTCTCCACCATCCGTTTCTGACATGAACGCGGTTGCCATCGCTTGGGGACAG
CTGCTGCTTCTCGATTTGTCCTACACCGTCGACAACAGCTCGGAACCCTTCGATATCGCTTGCGATGACGGAGGGGGCTCCGTCGATGTTTGGTGCCCTCTGGGGGAGGCATCTGATCCA
ATCCCTTTTTTCAGATCCGAAGCTACGGTGACTGATTCTGTGCGAAACCCGATCAATTATGCGTCCTCGTTTATCGACCTGGACTTCGTCTATGGAAGGAGCGAGGACGCTGCCGATGCA
CTTCGTACCTTTGAAGACGGAATGCTGAGTATGGCAGATGACAACATGCCCATCAAGAACGACGACGGGACTTGGTTG
ATCGCGGATCAACGTACGGCGAGATTTCCACTGACGTTCGCT
CTTCACGTCGTTCTCCTTCTCGAGCACAACCGCTGCTGCGTTGACGTCGCGCCCGGCGAGAACTACACGGGCGATGAG
GATATTTACCAGGCTTGTCGAGGCTGGACCATTGCAACATTC
CAGCACATAACTGAAGACGAGCTTATGATTCTACTCATGGGAAGAAGCATCGGCGATTGGACCGTGTACCAAGATGACGATGACGGCGGCAGACGAAGACTATCCCCAGAACAGCGGAGG
GAGCTGTTGTTCACTTTCGACTACTACAACGACACCGTGGACCCGTCCGCCGACGTCTTCGTGACGGTGGCCATGACCGCCGCGTTCGAGTCGGCGCTGCCTTCTACCCTCCGCATTGTG
AGCGAGGGGTATGTTGCCACTGACTACGACCACCTTGAGCTCACCGTTGCGGCGGAAGATATCACGGGCCTGTTCGAGCACAGCGCGATCGGGGACATTCTGCGTGGGGCGGTTTTGTCG
CCTGCGATGGCGGTGGGGGCGCACTACGCTTCGGCGGTGTCGAACGCCTCGCCGCTGTTCAAACTCCCTGTGGACATGGTGCAGCGGGGCCGTGATCATGGGGTGCCATCGTACAACGAC
GTCCGGGGG
GCGTATGGTCTTCCGGAAGCCACGGACTTTTCAGATGTATCGTCGGATGGAGACGTGGTGCAACTCCTAGATGCTGCGTACGGTGGAGAAATCGACAACCTCGACGCGTGC
ACAGGAGCCTTGGCGGAGGATAAGGAGGCGAGCCTAGGTGGTATATTCGGCTACCTGCTGCATACCGCATGGGTGGACCAGTTATACAGATCTCTCTTCGGGGACCGGTACCACCACCTT
CACTCGAGGCCGATCGAGAACGTGTCACTCGTGTCTATCTCGCAGCTACTCAACCGCACGCTCGGCTTGACCGCCTTGCCGGAGTCGGGGTTCACGGTGCCGGAAGTCACTGTTTGCACC
GGGCAATGCGAAGCCACGGGTACATCGGGGGTCTCGTTGGCTGAGCGCTACGGCATATCGTGGGAG
GTGGAAGATGAAACACTACTGATTTCTTTGAGTGTCCTGGGCATCGGCGACAGC
GGGATGATAGGAATCGGCTTTGGAGGCTTGTCCATGACGGACGCCCAG
GATTTCATTATCTGTGAGGTCTTCTCAACGGGCGGTGCCGAATGCACTGACCGGTCTCCCACTGGAGGGCGA
TCGGAGCCGCAGCCGGACACTTTTCAATTGGGCCTCGAAGTTACCAATGTAACGACGGGGGGAGGCTGGACTACAGTGAAGTTCTCGAGGGAACGGGCGACGCTGGATGCAGAAGACTAC
GACCTCTTTGAG
GATATCGAAAACGAAGCAGACACCCTCGTCATCTACTCGTTCAAGAAGGGAGAGGGCGTGGGCCAACATCCCAACACCAATCGTGGAGCGGCCACGATAAACTTCGTC
ACGGGAGACGTAGACACTCAGTGCGACGGCGAGACCAGCTTCGTTTCGTTGCACGGCGCGCTGATGCTTATCGCGTGGATGATCATCGCACCGTGGGGTATCTACTACGCGAG
GTACCGC
AAGGGCGACGCGATTAAGTGGGCTGGACGTGAGTGGTACGAGATGCACGAGGAAATCATGATCGTTGCCTCCGAAGCCGTGCTCCCCCTCGGGATCACCGCAGTGTTTGCTTCAAGGGGC
AGGACCTCGGAAGCACACGCACGCTGGGGGTACTACATGATCGCCGCGGTAGCAATGCAGATCTTTACGGGCTGGATGAGGACCAAGGGGTTAGAGGCCAAACACTCGAACTTTTCTCTC
TTCCACAGG
TTCAACAAGTTCTTCCACATCTGGGCTGGACGGTTCGCATACGCAGCCGGCGTGGTGCAGTGCTACCGAGGGCTGGAGCTCGTGTCCTCGGACGATGAGCTCATTTTCTCA
GCAGGCGATGGCCTTGACTTGCAG
CTCGGCAGCTTCGGTTGGGTCAAGGACATCTTGTTCCCAGCCTGGTTTGCGCTCATCGCGGGCAGCTTTCTTATCCTAGAGACACAAAAGCAGTAC
CACCGGTTCTTCAAGAAGGGAGCTGCTAACGTGTGTGGCGTTGTGTCCATTGTCAACGAGCTGCACGACACATCTATTCGCAACAATGGTGGCCGGCTAATTCCGAGGACTTTAGACCTG
CCAATATACAGCATATCGGCGTTCAATGACAAG
GTGCTGAGCGGCCAGACCTGGTTGATGGTGGATGAGGCAGTTCTGGATGTGTCCGACTTCGCACAGAGGCACCCAGGGGGCAGGCGA
CTCATCCTGAACGCCCTGGGAACGGACGTTACACAGGAGCTGTTAGGACAAGAGAACTCCGTGGGGCATGCCATGTCCTTCCCGCCCCACGTGCACACCGGG
AGTGCATGGCGAATCATT
CGGTCGCTAGTAGTCGGCTACATCGAGGAGAAGGACGTCGGGGAACCTGCGGCAGCCCTGGAAGATCAACAGGAGCAGGAGGAGGCAGAAGAGAAAGTCGAACCCTCGACGGGAGATCCT
GCCTGTTCTGGCACCAACAACCGCAAGATCCGTGTCGCGGGCAGGGCGGTAATGCTGACCAACCGGTTGGCCCTGGGCGACGACAATCTG
GCAACCAAGGCGATGCGGCTGAACGACTTG
GCGGCTATTCCGGCATGCATTCCCGCTCCAACCAGGCGCCCCACGAATTTGGTGGCGACGAGTAGCTCGGCAAGCCGCTTCGGCAACCAGCCCAAAGAGATCGACGCT
CCTCAGCGCGTC
GATGACAAGGAAGGCGTTCTGGGAAGCAACACGGACTTGTTCGAGCGGTTTCAAGTATGCCCCCTGCTCTTCCGAGAGAGGATGGGAGCCGCCAGTGCCGTGGGCCGTGGTCACTTGCCC
AGCAAGCGCCCGGTCTACCGATACATTTTCTCGTGTCCCGCCAACGGACAAGCCCAG
GCACAGGCGGTTTCAGGAGTCTGCTATTTCAACATGCGCGCCCAGGAAGAGGGGAAGGGTGTA
GTACAGCGGGCGTACAATGCCTTTGCTGTCAGATTGCTGGACGTCGAGCCTCCCACACCAGGCGGAAGGGTGGCCTGGACCAAGGGCTTTGCCAAGCTGCCGAAG
ATTGTACCGGCGGGA
GAGACTACGGAGGGCATACTGTGCATCGAGATGCGCATCAGGATGTACCACGACGGGGCCATGAGCAAACTGCTAGAAAAACTCTCACAG
GATACGGACAACGCCGCCGTCCAGCTGCAA
GGACCATTCCTCATCAACAAGCTTGCCCCACCACCCGTCTATCGCAACGTTATCATGATTGCGGCAGGCACGGGCGTCAACCCGA
GGACACCACGTTCTCCACGAGGTCGCGGCTGGTCC
TCGTGTGGCAGAGCACGACCGAGGCCGACTTCTACGGTACCGATGAAATCACGGCCATGCAA
GTTCAACTTGGACAGCAGCTCCGGGAAACCTCCGCCTTACAGGACGCCGTCCAGAACT
GGTCACGGGGATGAGCAGCCCCCCCCGTACCGCACCCCGGGTCGTGACGGGAGCAGGCCTGCAGATGGGAAGGAAAAAAGGACCACGACTGGCGTTGGCAAGCTATTGCCCAAGAAG
ACC
TGGCGCAACCTGCGGCGGAGTGACAGCTCAACGCCAGGTGCTCACCGTCGTCCACCTATTCAAGACAGCAGC
ACCTATCAAGTGGGAGATGGCCTCGTCCGAGGCAAAGTGAACAGGGAG
ATCCTCGAGACGGTCTTCGGCGAAGCGCTGACGACCCCGATAGCGGCGGATAACCGCCAGCGAGAGGTGAAAAGCCTTCTTCGAAGCGACAGCGACATCTCGGACGAGAAGGAAGGACAA
GACGAGGATGATGGGGATCTTACAAGCACCGACCAGACCTCACGGAAACTTCAG
GTGGTTGTATCAGGGCCTAGCGAGTTTGTGGCCAACGTGTGGCAGCTCCTCGACCAAATGGGGGTC
CCCTCTGGCTGCATGGTGTTGCTTGACTGA

Retrieve as FASTA