Entry information : EsilPxd03 (Esi_0083_0098)
Entry ID 16972
Creation 2021-02-04 (Christophe Dunand)
Last sequence changes 2021-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilPxd03 (Esi_0083_0098)
Name (synonym) EsilPxd03 (Esi_0083_0098)
Class Peroxidasin    [Orthogroup: Pxd003]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilPxd03
start..stop
S start..stop
EsilPxd02 2566 0 1..1490 1..1489
EsilPxd01 1060 0 282..1262 356..1344
EsilPxd01 292 2e-80 10..220 82..302
EsilPxd01 73 0.0000000000005 1329..1490 1445..1627
EsilPxd04 815 0 17..884 1..805
EsilPxd04 278 8e-77 987..1262 836..1095
EsilPxd05 504 4e-161 10..679 87..763
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 565069..565109 41 N° 2 565629..566025 397 N° 3 566334..566453 120 N° 4 567116..567646 531
N° 5 567965..568381 417 N° 6 568980..569084 105 N° 7 569808..570011 204 N° 8 570274..570494 221
N° 9 570889..571144 256 N° 10 571476..571610 135 N° 11 572010..572252 243 N° 12 572793..572981 189
N° 13 573312..573536 225 N° 14 573929..574054 126 N° 15 574435..574623 189 N° 16 575159..575215 57
N° 17 576351..576461 111 N° 18 576714..576818 105 N° 19 577374..577488 115 N° 20 578289..578385 97
N° 21 579197..579392 196 N° 22 580156..580230 75 N° 23 580422..580643 222 N° 24 581122..581217 96
join(565069..565109,565629..566025,566334..566453,567116..567646,567965..568381, 568980..569084,569808..570011,570274..570494,570889..571144,571476..571610,57201 0..572252,572793..572981,573312..573536,573929..574054,574435..574623,575159..57 5215,576351..576461,576714..576818,577374..577488,578289..578385,579197..579392, 580156..580230,580422..580643,581122..581217)


exon

Literature and cross-references EsilPxd03 (Esi_0083_0098)
Protein ref. GenBank:   CBJ27734.1
DNA ref. GenBank:   FN649064 (565069..581217)
Protein sequence: EsilPxd03 (Esi_0083_0098)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1490
PWM (Da):   %s   162508.07  
PI (pH):   %s   4.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTILLGALRGQPRELMTDVFLSSPPSVSDMNAVSIAWGQLLLLDLSYTVDNSSEPFEIACDDGGGSVDVWCPLGEASDPIPFFRSQATVTDSVRNPINYASSFIDLDFVYGRSKDAADALRTFDGGMLSMADDNMPIKNSDGTWIADQRTARFPLTFALHVVLLLEHNRCCVDVAPALNYTSDEDMYQACRGWTIATFQHITEDEFLILLMGRSIGDWTVYQDDDGGSRRRLSPEQRRELLFTFDYYDDLLNPSADVFVTVAMTAAFESALPSTLRIVSEGYVATDYDHLELTVAAEDITGLFEHSAIGDILRGAVLSPAMAVWPHFASAVSNASPLFKLPVDMVQRARDHGVPSYNDVREAYELSKATAFSDVSADDDVVQLLYAAYGGEIENLDACVGALAEEKEASLGGNFGDLLHTAWVNQLYRTFFGDRYHHLHSRPIENVSLASISGLINQTLGVTDLPASGFTVPEVTVCTGECEAAGISGVSLAERYAMSWEVIDDQTISISLSVLGIGDSGMMGIGFGGLSMTDAQDFIICEVFSTGGAECIDRSPTGGRSEPQPDTLQSGLQVTNVTTDKTWTTVTFSRERATLDAEDYDLFEDIENEEDTLVIYAFKKGEGVGQHPNTNRGAATINFVTGDVDTQCDGETNFVSLHGALMLIAWMLIAPWGIYYARYRKGDAIKWAGREWYEMHEDIMIVASEAVLPLGITAVFASRGRTSEAHAHWGYYMIAAVAMQIFTGWMRTKGLEAKHSNFSLLHFNKHFHIWAGRFAYAAGVVQCYRGLELVSSDDELIFSAGDGLDLQLGSFGWVKDYLFPAWFALVAGGFLVLEAQKQYQRFFKKGAASVCGVVSIVNELHDGSMHKGRLIPRTLDLPIYSVAAFNDKVLSGQSWLMVDEAVLDVSDFAQRHPGGRRLILNALGTDVTQELIGQENSVGHAMSFPPHVHTGSAWRIIRSLVVGYIEEKDAAEPTAALEDDQEQEGEEKVDTTTGDIPVPDANNRRFRVAGKAVMLNNRLALGDDTLATKAMRLNDLAVIPAPTRRPSRTAASNNPASVVGNPPIEMDVAQRADENDGGWGSSTDLLERFQVCPLLFRERMGAASAVGRGHLPSKRPVYRYIFSCPAKAQAQAQAVSGVCYFNMRAQEEGKGVVQRPYNAFAVRLLDVEPPTPGGRVAWSKTSAKLPKVVPAEETTEGVLCIEMRIRMYHDGAMSKLLEKLSKDTDNVAVQLQGPFLVNKLAPPPAHRNVIMIAAGTGVNPRTPRFPRGRGWSSCGRARRRLTSTVPTKSRPCRSNLDSSSSGKPKPPPYSTLARDGGRDEQPPPYRTPGREEKKRSAADAGAKKERAPTGVGKLLTTRTWRNSKWNESPTTSGRRRAPMQDTSNYQVGDGLVRGRVNREILETVFGEALISSIAAYNRQRALNSLACSDSDVGDNKEGEGEDDRDLIGTDQTAGKLQVVVSGPTAFVANVKQLLTEMGVPAGSTVLLD

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACAATCCTACTTGGGGCGCTGCGGGGACAACCCAGGTGTGGTGACAAGCGCAACAATGCGTCCATGACCCACGACACTCTTCCTAAGTTGGTCGCACGTATATTCTATGGCGGA
AAACAACAGGGCTCGAAGGCCTTTGAGCTCATTAGCGGAAAATGACGTTAAGTTGGGGTTTTTCGACTCTGTTTTCGACGCTAGCCAGTTCACTCGGCCGTCCCCCAACACCTCGCTTCG
GTTGCACCTTCCTCCTCTTGCCATGCCCCGCGGCCTACTTTCCAGATACGTTCGCCAGCTGAATATTCGTTTGCGGACGACGCATTCACTCCGCTGGAGGAATTTAGGCCGACTGCGAGG
CAAGTACGGCCGTAAGAGGATCTTGTTTCATCGGAGGCGTCATGCCGAGAACCAGTTGTTTCTAACTTTGGTATGTTGGCACTGCCCTCACTCCGCGTTCGGGCTCGAACGGGCTTTGAC
ATGTCTCGGCTACGTGCGCCTAACCCACTCATCACCGTCTGTACTCTGTACTCCTTTATTTCTCCCGCAACCGTTGACAGGGAGTTGATGACGGACGTGTTCCTGTCGTCGCCACCGTCC
GTTTCTGATATGAATGCGGTTTCCATCGCTTGGGGACAGCTGCTGCTTCTCGATTTGTCCTACACCGTCGACAACAGCTCGGAACCCTTCGAAATCGCTTGCGATGACGGAGGGGGCTCC
GTTGACGTTTGGTGTCCTCTGGGGGAGGCATCTGATCCAATCCCTTTTTTCAGATCCCAAGCTACGGTGACTGATTCTGTCCGAAACCCGATCAACTACGCCTCCTCGTTTATCGACCTG
GACTTCGTGTATGGAAGGAGCAAGGACGCTGCCGATGCCCTTCGTACCTTTGATGGCGGAATGCTGAGTATGGCAGATGACAACATGCCCATCAAGAACAGCGACGGGACTTGGTTG
GTA
GGTTGGCGAGGCCAGTGTACTTGTAGAAGTTTAGAACAGCAGTGTCGAGCGCGCAGCAGAAGATTTATCCAAGTTGCGAGAACCTAGATGGTCGACAGGTCGTGTCTGTGACAAGCAACG
GTTTGTATGTACATCTGCACTGCGGTCAACAACATGTTGTCTACATTCGTTGTCCCGATCTTCATTGTCCCGAACTTGTTCGGTTCGGGAACTATCCATCGATGTATTGCCAACCAGTTG
ACAATCTGTATTGGCCTCCATATTTTCTTGATTTTGCCGCTGTCACCTTGTCACCTCTACGGTAGATCGCGGATCAACGGACAGCCAGATTTCCGCTGACGTTCGCCCTTCACGTCGTTC
TCCTCCTCGAGCACAACCGCTGCTGCGTTGACGTCGCGCCAGCTCTGAACTACACGAGTGATGAG
GTCAGTCATGCTGAAGATAAGATACCCGCTTCTTAGGGAGCACACAGGCTTGTGT
CGTGCCTGATTCCTTGCCGCAACTTCGATGGAGCATCATTACGTCGTCCTATTCGTTTCGATCGGAACAACAGAAAAAAATATTTGTAAAGAAAGAAATACGGAGTTGTCCGTTAAGGTG
ATTGGCTTGGGTTGCCATACCCACCCCGCATAGCCAATAGTGGCAGTGGATCGGCGTGTCCCACGTGTGTGCGCCAGCAGGTGTGGCCACGTGCCCCCATTCATACGCAATCGCGTCGAA
ATTGTTCGTTTGACCAACCCCACATGCATTTTTTGGGCTTTGAAATATCAGATTGAACCATGAACCAGAATCGTCCCCTTTCGCGCAGGAAGCCACATTATATGCTTGGCGAACGCAGAG
CGTAGTGTCATGTTGAGATCAGGAATATTTCACACGAAGAACCACTCATTCCTCTCTTCAGAGACTCGAGACTCGCTCAAATATTATGTCATGAGCTCGAACAGCAGTGCACATCATGGC
TTTTAACGTATATAATTTTTCCACTGCTCACCCGATGTTGTTGCCCTAAGACGTGCGGTTACCTCGCACCTCACTGACGTGCAACCCGCCGACCTCACACACAACAAACTCCTCGGTTGC
TGAACAGGATATGTATCAAGCTTGCCGAGGCTGGACGATCGCCACATTTCAGCACATAACTGAAGATGAGTTCTTGATTCTACTAATGGGAAGAAGCATCGGCGACTGGACCGTGTACCA
AGATGACGATGGCGGCAGCAGACGCAGGCTATCCCCAGAACAGCGGAGGGAGCTGTTGTTTACTTTCGACTACTACGACGACCTCTTGAACCCGTCCGCCGACGTCTTCGTGACGGTGGC
CATGACCGCCGCGTTCGAGTCGGCGCTGCCTTCTACCCTCCGCATTGTGAGCGAGGGGTATGTTGCCACTGACTACGATCACCTTGAGCTCACCGTTGCGGCAGAAGATATCACGGGCCT
GTTCGAGCACAGCGCGATCGGGGACATCCTGCGTGGAGCGGTTTTGTCTCCCGCGATGGCGGTATGGCCACACTTCGCTTCGGCGGTGTCGAACGCCTCGCCGTTGTTCAAACTCCCAGT
TGACATGGTGCAGCGGGCTCGTGATCATGGGGTGCCATCGTACAACGACGTCCGGGAG
GTGAGTCCTTAAAATTGTCAAAACGTTTTGGAGGCACCGGTTCCACCAACCTCGCTGTGTCG
AGGGGAGGGTAAGGAGCGAGCCCTCTCGGTCACAGTTGCACGTGGGGTATTGATTGTCCCACGCCTCAGGGCGTGGCCGAATGCTCATCCCTAGGGAAGAAATGCTGGAGTATCAACCGG
AGGTGAACCTTGAAGTGTAGGCCCTTACTGTCATCTTCGCCACGAAGCACCCCCACGTGTTCCCAGGCTATTACGAGGGGACACATTTCCATGAAAAGAATAATCCACCTGTTTACATGC
ACGAACAATACAACAGGCATATGAACTTTCCAAAGCCACGGCCTTTTCGGATGTCTCGGCGGACGACGACGTGGTGCAACTCCTATATGCTGCGTACGGTGGAGAAATCGAAAACCTCGA
CGCGTGCGTCGGGGCCTTGGCGGAGGAGAAGGAGGCGAGCCTAGGTGGCAATTTCGGTGACCTGCTGCACACAGCATGGGTGAACCAGTTGTACAGAACATTCTTCGGGGACCGGTACCA
CCACCTTCACTCGAGGCCGATCGAGAACGTGTCACTCGCGTCTATCTCAGGACTAATCAATCAAACGCTCGGCGTGACTGACCTGCCGGCATCGGGTTTCACGGTGCCGGAAGTTACCGT
GTGCACCGGGGAATGCGAAGCTGCGGGAATATCGGGGGTCTCGTTGGCAGAGCGCTACGCCATGTCGTGGGAG
GTACACGATGTCGTTGAAGGAATGCTTGTTTCCTAGGTTCTCGGATT
AGGACTGTACTGGTATCACTCTGATCCCACAGAGTGGCTCATCGACACATTCACCGACGTCCAGCAGTGCGATATTCCCTTCTTCCCGGAGCTTTCGGATGTACACAGTTTGGATTGTTT
CTTGGGTGAACGAACGGGCGGGTGGAAACGAAGGGCCCCTCCTACACGCCGCGACCGTAATCTTTCTTGGGATGAGGGTAGACCCTTGCCCTAGTCATCCGAATTTTGATTCCTCGCGAA
CAAGCGACCTCGAAGGAGTGTTTCGACCGGGTTCGACTGCGTTGATCATCCATGTTTCACCACCTGGGGCCGCAAGCCCATGGGGGTTGTCGCCTAATGGGAAGTCTGCGATGGTCCCTT
CTCTGCCACGTTTTGTCAGTAGTTGCGTGATCGACGATGTAGATGTGTTGGATGTTTGGACGCTGCACCACCATGCAGATTCTAATGATGCCGCTCCACGTTACTGAGCGGCATACGGTG
ATAGCGAAACGAGTTTTCCGGGCTTGACTCCCACGGCGATGCATCTGTTGAAACCCTTGGCCATTTCACAGGTGATTGATGATCAAACGATATCGATTTCCTTGAGTGTCCTGGGTATCG
GCGACAGCGGGATGATGGGCATCGGCTTTGGAGGATTGTCCATGACGGATGCCCAG
GTGCGAGAAACCAAGCTATAATCTAATCGCTCCGAAATTCTGAACACAACAGTCTGTTTAGTTC
TTCCTCCGTTGAGCGCTTCCGGCTGTCCTCCTCACGCTCGAACCTTATTCGGGTTATTTCGCTCAGGGGGGTGCGGACTATTTTTTTTTCTAGAGCAGTTTTTCAGGTGAAAGCGAAGAT
GTCACAATTTACAGGTCGTTCCACTGGTTGTCGTTACCGTTGTGTTCCACTTGAGTGTATATCAGCGCTATGCAATAAAGCCGCAAGCAGGGAATGGCGGAAAGAGGCTCGAAAACAATG
CTGTGTCTTGTCGTCCAGGCGGGAGGCTTTTCTCTCCTCCGGGGATGTGCTCAACTTTGGCAAACAAACCCCCGCTAGTGCCGGTGTTCGTTTGGGGAGAACTGTGTCCTACACCTTGTA
CGAAGTACCTCCCCACACACTCGGCCAGCTCAAAGCTGCTTGCGTCATGGTTTTTTTCTGCTGTTCATGACGTCGTTACGCCAGTCGACAGCAGTTGATGTCCATACTCTGTGACGGCCG
AATACTCACCCGTATGATTGTGCGCGCGGGAGTATGTATGCATCAACGATTCCAACCAGCTCACGGTCGTGCTCTATTCACGTGTTGCAGCATGCTGTTCAACACAATAGTCTACTTCCC
GCCGTCTGCTCCGCCAACGCTCACCGCTGGTGTGTTGATGCATATGGTGCCCTCTAAAGGATTTCATTATCTGTGAGGTCTTCTCAACGGGCGGTGCCGAATGCATTGACCGGTCTCCCA
CTGGAGGGCGATCGGAGCCGCAGCCGGACACTTTGCAATCGGGCCTCCAAGTTACCAATGTAACGACGGACAAGACCTGGACTACCGTGACGTTCTCGAGGGAACGGGCGACGCTGGATG
CAGAAGACTACGACCTCTTTGAG
GTGGGTGCTACACCTGCTGTGCATGTTATCTTTTGGAATATTTTTCGCGTCCACCTTGATGACGTCTTATATTTTGGGGAGTTCATTCCGCGGGTTC
CGGTATACGCCAGTGATGCTGCCGCTGTGAATTCAACGCCGATGTAAGGAAGAGCGTACCCGGCCTGTGTCAACCTTCCATATATGGACATTTTGGTTTCGGTACAAACAATATCCGTTA
GCGGCGTGCATGCCGCCTCAAGTACGTTTTTTTCGTCGCTTATAGGATATCGAAAACGAAGAGGACACCCTCGTCATCTACGCGTTCAAGAAGGGAGAGGGCGTGGGCCAACATCCAAAC
ACCAATCGTGGAGCGGCCACGATAAACTTCGTCACGGGAGACGTAGACACTCAGTGCGACGGCGAGACCAACTTCGTTTCGTTGCACGGCGCGCTGATGCTCATCGCGTGGATGCTCATC
GCACCGTGGGGCATCTACTACGCGAG
GTGAGCAACCTCAAACGATAATTTGTTCTAGAGTTTTGGATGTCACTACCTGAGTCAAATCGCGACTGAAAGCTTTCGATAGCAAGAAGATCCC
CTCTTTTCCGTGGCTAGCTAGGTGAAACCACAACTGATTGGTACTGACAAGTCAGACGGGACGCTCGCTTTTTTGCCATTTGCGGAGCTGACCAGCAACAATACATGTCCGAACGGCTGA
TCCAACCTTGGCGTTTTTGGCCAGCCGTGCCTCCCTCCCTCACAGCCGTAGTATTTTCTTGCGCGATCTCCAGCCGAATAACACGGTGATTGGTTGCCGAAAGCACAACCTCGCTCATAA
CGATAAGTCGTCTCGAACATTACTCGTAATGCATGTGACACACCATGGGCATTATCCCAGGTACCGCAAGGGCGACGCGATTAAGTGGGCTGGACGCGAATGGTACGAGATGCACGAGGA
CATCATGATCGTTGCCTCCGAAGCCGTGCTCCCCCTCGGGATCACCGCTGTATTTGCTTCCAGGGGCAGGACGTCGGAAGCACACGCGCACTGGGGGTACTACATGATCGCCGCGGTCGC
AATGCAGATCTTCACGGGCTGGATGAGGACCAAGGGATTAGAGGCCAAACACTCGAACTTTTCCTTGCTTCACAGG
GTGAGATGAGCAAGACATGTTGGTTGTCGATGAGACGTGTACAC
CATTTATTTTTTCCGCATGCCAGTACTTGGAGGACATTCTTCGCTATCCATTGACTCGCACTGGGTAGCTCTCGCAGGCGAAAGCCGGCAAGTTCCAGGCACGTGCCGTTCGCTTTGGGT
GTTCGCTTGACGATCCACGCTGTTCATCTCAACAATCGAACCAAGGCTACCCAGCCCCAACAACATCACTGGATACCATGAGAAAAAATGACAACACGTTTGAGGGCCTCAATTGCCAAG
CATCTCCTAGGCTAATCAGCTACTGCGGGAACTCCCTTGCTCAACAGTTCAACAAGCACTTCCACATCTGGGCCGGACGATTCGCATACGCAGCCGGAGTGGTGCAGTGCTACCGAGGGC
TGGAGCTCGTGTCCTCGGACGATGAGCTCATATTCTCCGCAGGCGATGGCCTTGACCTGCAG
GTGAAGCCATGGGAGCGAATCGTAGTCCCTCCTCACCAAGTATTCTACGTCACCCCGC
ACCTGCATTGATCGTGACGAATGCGGGCAATATAGTTGTTTCCTACTTCATGAGGCGTACTCCGTAAGTTCCCAGCGTTGGTGTGATGACTTCCGTCGCTGAAGAGCTCGACTTGTATGT
AGGAGTGCAAAGGACGCAGCAGAATCCTCGGGATATACAGGCAGAAACACCCCCGGCTGTGATATCGGAATATATGTGTCGCTGTACCCCTCTGCCTTCTTGGATACTGTCCTTGACGGT
GACAATCTCCTGTCAGATCGCGCTGCTTGTCACATTAGCCTCCTTGTGTTCGCTCACCTCTTGCTGAAATTCCTGTTCGCACTATTTCGACCGAAATACAGCTCGGCAGCTTCGGTTGGG
TCAAGGACTACCTGTTCCCTGCCTGGTTTGCGCTAGTCGCCGGCGGCTTTCTTGTCTTAGAAGCACAAAAGCAATACCAGCGATTCTTCAAGAAAGGGGCGGCTAGCGTGTGTGGAGTTG
TGTCTATTGTCAACGAGCTACACGATGGCTCAATGCACAAAGGCAGGCTGATTCCGAGAACGTTGGACCTGCCTATCTACAGCGTTGCAGCATTCAATGACAAG
GTGAACGAAGACTGTG
GACTTTTGGCGATCGGTAATAGTGTTTGGCGTGCTTCGCGCGGCAGGGTGTGCGCTTCATTGAACTGCTTGAATCGCATTAAACGTGGAGGCATCGACAACGGGTTTCAAGCTCTATTCA
GTCTTTTCGTAGTACGCTCGGTCAAGAACAGTTCGCGGAGTCGGTTTTTCTTTACCGTGCAAAGGGTGTCGTTCAGAATAAATCTCCCGCTCAACACCTATTGTCCTTGGCCTAAGTTTG
TTTCCAGTCAACGTCTCGACGCCATGAACCTCTAGAAGGAAACGTCTCCCACCAATTCGGAAAGGATCGTAGACAACATGTGCCAAATGCAACCCATATGTAGCATGCACCTCCTAGGTC
CCGCAAGATACGCAATAAGTCGAAACGATCTCCCAACCTCCACCATGTCGCCATTCTCTTGGAGTCTCACGCGGACCATAACCAACACCACACACCGTGCCTGATGTAAACGTGTCTTGC
GGCCCAAAACTTACCTGCCTTCCGACCAACCTCTCTTCGATCAGGTGTTGAGCGGCCAGTCCTGGTTGATGGTGGATGAAGCAGTTCTGGATGTGTCCGACTTTGCGCAGAGGCATCCAG
GCGGTCGACGCCTCATCCTCAACGCCTTGGGCACCGATGTTACTCAGGAGCTGATCGGACAAGAGAACTCTGTGGGGCATGCCATGTCCTTCCCGCCTCACGTGCACACCGGG
GTGAGTG
CGCGCTTGACAGAACCAAATTTCCCTCCTGTTGAAAATGTGTAGAACAGACGAATGTTAGGCGTATCGTTCTGATGGCCCTCGAACAGCACAAGAAGATGGTGTGACTGCCGACCACCTC
AACCATCACACACAGACCTCTTGGAAACCATTGGATGGCAACGCAAGGGCCAAATCCTGGACAACCCCCTCCGCAAATTGTCGTCAGGGGGGTGGATGATTGGATGATGCGATATATTTC
GTAGCATTGCAGTTATTATCGCCACCAACAAGGCTCCTGACCCACCTGTTGCGTCTACACCTTTTCTTACTCGCTGGCGGCAGAGTGCATGGCGAATCATTCGTTCGCTTGTAGTCGGCT
ACATCGAGGAGAAGGACGCTGCGGAACCTACGGCTGCCTTGGAAGATGACCAGGAGCAGGAGGGAGAAGAGAAGGTCGATACCACGACCGGTGATATTCCCGTTCCTGACGCAAACAACC
GAAGGTTTCGTGTCGCGGGCAAGGCGGTAATGCTGAACAACCGACTGGCCTTGGGCGACGATACTCTG
GCAAGTGACGATCCACGTCACGATACTCATGTGTCTCGAACAATGACCTCAC
AGCCAACGAATTGCATGTATTCGACAGGCGTTCCGAAGCATCCACATCATGATGCATGAGTGTGCACCTGAGTCGAAATCAACAATTTGGATGTGAGATACTTTGTGGGCCGGCCGTTGA
GAATTTCCACACCAAGCTCAGCTACTTGGTCACGTAGGTGCTTTCTCGACAACACGCTGTACACACCGCACCAGAAAACTCTCCCCACTTTCCCTCGATTTTGGGATCGCCTGCTGAGAT
GTGCCTTTCCGTATCAAACCATGCCGATAGGTCGTGAGGGGCGGCATGGAACCGATACTTGTTGTTCCCTTTGTTTCGTGGTATGCAACACTTCCTCCAGGCAACCAAGGCCATGCGGCT
GAACGACTTGGCTGTCATTCCCGCTCCAACCAGGCGCCCCTCGAGAACGGCAGCGTCGAACAACCCAGCAAGCGTTGTGGGCAACCCGCCCATAGAAATGGACGTC
GTAAGTCTCCAAGT
CTCCCAAGTTTTTGTCTCGTGGACTGTGCAGACGTGCCGAGACCTTGTTTCTCAGTACCCGGCATAGTCTAGTGCTTGTTTGATGGACGCCCTGTTCCCAACTGAAAGATGGGCAGATGA
CCATGTAGTTGCACGTTCAGATTCCCCAGCTGTTGGTTTTGTGTGCTGCTGCTTTTTCCCGCGAATTTCAATCGGGGTCAATAACACACCACGTCGAAATCCCCCAGAGGGAACACCCGG
CGTTGCCGGAGGGAAACACCAGCATTGTTTAGCACCTACAGTATGAGCGAAGCTCAAGGACAACATAAGAGCTGATACCCATGTTATTTTCCGTTGAACTGGAACGGAACGTTTGATACA
TCGAAGGCTCAGCGCGCCGATGAGAACGACGGCGGATGGGGAAGCAGCACGGACTTGCTCGAGCGATTTCAAGTATGCCCCCTGCTCTTCCGAGAGAGGATGGGAGCCGCCAGCGCCGTG
GGCCGCGGTCACTTACCCAGCAAGCGCCCGGTCTACAGATACATTTTTTCTTGTCCCGCTAAGGCGCAAGCCCAG
GTATGCACACCCTCGTTTCCCTTCATTATTATAGTGTTTTGCGTC
AATCCTCCCCTTTGGCATGCTCCGCTGTAGACACGAGGACCCGCCAGCCAACGTAGCTCTCTTTTTTCCGCTTGCTTTGCATTCTGAACAGTCGGTCGGGCCTGTCTGTAGACAGAGAAC
ATAGACAAAAAGTGGAAAACGTAGGTATCAAATGTCGTCGAAAGCATACGTTGACTATGACACCCATGACGGAATTGGAGTCCATGAAGTCAATGTCTCTTCCTGTGGTCCCGCCGTGCA
CGTCTAAACAGCGCGGAACCCTATCCACGCCGCGGGACACAAAACAAACGTGTTGGTCCAGAGGTCTTTTGTGCTGATGTCGCCTAGCTCTCGCATCACACGGGTTTTTCTGTTCTCTGT
TGCGCGGTATACGTTTTCGACCACGTCTTTGGTCAACCAGCAGTTCATGTCATTTTCATGATTTTTTCGTTAGTTGCCTTGTGGTTTACACGGGAAAATTCTTCGGCCCCTATCAATTTC
GGTACAAAAGGCGCAGGCGGTTTCAGGGGTCTGCTACTTCAACATGCGCGCCCAGGAAGAGGGAAAGGTGAGGCTTGAAACGAACAGAGTCGTGGTGAATGCTCTGTGGGATCGCCGTTC
TGCGCCAGGTACATGCCTACCTTTTCGTGCGCTACCACGGGTTGTTGTGACATCGTTGTCGCGTGCCCCGCCCTAGCGATCACGTGACTGAACACAACGCCCCTACGCTCGGCTGTATTG
TGCGGGGTTGGTTTTCCTCTCGCCCAAGAGGCGATACTGCATTCTGACAAGTGACCTTTTCGGGTCTGTTGAACCATATCAATGGTCTAGATTGACTTGGCTCCCGCTGGAATGTTTGTG
TTGGCCGTATTGATGGAATTTTCATCCAATCTGCCACAAAGGAGGTCTCCCAATGTCCTCTAGAAAACGAATGCCGTCCGTGCTGCAATGGTTGCTGTTGTGGACTGCTGCTACTGGCAT
ACGTCCGGAATAGTTATAGGAGAGCTGGATGTGGCATGGCAGGGACCCCTACAGGTCTCAATCTCTCGCACTACCTACAGTTTCGCTAAACCGCCCATGGGACACCCATGGGTCTCCCAT
GGGTCGGCTATGGGCACTTCATGGGCCGGCCATAGGCAGCCCATAAACTGCCCAACGTGGGCACTTGAACCTAGAACTTCGCCACCGGGATATCAACCTAGAACTTAGCCACCAGCGCCA
ACCTAACACGTTCGTGTGGGCTTGGGGTTAGGGTTACGGTTAGGGTTATTAGCCACTATTGTACCCGTTCCAACGCGGACAATCTGTTGCTTAGGAGTACACGGGTTCGGTTATAGGGCT
CCCATTGGCAGCCCATGGGCTTCCCAAGGGTCGCCCATCGGCTGCCCATGGACCTAACGGGGCGCCCATGGGCGGCCCATGGGTCACCCATGGGTCACCCATGGGAGTCCCATTGGTCGT
TTGGGAAAACTGTGGAAAGTGTGGGAGACCCACAAGCCAACCCTACAGCATGGCTATCTGTGTCTCTCACTGAGATGCGAGGATGCGAGGTTTGAGCACACACGGTCAAGAACATTCTCT
GTCGACCTGATCAGTGACTTGAGATTTCCTACGGAGTATCGAAAATCGGCATGGATTTGTTTTTCGTCTTGTCGTCAGCGGCATTGTTCGTGATCTCAACGTCGTTTGCGTCTTCACAAC
AGGGTGTTGTACAGCGGCCGTACAATGCCTTCGCGGTGAGGTTGCTGGACGTCGAGCCACCCACACCGGGCGGAAGGGTGGCCTGGAGCAAGACTTCTGCGAAGTTGCCTAAGGTCAGCA
CGCTTGAGACAAATCGAGCGAAAGAAGAAAATAATTCGATGTAGACGGCATACTCTAATCTGCTCCTCGTTCGCTACACACACCTGCACCTGAAGGTTGATGCAAACTGTAGCCTCCATG
GACATAGTCCGAACGACATGTTCAACCTGTGCCACAAGGCTCTCGTGCGAGCCCAGCACCTGTCCCATCGTTAACGTTAACGCACGGTGCCTAACTCGCGTGACGGTTTTTCCTCTGTGT
GGAAGGTTGTGCCGGCAGAGGAGACTACGGAGGGCGTACTGTGCATCGAGATGCGTATCAGGATGTACCACGACGGGGCCATGAGCAAGCTACTAGAAAAACTCTCCAAGGTGAGCTCTA
CGATTGATTCCGCAACATGATGTTGTGCAATGGTTTCGCGAAGTTGCTCTGGCAGTTTTCTTACCATCCTCCTCAAGCCGAAATATTTTCGAGACTGAGGCCGTTTTCGTTTATCAAATA
TTTTGCCTCATGTGTGCTAACCTTCGGCGTAAGGTGCCGGTACACCGACCACTACCATTTGTTTTAATTGTCACAATTACACTGCTTGTGTTACGGGTAACAAAATCTCCTTCAAGAGTC
GAGCATCAAAATGTGACAGATGATAGTTTTATCACCTTGAGTGGGGCGTTGTGGATGAAAGGGGACTTCGTGAACATTTGCGGAGTCTAATACTCAAATTCTAGCTGCTGTTTGACCGAG
GGAACCTGTAGACTCAGCTCTCGATTTTATTCCACGAATATCCGTCAGATAATCGTTTTTTTCTGCCAAGGCCAAGATCACAAACAATATTTGCTTTTCCACGCCATGCTCCGCCTAGAT
GCTAAGTAACCGGATTAGCGAATTTACGTTTACTCTTGATAAACGTCCATACAACTCGTCTCCAGGATACGGACAACGTGGCAGTCCAGCTGCAAGGACCATTCCTCGTCAACAAGCTCG
CTCCGCCACCGGCCCACCGCAACGTCATCATGATTGCGGCGGGCACAGGCGTCAACCCAA
GTGCGCAAAGATGGTTACTGATGGATGTGTTGTCTCTACAATAGCGTATTCGCTTCCGGT
GTGTGTGACGAAGACAACGTCGCCGAGTGCCCAGTATGCCGCGGATGTTCGCTCCGCGCCCTTGGAGCCAAAAACGGAAATGCTTTGAATTTGGGTATTGAAACGTCTTCGAAGGTTTAA
CGACAGGGCTAAGGTTAGGCTAAGGGTTACTCTAACACTACCTGACCTTGCCGTGCAATATATGTCAGAAATTGGCCGTATAATACCTTAAGTACCTCAGGAATCTGTGCAGACCCATGT
CGCAGAGGCCAATGTGCATGACCGCAGGAAATCGACGGCCTTTCCTATATATCGTGTCAGATAGTTCAGGGCCACCACCTTTGTCGTACTGTCTTATCCCCGCCGCCAGCGATGTCGTAC
TAGACCCCGGCCACCACATCAAACGAAGGCGTGCTCTGTGACGCAGTCAACGAAGTGTCGCAGCCGACTGTCGCCGTATCTTGACGTCCCCGCGCAACCTATGTATGCCCCCCCCCGCGT
ATCTCCTTCATTCGCGGCGTGACGTCCCTACTGGTGGTCTTCGACGGTCGAACAAATGACCGACGGCAATGGCAGTGGTCCAGCAGATTCGGAACTATCTCAACGTTTCCAGGTGGGCGG
CAAATCGTACGTGGGATGGCCATCATCAGTACTTTCACGACGTTTCCGAAACCCTCTGGCGTGCCGACGACTCGCATGAACGGCAGAAGAAACTCGCGCGTAAAGCGGGATCCCTCCCTT
CGTATTTTCAATGACCCCAGGGACACCACGTTTTCCACGAGGTCGCGGCTGGTCCTCGTGTGGCAGAGCACGACGGAGGCTGACTTCTACGGTACCGACGAAATCACGGCCATGCAGGTA
AGTCACCTTTGCATGGATCAGTCTGGATATGCAGCAGGCATCTCCCATCGCTAACTCGGTGATATGGCGTGGCCGGCTCTTTGCCATTCTGGTGTCGCTCCCACTGTTGGACACGTCCCG
AACATTGATCGGTGCAACATCCACCCCGCCCTGGCTTCTTGAATTGTTATTATCCAGGAGAAAAGCAACGGACTCCTCGAAGTGACTGCTCTCACCAGTGAAGGAGGTCGTCGTCGGAAT
GCTCCCGGTGCAGCCTTCCGCAAGGCCCGTGACATGGCCTGGAATGTCTTCGGTTCACCCGCGTCTTCAAACACCAGCTCCGCTAACCCCTTCACTCCTGCGGGGTACGGTGCCACGATG
ATTTCGGGGTCATCAAATTATCCCCCGAAGACGCAGTGGGAACTGTTGGTTGATCGCTCTTTCGTCGCCATTTGAACGCGTAGGCGTACCATATTTTTCAGTATTCCGCGCTTGAAATCC
GGGATTTGATCTGTCGGTCCGGCTTCTCCGCGGGTCCAGCCTTGTGTGTGCTCCGTTAAAATTGGTCGGCGAGGTTCCTGCGAAGGTGCGCTTGAACAAGTAGCGGGCGCAACAAAATTA
TTATCTACCGCCTTTGCTCCATTTCCGTTGGAGCGCTTGCCTCACCTTTGAACCTCGAAAATCACTTGCTCTAGATCAGATGCCGGCACGCACTTGTGGTTTCAGAGCACACCTCTCTCA
GAACCAGGGTACGACGAGACCCCCACTGCCAAGCGGCCCATGTGCAATGACGTTGCTACGAATACTGCCGTGTTTTACCCGTCGCCAGGTCCAACCTCGACAGCAGCAGCTCCGGGAAAC
CGAAACCTCCACCCTATTCCACGCTGGCCCGAGACGGTGGAAGGGACGAGCAGCCACCCCCGTACCGCACCCCGGGTCGTGAAGAGAAGAAGCGCTCTGCTGCAGATGCAGGGGCCAAGA
AAGAAAGGGCCCCGACTGGCGTTGGGAAGCTACTGACCACGAGG
GTGAGACGTACCACGTGGCAGGGACACATTTGCAATATGCGTACGTACGTGACACCTACGCCCAGACCTAGTAACA
CGGATGTAGTTCTGGCGTTACCCAGGAAGTTGAATAGTGAGCGCAGGACGCATCATTTTGTCTGTGGCTAAATAACCTGGTCTCAGGGATGCTCGCACCCAAAACGAGGCAGCTACGCCC
AACAAGGACCACCAGTGGTCGCTCTCTTAGCTGATTGGTCGTCTCGATTACCTCGCAGCAGATTGCCGTCCTTCTCTCATAATCGCCCCGCTGAAAATTCAGTGTGAGGAAAGTTTCTGG
AGAACAGTGACAGGCAGACGCAGAATCCTTGCGTTCCATGCGAAAAGGTAGATGTGACGTCCAGACCAGTACGCTCCAAGACTTCTGGTTGTTCGAGGGAATGGGCAAATTGGCAGAATT
GAACGAGTCGTTCGCACGATCGCAACGAGATGGCTTGCCGAACCAACCAATGACAGTGCAGCTCCCGAAAGCGCTATCGTACGAGAAAAGCCCGAGTACTCTCCGAGGGGTACTGTTGGA
TGAGCAAAGTGGGCGGGGCGGGGCATCTTCGAGTGGTGGATGACTACTGAGCAATAGGAGTGCCGTGTGTCCCGGGGACTTGCCTGCCTCACTACGGAAGCTATGGGGATGTTCTAACCA
CTGCATCATGTATGTCGACCGTATGTTTCGTGATGCTCGTGGCGCCGTGCGTGTTTCGATGGACGGCTGTTGTTCATGCTGCTGCAGACGTGGCGCAACTCGAAGTGGAATGAGAGCCCA
ACGACAAGCGGTCGCCGTCGCGCACCTATGCAGGACACCAGC
GTGAGCTTCAGACATGTGCATGAGTTAGGAGTAGCGACCGACAATCAAGTTTGAAATGCCAGAAAAGGGCTCGTTGAG
AGTTAAGGCTCCACATCGTGAGAAGGTTGGAATCTGCATCATCTGCGAGGCGTGGTCTCAGGTGAACCTACTCCCATTATCTCCCTCTCGCTGTTCTGGTTTGTCATCGCCAGAACTATC
AAGTGGGAGATGGGCTGGTTCGAGGCAGGGTGAACCGGGAGATCCTCGAGACGGTCTTCGGCGAAGCCCTGATTTCATCAATCGCGGCGTACAACAGGCAGCGAGCGCTGAACAGCCTTG
CTTGTAGCGACAGCGACGTCGGGGACAACAAAGAAGGGGAAGGCGAGGATGATCGCGACCTCATAGGCACCGACCAAACTGCCGGGAAGCTTCAG
GTGGCCATCACGAGTAGTCGTAGTT
TCTTGTCGTTAACAATTCATATAAACGATGATGAAAACCTCGCCACAAACCTGAGAGCTAGGGTGGCTATGGTTGTGACGATAAAGTGTAATCCAATAGAAACGGTTCTGCCGTTGGTTG
TGAAGAAGGCAACAGCAATAACAGCACGAGCAACGTCTAGTCTAGAGGCCTATCGTTTTTCGAGGATTTCTTTCGATGGAGCACGTCGAGTGTGTGGCTACCTCTTCGTGCCAGGGAGAA
CGGCGAGTTTCAGACTCGCTTTTGACCTGTTACTCTCCCGAAGTGAACATTTCCTCCTCGTGGACAGTCGGTCCAATGGCGCAATCTTGGTGGGATACTTCTGGCAGTATCGACTATTCG
ATGCTGGACAGTGAATGGTCAGGTATTCGTACATGACCGCCTGGAGAAACACGACGAACGTGTCCCGTCGAATCCCCTGTGCTCTGATGTCAGGTGGTCGTTTCTGGACCTACCGCCTTT
GTGGCCAACGTGAAGCAGCTCCTTACCGAAATGGGGGTCCCTGCCGGCTCCACAGTCTTGCTTGACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACAATCCTACTTGGGGCGCTGCGGGGACAACCCAGGGAGTTGATGACGGACGTGTTCCTGTCGTCGCCACCGTCCGTTTCTGATATGAATGCGGTTTCCATCGCTTGGGGACAG
CTGCTGCTTCTCGATTTGTCCTACACCGTCGACAACAGCTCGGAACCCTTCGAAATCGCTTGCGATGACGGAGGGGGCTCCGTTGACGTTTGGTGTCCTCTGGGGGAGGCATCTGATCCA
ATCCCTTTTTTCAGATCCCAAGCTACGGTGACTGATTCTGTCCGAAACCCGATCAACTACGCCTCCTCGTTTATCGACCTGGACTTCGTGTATGGAAGGAGCAAGGACGCTGCCGATGCC
CTTCGTACCTTTGATGGCGGAATGCTGAGTATGGCAGATGACAACATGCCCATCAAGAACAGCGACGGGACTTGGTTG
ATCGCGGATCAACGGACAGCCAGATTTCCGCTGACGTTCGCC
CTTCACGTCGTTCTCCTCCTCGAGCACAACCGCTGCTGCGTTGACGTCGCGCCAGCTCTGAACTACACGAGTGATGAG
GATATGTATCAAGCTTGCCGAGGCTGGACGATCGCCACATTT
CAGCACATAACTGAAGATGAGTTCTTGATTCTACTAATGGGAAGAAGCATCGGCGACTGGACCGTGTACCAAGATGACGATGGCGGCAGCAGACGCAGGCTATCCCCAGAACAGCGGAGG
GAGCTGTTGTTTACTTTCGACTACTACGACGACCTCTTGAACCCGTCCGCCGACGTCTTCGTGACGGTGGCCATGACCGCCGCGTTCGAGTCGGCGCTGCCTTCTACCCTCCGCATTGTG
AGCGAGGGGTATGTTGCCACTGACTACGATCACCTTGAGCTCACCGTTGCGGCAGAAGATATCACGGGCCTGTTCGAGCACAGCGCGATCGGGGACATCCTGCGTGGAGCGGTTTTGTCT
CCCGCGATGGCGGTATGGCCACACTTCGCTTCGGCGGTGTCGAACGCCTCGCCGTTGTTCAAACTCCCAGTTGACATGGTGCAGCGGGCTCGTGATCATGGGGTGCCATCGTACAACGAC
GTCCGGGAG
GCATATGAACTTTCCAAAGCCACGGCCTTTTCGGATGTCTCGGCGGACGACGACGTGGTGCAACTCCTATATGCTGCGTACGGTGGAGAAATCGAAAACCTCGACGCGTGC
GTCGGGGCCTTGGCGGAGGAGAAGGAGGCGAGCCTAGGTGGCAATTTCGGTGACCTGCTGCACACAGCATGGGTGAACCAGTTGTACAGAACATTCTTCGGGGACCGGTACCACCACCTT
CACTCGAGGCCGATCGAGAACGTGTCACTCGCGTCTATCTCAGGACTAATCAATCAAACGCTCGGCGTGACTGACCTGCCGGCATCGGGTTTCACGGTGCCGGAAGTTACCGTGTGCACC
GGGGAATGCGAAGCTGCGGGAATATCGGGGGTCTCGTTGGCAGAGCGCTACGCCATGTCGTGGGAG
GTGATTGATGATCAAACGATATCGATTTCCTTGAGTGTCCTGGGTATCGGCGAC
AGCGGGATGATGGGCATCGGCTTTGGAGGATTGTCCATGACGGATGCCCAG
GATTTCATTATCTGTGAGGTCTTCTCAACGGGCGGTGCCGAATGCATTGACCGGTCTCCCACTGGAGGG
CGATCGGAGCCGCAGCCGGACACTTTGCAATCGGGCCTCCAAGTTACCAATGTAACGACGGACAAGACCTGGACTACCGTGACGTTCTCGAGGGAACGGGCGACGCTGGATGCAGAAGAC
TACGACCTCTTTGAG
GATATCGAAAACGAAGAGGACACCCTCGTCATCTACGCGTTCAAGAAGGGAGAGGGCGTGGGCCAACATCCAAACACCAATCGTGGAGCGGCCACGATAAACTTC
GTCACGGGAGACGTAGACACTCAGTGCGACGGCGAGACCAACTTCGTTTCGTTGCACGGCGCGCTGATGCTCATCGCGTGGATGCTCATCGCACCGTGGGGCATCTACTACGCGAG
GTAC
CGCAAGGGCGACGCGATTAAGTGGGCTGGACGCGAATGGTACGAGATGCACGAGGACATCATGATCGTTGCCTCCGAAGCCGTGCTCCCCCTCGGGATCACCGCTGTATTTGCTTCCAGG
GGCAGGACGTCGGAAGCACACGCGCACTGGGGGTACTACATGATCGCCGCGGTCGCAATGCAGATCTTCACGGGCTGGATGAGGACCAAGGGATTAGAGGCCAAACACTCGAACTTTTCC
TTGCTTCACAGG
TTCAACAAGCACTTCCACATCTGGGCCGGACGATTCGCATACGCAGCCGGAGTGGTGCAGTGCTACCGAGGGCTGGAGCTCGTGTCCTCGGACGATGAGCTCATATTC
TCCGCAGGCGATGGCCTTGACCTGCAG
CTCGGCAGCTTCGGTTGGGTCAAGGACTACCTGTTCCCTGCCTGGTTTGCGCTAGTCGCCGGCGGCTTTCTTGTCTTAGAAGCACAAAAGCAA
TACCAGCGATTCTTCAAGAAAGGGGCGGCTAGCGTGTGTGGAGTTGTGTCTATTGTCAACGAGCTACACGATGGCTCAATGCACAAAGGCAGGCTGATTCCGAGAACGTTGGACCTGCCT
ATCTACAGCGTTGCAGCATTCAATGACAAG
GTGTTGAGCGGCCAGTCCTGGTTGATGGTGGATGAAGCAGTTCTGGATGTGTCCGACTTTGCGCAGAGGCATCCAGGCGGTCGACGCCTC
ATCCTCAACGCCTTGGGCACCGATGTTACTCAGGAGCTGATCGGACAAGAGAACTCTGTGGGGCATGCCATGTCCTTCCCGCCTCACGTGCACACCGGG
AGTGCATGGCGAATCATTCGT
TCGCTTGTAGTCGGCTACATCGAGGAGAAGGACGCTGCGGAACCTACGGCTGCCTTGGAAGATGACCAGGAGCAGGAGGGAGAAGAGAAGGTCGATACCACGACCGGTGATATTCCCGTT
CCTGACGCAAACAACCGAAGGTTTCGTGTCGCGGGCAAGGCGGTAATGCTGAACAACCGACTGGCCTTGGGCGACGATACTCTG
GCAACCAAGGCCATGCGGCTGAACGACTTGGCTGTC
ATTCCCGCTCCAACCAGGCGCCCCTCGAGAACGGCAGCGTCGAACAACCCAGCAAGCGTTGTGGGCAACCCGCCCATAGAAATGGACGTC
GCTCAGCGCGCCGATGAGAACGACGGCGGA
TGGGGAAGCAGCACGGACTTGCTCGAGCGATTTCAAGTATGCCCCCTGCTCTTCCGAGAGAGGATGGGAGCCGCCAGCGCCGTGGGCCGCGGTCACTTACCCAGCAAGCGCCCGGTCTAC
AGATACATTTTTTCTTGTCCCGCTAAGGCGCAAGCCCAG
GCGCAGGCGGTTTCAGGGGTCTGCTACTTCAACATGCGCGCCCAGGAAGAGGGAAAGGGTGTTGTACAGCGGCCGTACAAT
GCCTTCGCGGTGAGGTTGCTGGACGTCGAGCCACCCACACCGGGCGGAAGGGTGGCCTGGAGCAAGACTTCTGCGAAGTTGCCTAAG
GTTGTGCCGGCAGAGGAGACTACGGAGGGCGTA
CTGTGCATCGAGATGCGTATCAGGATGTACCACGACGGGGCCATGAGCAAGCTACTAGAAAAACTCTCCAAG
GATACGGACAACGTGGCAGTCCAGCTGCAAGGACCATTCCTCGTCAAC
AAGCTCGCTCCGCCACCGGCCCACCGCAACGTCATCATGATTGCGGCGGGCACAGGCGTCAACCCAA
GGACACCACGTTTTCCACGAGGTCGCGGCTGGTCCTCGTGTGGCAGAGCACGA
CGGAGGCTGACTTCTACGGTACCGACGAAATCACGGCCATGCAG
GTCCAACCTCGACAGCAGCAGCTCCGGGAAACCGAAACCTCCACCCTATTCCACGCTGGCCCGAGACGGTGGAAGG
GACGAGCAGCCACCCCCGTACCGCACCCCGGGTCGTGAAGAGAAGAAGCGCTCTGCTGCAGATGCAGGGGCCAAGAAAGAAAGGGCCCCGACTGGCGTTGGGAAGCTACTGACCACGAGG
ACGTGGCGCAACTCGAAGTGGAATGAGAGCCCAACGACAAGCGGTCGCCGTCGCGCACCTATGCAGGACACCAGCAACTATCAAGTGGGAGATGGGCTGGTTCGAGGCAGGGTGAACCGG
GAGATCCTCGAGACGGTCTTCGGCGAAGCCCTGATTTCATCAATCGCGGCGTACAACAGGCAGCGAGCGCTGAACAGCCTTGCTTGTAGCGACAGCGACGTCGGGGACAACAAAGAAGGG
GAAGGCGAGGATGATCGCGACCTCATAGGCACCGACCAAACTGCCGGGAAGCTTCAG
GTGGTCGTTTCTGGACCTACCGCCTTTGTGGCCAACGTGAAGCAGCTCCTTACCGAAATGGGG
GTCCCTGCCGGCTCCACAGTCTTGCTTGACTGA

Retrieve as FASTA