Entry information : EsilPxd04 (Esi_0209_0042)
Entry ID 16973
Creation 2021-02-04 (Christophe Dunand)
Last sequence changes 2021-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilPxd04 (Esi_0209_0042)
Name (synonym) EsilPxd04 (Esi_0209_0042)
Class Peroxidasin    [Orthogroup: Pxd003]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilPxd04
start..stop
S start..stop
EsilPxd02 865 0 1..811 17..891
EsilPxd02 256 1e-69 849..1095 1007..1268
EsilPxd03 842 0 1..811 17..890
EsilPxd03 269 7e-74 849..1095 1005..1262
EsilPxd01 606 0 249..811 356..989
EsilPxd01 335 4e-95 852..1194 1099..1455
EsilPxd01 219 5e-58 1..178 89..302
EsilPxd01 50 0.000006 1233..1264 1596..1627
EsilPxd05 431 2e-135 1..646 94..763
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 202436..202647 212 N° 2 201853..202039 187 N° 3 201017..201049 33 N° 4 199871..200052 182
N° 5 199285..199419 135 N° 6 198226..198466 241 N° 7 197632..197849 218 N° 8 196890..196998 109
N° 9 196422..196511 90 N° 10 196050..196154 105 N° 11 195642..195848 207 N° 12 194948..195165 218
N° 13 194596..194695 100 N° 14 192931..193065 135 N° 15 192574..192674 101 N° 16 191290..191449 160
N° 17 189457..189642 186 N° 18 188861..188965 105 N° 19 188136..188324 189 N° 20 187586..187642 57
N° 21 186631..186831 201 N° 22 186168..186282 115 N° 23 185374..185410 37 N° 24 184743..184839 97
N° 25 183851..184026 176 N° 26 183361..183463 103 N° 27 180287..180382 96  
complement(join(180287..180382,183361..183463,183851..184026,184743..184839,1853 74..185410,186168..186282,186631..186831,187586..187642,188136..188324,188861..1 88965,189457..189642,191290..191449,192574..192674,192931..193065,194596..194695 ,194948..195165,195642..195848,196050..196154,196422..196511,196890..196998,1976 32..197849,198226..198466,199285..199419,199871..200052,201017..201049,201853..2 02039,202436..202647))


exon

Literature and cross-references EsilPxd04 (Esi_0209_0042)
Protein ref. GenBank:   CBJ30678.1
Protein sequence: EsilPxd04 (Esi_0209_0042)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   1264
PWM (Da):   %s   136702.27  
PI (pH):   %s   4.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTDVFLTSTAGLSAKSSLFIAWGQLLTYDLALTVANGTESLDVPCNDADQNGGIDVWCPLGAASEDIPFSRSDAAEGTDGVRSPINYASSYIDLDFVYGRSAEEAELLRTMEDGFMNVTDSGVPFQNEDGTWVAPDMGFEGDEDIFQACRGWTIAIFQHVTQNDFLIRLLGITLTDLGLAMYLGSDDDFTSTYDSEGAHRRSRRGRRLYVSSNDYNTTINAAADAFTVTAGGAAFESALPGTVRIVSDGYVSTDDDNVELNVASADMAGIFARNNVADVLRGAVLSPALTVDAYYSPVVSNLSPLFKLPVDGVQRGRDHGLPSYNGARAFGLDPATTFEDVSDDADLASRLSDAYGGDINGLDAFTGALAEGTHSSTGGVLGDLLVAAWSDQLTRSIAGDRFYHLHARYMENVANTTLMDVIGRVTNATDLPLSVFAPSITVCDGGCAGDGDGIAVLSDNFELEWEELEDDQMAITFRCKDLGTSGWMGVGWGGLTMELAQDFIICEITDESTASCTDRAYTTEREAPPLDSAGETSLNFTDLSMEDGWTSVTFLRDRGAFDDQDYDLGSDIDNAADTLMIYAYREGEGIGQHPNGNRGAATVNFATGNVEAECDDDDFVLLHGALMLVAWMVLAPVGIYYVRYRKGERVKWAGFEWFEMHQEIMIVASEAVLPLFNKHFHIWAGRFAYLAGVVQCYRGLELVSSDDNLVLSAGDGLDLEIGSFGVFRDVGFPIWFALVGLGFLVLETRKQYRRYFRKGAANLCGCVELINEEYTGEKGDDGEKVEDRLVPRTEALPLYTVEEFNDEEEEGDEEEEEEEKDKSVRKAGAAGEETQAAAGGKEPNRAFRIAGKAVLMQARGTAGRTFDLETKAAKANELAVVPDGPSAPSAGAGVTTFGVPVVSPGAGPAALKRTWSSKKLLQRFHVCPLLFREKMGTDSPIGRGLLFTKRPTYRYIFSCPGQAQALVETIHGVCHFHMPGQVPGKGVIQRAYNAYAVRVQGFVDGKDGSGKGATPPRVVPAQETSEGVLCIEMRIRLYHDGAMSQLLEKLSKDTDNPAIQLQGPFIITKLVPPPAHRNVVMIAAGTGVNPMVQQIRDYLALPRDQAHSTRSRLCLIWQSMSEAELYGSEEITEMQAKSKGLLEVIVLVSGDQRRRNVPGAAFRRGKKMMSKAMAMVSPVSSSPSSSVIAMPARPPKVYDMSPNRPDDEERSSGGIAGHKRGRRRSDQVVVSGPSVFVFYVETILAEMGVPSEAIVFLD

Retrieve as FASTA  
Remarks Missing part due to N in the sequence.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGGACGTCTTCTTGACGTCGACGGCCGGGCTGTCGGCGAAGAGCTCCCTCTTCATCGCGTGGGGCCAGCTGCTGACCTACGACCTGGCCCTCACGGTGGCCAACGGGACCGAGTCC
CTCGACGTGCCTTGCAACGACGCCGACCAAAACGGGGGGATAGACGTGTGGTGTCCCCTAGGTGCCGCCTCGGAGGATATTCCCTTCTCCAG
GTCAGTTGTCTCGTCGCGTGTCTAGTTT
AATGCGTGGCGGGGGCCGGCGGGAGCTCCCCCCCCCCCCCTCCCTTCCCCCGCCAACGGAGTTCTGAAGAGCTAAACGCCCCGCCTGCACGTCAGTAGAAGTATGTTTGTTGTCAAAGAG
GCGAGCATGCGGTGTCCACACGTACACACGTAATTGTTTTTTGTTTGATTTCGTGCTGTGCTCAGCAGGAAGTTTCTTGTAATCATTTTTTTATTGCTTCCCAGGAGTAGATGATGAAGC
ACCATGTTGACTCTTACAGCTATTTAGTCGCGCATCTGCTTCGTTCGATGGACTGGGGTTCCTTTTTATTTTTATTTTTTCCAATTTTCGTTTCGTGTATCTCCGCGCGATACATTGCAC
ACGCACAGATCGGACGCCGCGGAGGGAACGGACGGCGTGCGCAGCCCCATCAACTACGCGTCCTCGTACATCGACCTGGACTTCGTGTACGGGAGAAGCGCGGAGGAGGCAGAGCTCCTG
AGGACCATGGAAGACGGTTTCATGAACGTCACGGACAGTGGAGTGCCCTTCCAGAACGAGGACGGAACGTGGCTG
GTGAGTGTGGGAGAAAGTCGGGCAGAGAGGCAAAGAGAGACACTT
GTGTGCTTGTGTGGCCGGTCGGTCGGTCGGTCGGTCGGTCCTGAGTTTTTTGTTTTTGCGGCTGACGGGGGCATGTATAGCGTTTTTTGTTTTTCTACGTTTGAGTAGAGTGATCTGAAT
AGAACGTTGGTCGGGGAGGGGGGGTTATCGTGCGTGACGTGATCTCCAGACGAAAGACCCAGGTATTGCACCCCGTTCGAAGTTGGGGAGGAGGGGGAGTTGACCCATGTGTGTAAATTT
TATTGAGAGGCGATACGGAGGGGGGGGGGGGGGGGGGGCCAATCCTGCCCCAAGGGGGGGTCCGTCCCCGAAAAAAAATAGGGGGAAAGGGGGAAAGACCACCCCGACCGACCAACCCAA
ACCCAGACCCGGGGGGGGCCAAAAAACCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTTTTTTTGCCCCCCTTTTAGGAGCCCTTTTTGCTTTTTTTTTTTCTTTCCCCTGGCCGCTGCCCAT
TTTGGGGGGGGGACTTTTCCTGGGGGGGTTCGGGGGGGGGGGGGGGGGTCGGTCGGCACCGGCACGGGCAGATGGCGGACCAACGCCCCGCACAGTACCCTGTCACGTTCGCGCTCCATA
TCATGCTGCTGCTGGAGCACAACCGCTGCTGCGTGGAGGTGGCGCCGGACATGGGCTTCGAGGGAGACGAGGTGACCGAAGGAAGTGTTGATTTTTATTTCGTCGAATTTTTTTTGCAGG
GGAACGATTGGCCATCGGTGATCGGTCGGTCCTGTAGGAACAAGTACCGTTCTCTCGACGACGCGTGGTCACTGGTCTATAACAACGAAAACATGCAAAACATGAGTGCGCCCCCGTTCT
TTTGACGAGAGTATTTTTCATGTGTCTCGTGTGTCGAGCCTGCCGGGTTAAACGCTCCTGCTGTGCGCCACCGCTGTAGCAGCAGCACCGCTGTCGGGGGGTGAAGTGCGAACGAACTTC
AAGTAGACCGTGGTGCTTGATTTCTGACGTGGGTTTCCTTCTCTTGTTGTACATGGCCCAGACCACGGCTGAGCACGCCGCCGCGCCGCTTGTCCTTGAGTTGGTGGGTGGCTTTGGCTT
GCAGGGCGGTACTGTAGCCTTCCCGGGGATATCAAGTTTGGTTTTTGTAGGGGTACGGGGTGGGGGTAGGATAAGGGATAGGGCCACGAACCCCCCCTCTCTATTTCATAGAAGAATAAT
CAAGTCCTCGCGAGGGCGGTCCCTTCGAGGCCCGCCGGCGGACTGTGTAGAGTGTTTTGTGCGTACGCCCGATGGATTTTTTTCTGTCCATGCACAATCTGTTTTTTCTTCTTTAGGAAG
GATATTTGGTTTCACATGCTTCCACTGTTGTATTCGTTTCCTTGTCTTGCAGGAAACCGTCTGCATAAAACAATTAATTCTTCAGTAGAAAGAACAGTTGTGTACAAGACGACAGCCCTA
ATACGTGTTGGTGTATACTTGAACATACTTTTGTTTATTCTTGACGAAAACCAAATGCAATCAAATGCACAGGCAACACCCCCGTTAACTGTTTTTTTTGTTTCAAGGTGAGAACCCAAA
CGAAAACCATTGATGAAATAGGAACAGATGATCGTTGGTCACATTGACCCACTTTTTTTTTTCTTTTTTTTCCAGGACATTTTCCAGGCCTGCCGGGGATGGACGATCGCCATCTTTCAG
CACGTGACGCAGAACGACTTCCTCATCAGGCTTCTCGGCATCACTCTGACGGACCTGGGCCTCGCCATGTACCTTGGCAGCGACGACGACTTCACGTCCACATACGACTCGGAGGGCGCG
CACAGGAGATCGCGTAG
GTATGAAGATGTATGTGCACTAAAATTACAAAGTGATCCATTTTTTTCCGGAGTGGGCGCATGAGAGCACAGCAGCAGTGTACATCAAGGGGTTATGCAAGAT
AAGCAGGTGTTTATTTTTGCAGCAAGGACCAACGCACAGCTGGCTTTCCACCTGCTGTATGACGGTTCCCAAGCTCACACAGCTGAGGACGTGTTTTTATTTCGCAACAGCCCAGGGAGC
CTCAACGGACCAAGAAAGGGAACTCAAGGCGCTTGCCATGGATCAGAACGCACAACTCTCGGTTTTACGCTGAACGCGCTCGCTTGTTCATGGACGTACTGTGTGTATGTTGGTGCGCAC
GCGAATTATCGCTTTTTCAGATGCATGCATGCGTTGTTGTTGGCGTGATGCCTTTTTTTTTTTTTTTGCGTTCGTTCGTTCGCTCCCGTGTTGTTATTGGCGCTTCAGAGGGAGGAGGCT
CTATGTTTCTTCGAACGACTACAACACGACGATCAACGCAGCCGCCGACGCGTTCACCGTCACCGCCGGAGGCGCGGCGTTCGAGTCGGCCCTGCCGGGCACCGTGCGCATTGTGTCGGA
CGG
GTGAGAGAGCGTTTCATTGTGTCGATGAGATATCCTTGCATCTATTTCTCCCTAGCCCGCCGGGTCGGATGACTGGCCCGTGTATGTCGTGCTAACAGCAGCAGTGCATAGGGACAA
GGAGCACGCAAGAATAACAAACCCTGGCGTGATTGACCTAGGCGCCAACCAACCCTTTCCCCGACGAAGCCCCCGTCCTGGGCGGGCGAAAACCCGGCGTTTCGCTCCGTCGTAGGGATG
CGCTTTCATGACCCCCCCCCCCCCCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCCCCCCGGCCCCCTGGCCCTTTTTTTGGGAGGGGGGAGAGAGGTTTTCTTGGGGGGGAGGGAATTCCCTGGCTTTTTTTTCCCCCACCCCCCCGGGGTGGAAAGACGGCC
CCGTTTATTTCGTCCTACCCCCCCCAGTCCTTGGGGCCAGGGGCCCCCCAAAAATACCAACCCCGGGGGGGTTGGCCTTGGGCCCCACCCACCCCTTTCCCGGAGAAACCCCCCTCCCGG
GGGGGGGAAAACCCCGGGTTTTCCCCCCTTTGAGGGGGGGGGTTTTCAGGCCCCCCCCCCCCCCCCCCCCAGGTACCGTTGGCAGAGTAGGGAGGAACGATTGGCCATCAGTGATCGGTC
CTGTGGGAACAACGCTCCGTCCTCTCGAGGACGCGTGGTTAATGGTCTAACCGCTAAGGCATGCAAAACACAAGAGTACGCCCCCCCGCCCCTCTCCCCAGGTATGTCTCAACCGACGAC
GATAACGTCGAGCTGAACGTCGCGAGCGCCGACATGGCCGGGATCTTCGCGAGAAACAATGTCGCCGACGTCCTTCGCGGCGCCGTGCTCTCGCCGGCCCTGACGGTGGACGCCTACTAC
TCCCCCGTGGTGTCCAACCTGTCCCCGCTGTTCAAGCTCCCGGTCGACGGCGTCCAGAGGGGGCGGGACCACGGGCTGCCCTCGTACAACGGTGCCCGAGAG
GTGAGGATGAGATAGACA
CGTGGTCAGGCGGGTTTAGGTGTCAGTCGTATTTAGGAGATAGGTTCCCGTGCTGCCAGTAATGGTTGAGTTCAGGAGACTTGCCATGCTGCCGGTTGTAGTCGTCAGTTGGGGCCACGA
GACTCTTGCGCCTTCCAGCAGTACTGTAGCCAGTCGGGGGTCCAGAAGACTCTCGTTCTACTTGTAGTCAAGTCAGGTTCACTCAGACAATGAACCGGAACACTCGGGGTGTACATGGAG
TTACCTATTTACCCCCCCCCGTCCGTAGGCGTTCTTTCCACGGCTGCTGCTGCTGCTGCTGCTGCTGCTGAACGTCGTCGGTCGTTGTTTGGTGGCGTTTTTCGTTTTTCGCGCGAAGGC
GTTCGGCCTGGACCCGGCGACGACGTTCGAGGACGTCTCCGACGATGCCGACCTGGCCTCGCGCCTGTCCGACGCGTACGGCGGGGACATCAACGGCCTCGACGCCTTTACGGGGGCGCT
GGCGGAGGGGACGCACTCGAGCACGGGGGGCGTGCTGGGGGACCTCCTCGTCGCCGCGTGGTCGGACCAGCTCACCCGCTCCATCGCGGGGGACAG
GTTGGTTGGTTGGGTTTTGCGGTT
GTTTGCGGTGTGTTGGTGGCTGTTGTTTAGTTGCAGCAGAGGCACTGGGAGCGGCTGCGGTTAAAAAACGGAAGTATATTAGTTGTATTCGTTTGAGAGGGGAGTGTGGGTGTTTGTAGA
GTCAAGAGGTGGCATGTCCCGCCCACTAGGAGTACTCGTTGGATAGTACTCCGTATAATACGTTTGGAGAGAAGACGAGATTTATTTTCGTGGCCTTGTCCCGACCCTCTCCCGAACCTG
TGCCGGGAGATGGGCGACTCTACCATGCGTCGCACCATCTCCGTCTGTAACAAGGCGCGAATGCCGCACGGGAGCCTCTGTGTGATCCCGACCCTTCTCCTGTGTTCAGTGTGAACTCTC
CACGGCACTGGTGCATGTTGCATACCGTGACTGTAAAATCAATACCACGGTAATACAGCAGTCTCCCTAAACGGTATTGCACTCCTCCCGAGACCTTCGGCCGTTTCACCGCTGTTCTTA
ACGCCTCTTTTTTTTTCTTCTTTCTCTCTTTTTCGCAAATCTGGCTGTTCTCGTCCGCAACCCCGCCGGGCCTGTCGTTGCTATGTATGTGAACGCCGCGATTTTTTTTACGCACGTCCC
GAAACCCAGGTTCTATCACCTACACGCCCGTTACATGGAGAACGTGGCCAACACGACGCTCATGGATGTCATAGGCCGCGTCACCAACGCCACGGACCTACCGCTCTCCGTATTTCAGGT
GTGCATACAAGTACAAGTAGTCAAATTCGTTCGGCCACTTGTGCGCATCTATTTGTGCCCATCCCATCAAATCGTTGTTAAAGTCCCACCAATCGTTGATGAAGTCCCATCAATCGTAAG
AGTAGGCAGCCCCCGTGCCTGAGTGTCGAAAGTACGGTAGATGCTGGGGGCTCATTCGTCGGCCGTCATTCGCACTTGAATGTTGCAGGCCCATTTCCTTCCGAGCTTCCTCCTGTTATG
TTGTGCTAGAATGTATGACGCATGGAAGAGCTCATCCTGTTTTGTAGACGACTGACTTTGTTCAACTCTGTTTTCTTTTTCTTCTTGTTCTTGTTCTTGTTCTTCTTCCTTCTCATGCAC
CTCGTCATTTCCAAAGGCGCCCAGCATCACCGTCTGCGACGGAGGGTGCGCCGGGGACGGAGACGGCATCGCCGTATTGTCGGACAACTTCGAGCTAGAGTGGGAGGTCAGTCGTCATAG
ACTACGAGATCAGGCATGGAGAGTATTTTGCAAGGCCTCGTTGTATGTTTGGTGCGGGTATTCTATTTTCTATCTAGCGCATCGTCCCCAAGAAAATTGTTTTTTTTTTGCTCCCCAGAC
AAGAGGGTGTGCGCTTGTGCACCGCTTGTGCGTTTCATCTTGGCGCGCGCGAAGTCAAGGTTCGACACGCTTATTTTGAGGTGTTTCTTTTTTGGCCTTGCTGTGATGTTTATTCAACGT
GGACCGTCGCCAGGAACTGGAGGACGACCAGATGGCCATCACGTTCCGGTGCAAGGATCTCGGGACGTCGGGATGGATGGGGGTAGGGTGGGGAGGGCTGACGATGGAGCTGGCCCAGGT
AAAGAGGAAGGGTTGGACAAGGTAGACATCTCCACCCTGCCTGTTGCCGGTGTTCCTAGTAAAATGCTGTCCCCGCAAGCTATATCTGCGAAAACAAGTCGATTAACGGTAGAGACCCCA
CAGGGCCGACCCTGACCACACGTAAAACGAACTGACCAAGCTTCCCCCCCGCCCTTCCTCCCACGCCCCTGCCTCGAAGGATTTTATCATCTGCGAGATCACCGACGAGAGCACTGCTTC
CTGCACAGATCGTGCTTACACCACCGAGCGCGAGGCACCCCCCCTGGACTCCGCGGGCGAGACCTCCCTTAACTTCACCGACCTCTCCATGGAGGACGGGTGGACGTCCGTCACCTTCCT
GCGAGACCGGGGGGCGTTCGATGACCAGGACTACGACTTGGGTTCG
GTGCGTTGTTGGTGGTGATAGTGATGGTGGTGTTGTCTTACCGTTGTCATCGCTTCCTTACAAGGTAGTGGAGG
GCCGTTGTTCGCCTCATTCTCGTACCCCCCCTGGCGCGGCGTCCTGCTCCAGCCGGTAAGGTCGGCTAGGCGCCCCTTCTCGGAACGGTTTCGTCTTTTAAGTCAATTCCCACACCCTTT
CAAGGCCGTGTGCCCCCTCTCGCAACGGTTTCGTCTTTTGAGTCAATTCCCAAACCCTTTTTAAGGCCGTGTGCCCCCTCTCGCAACGGTTTCGTCTTTTGAGTCAATTCCCAAACCCTT
TTAAGGCCGTGTGCCCCCTCTCGCAACGGTTTCGTCTTTTTAAGTCAATTCCCACACACTCGAAAAGCCTGTGCGCCTTCTCGCACCGCTTTCGTCCTTGAGTCAATGCCTGCCAACTTA
ACGAAACAAGCAAGAACACCCCGCCTCCAATCCAACAAACAGGACATCGACAACGCCGCGGACACTCTGATGATATACGCCTACCGAGAGGGGGAGGGTATCGGGCAGCACCCGAACGGA
AACCGCGGGGCCGCCACGGTCAACTTCGCCACCGGCAACGTGGAGGCGGAGTGCGACGACGACGACTTCGTGCTCCTGCACGGGGCCCTGATGCTTGTCGCGTGGATGGTGCTGGCACCC
GTGGGCATCTACTACGTCAG
GTGTTTGTTTTTGTTCCCGTGGTGTGTAATAATTCAGTCGCTGGTGATGTTGTTTTGCGTTTTTTGTGTAAACAATGCCTAAATTATGACCACTCGTTGG
TCTAGACATTTGTGTCAATATTTCTTCCAGCTCGTTGTTTGTGTTGAACGAAAGGCCAACTGTCTTTCGTTCGCGCTTTGTCTCTTTGTACGTCGTCTGACTGCTGATATGAAGCCCGTT
GTTTTGTATTTCGAACATCGCGGTGGCGCCAGGTACCGCAAGGGGGAGAGGGTGAAGTGGGCCGGTTTCGAGTGGTTCGAGATGCACCAGGAGATCATGATCGTCGCTTCCGAGGCCGTG
CTCCCTCTCGGG
GTACGCTTCATTCGCCAATCGTCAACCACCAATCACCAATCACCAATCACCAATCACCAATCGACAACCACCAACCACCACTTACCGTTCACCAATCACCAGTGACCA
GTCATCAACCATCATCACCAAATACCACTTATCGTCCGCCAATCACCAATCGCCAATCATGAACCATGAGTCACCGCGCTTTCGTTCGTTTTTGGCCTTTTTCTTTATATATTTTCGTGC
GTGTGTTATCGGGTCGTCCCTGATTTTTCGCGTGGCTACGTAAATTGCTCATTTTTTATTTCATGGTGAAATGCTGGTGTTGCCAGCCCGTCACCACGAGTTGTTTTGTTGACGTTGAGG
ATTGTTGCCCGCTTGGTGTTGTCGCTGTGGTCGCACTTGTGAGGTCATGTTTTTTTGTTTTTGTTGTCGGATTCGCAGATAGATCCCCACCGTTCTCGCCTCCGGCCGCCAGCAAGAGCA
CGGCCTGCACGCACAACGGAGATATTCATTAACCGCCTTTAGCCGCACTCGTCACATATCCCCAGTTTGGCCGTGATTGAGAGAGAGGGGGGGGGGGGGGGGGCAAATTTTTTTCCCTTT
TTCAAAAAATTTTCCCCCCCCCCCCTTTTTTTCCCCCCCACCCCTTTTTTTTTTTTTCCCCCCAAAAAAAATTTTCCCCAAAAAACCCCCCCGCCAAAAAAAAAAATGGCAAAAAAATTT
AAACAAAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCGGTGTGTGAGAAAAAGACCCCAAAGGCCCCCC
CAAAAAGGGTCCCAAGGGAGGTTTGGCCCCCGGACAGAAAAACCAAAAAATTTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGGCAGTTCAACAAGCACTTCCAC
ATCTGGGCCGGGCGCTTCGCCTACCTGGCCGGCGTGGTGCAGTGCTACCGGGGGCTGGAGCTGGTGTCGAGCGACGACAACCTCGTGCTGTCCGCGGGAGACGGCTTGGACCTCGAG
GCG
AGATAGCCCCTGTGGGATGCCTTGTTTCGCCGTGTGTTTTTTGTAATGTTCCGTCATGTGGATATGGCCCCAGTGGGATGCGTCCGCGTGCTGCTGTTCGTGTGTTTTGTACGTGCGGAG
TGTGTGGACATGGCCGCTGGGGATTTCGTTTTTGCCTTGTCTTCGCAAGCTCGACATCACCTCAACAACCTGCTGCTGCTGACACGGAACTGGCGTTACGTACGACGCGCTTTGTTGTTG
GCGTTCGGAGCAGATCGGGAGCTTCGGCGTGTTCAGGGATGTCGGCTTCCCGATATGGTTCGCGTTAGTCGGCTTGGGCTTCTTGGTCTTGGAGACTCGGAAGCAGTATCGCAGGTACGG
TACGAGCTGTTGCTGCTATTCGTGGTGTAGGTGTTGTTGTTGCTGCTGTCGGTGGTGGTGGTGGTGATGTTGCTGTTGTTGTTGTTGTTGGTGGTGGTGGTGGTGATGTTGCTGCTGCTG
TTGTTGTTGGCGTCTTGGTATTGGTGTGATGTTGGCGCCGCCGTTCTCGTCATGGCCGTTGTCCTTGTCGTAGTCGTAGTCGTAGTTGCAACCGTAGTCGTTCTTGTTACCGGCGTTAGC
TTGACTGCGTCTTAGCGCAAAACCCGCGTTTTGGCAGTGACGCGATCTATACATGGACACGCTTCTTGTGAGGCGGCGGATTTGCCTCCGTCGTCGTCGCCCATTATGCTGCTCGCCGAA
ACAACCAAGGTGCTAGATACTGGTATGTGAGTACTGTATGTAGGGATTTTCGAAAGCGAAAGCCGAAGCTTACATCTATGAAGCTTTGGAAGAGCCCCCACGAAGGGGAGAGGGGGGGGC
TCCGGGACAGGCGACGTTCTTTCTGGCCTTGGCTCGACCAGAGCAGCGACCAAGGAGCTCCGGAAGAGAGGGAAAACGCGTAGTATCGTAAGGTTGCGAGTCAGCGCACAGGGGTGCGAT
CGATTTTCAAAGTTTACTTTCTCCACAGCCAGAAGGGTGCGAGCGCCAACTGATACTTCTCAGGAAAGCTCTCGATGAGATATTTCCAAAACCACCATTTTCGACAGTGGTAACCTCCTG
GTTGTGGAGAAATTACGCTTAGAAAATCGCTCGCACCCCTGTGCGCTGACTCGCAACGTTGCGGTAGGCTAGCGTAGCACGATTGCTGCTTTTATCTCCCCTCAAGAAAGGAAGGAATAC
ATTTAAAAAAAAATGCTAACCCTCGTCGAAATCACCGCTGCCGTATTTTGCGCTGCAACGTTTGGAGAGCGAGCTCCGTTTGTTTGCTTGTGTCTTGTGAAGCTCGTGTACGCTTCGTTT
TTGTTTCCCTTTATTTGTTTTTTGGTAACAATCTCTACCACTACATACTCCTGAGTACTGTTTTTTTTTTTTTGCGTATTGTTCCTTTCCATCCTTTATTCATTGTCCTGTTCTTCCTTT
TTTTTTTTCTCTATCATCCTTCTTTATGGTGATATCAGGTACTTCCGCAAGGGCGCGGCCAACCTGTGCGGGTGCGTCGAGCTCATCAACGAGGAGTACACGGGAGAGAAGGGGGACGAC
GGCGAAAAAGTGGAGGACCGGCTCGTGCCTAGGACGGAGGCGCTACCCTTGTACACCGTAGAGGAGTTCAACGACAAG
GTGCGGTGATGCTGCTGTTGCTCGATTTATTCGGGGGATACA
TATTTTGGTCGCGGTGTTGTAAGGGGCTCAGGCGTGTTGGGGGGGAGGGGGGGGGGGGGGGGGGCTCCTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTCGTGGTTGGTTACATCGAGGAAGAGGAGGAAGGAGATGAGGAGGAGGAGGAGGAGGAAAAAGACAAGAGCGTGAGAAAGGCGGGAGCAGCAGGG
GAGGAGACGCAAGCCGCCGCCGGCGGCAAGGAACCTAATCGGGCTTTCCGCATCGCCGGGAAGGCGGTATTGATGCAGGCGAGGGGGACTGCTGGCCGCACGTTCGACCTG
GTGAGAGTT
TTCGTGTATTTTGTTGTTGTTGTTGTTGTTGTTGTCGTTGTTTGCTTCTGGCCTGTGGTATTATGCATGTTGCAAAACAACCGAGGAAAGACGCGTGTCTCTGTGTGTGTCTGCTATGTA
CTGTAGCGTTGTTTTATTCGTTGCTGCGAAAGTACTTTGCGTATCCCGGAGTCGGTTGCGGCAACATGTTGCAATGAAAAAAATGTATTACGTACTTACTTGCAAAACCTTGTTACTCGT
TGTGGCGAAAGTGCTTTGCGTACGGGAGGCGGTTGCGGCTGCATCTCGACAAGGTGGTACTGAAAATGGTGGTTACACGTACAGCAGAAGCCTCGCTTGGTCTCAAGCCGCAAGCCGCAA
ACAACGCTGTCGAGAGACCCTGAACCATCATCAACATTGTAGCCCCCATCCCGCGAACAACGCTTGCATGCTTGCTTGCCGTCCTAACCTTTGCCGCCCCGTTCCTCCCCTCCCCTCCCC
AGGAAACCAAGGCGGCCAAGGCCAACGAACTCGCTGTCGTTCCCGACGGCCCTTCGGCGCCCTCAGCCGGAGCGGGAGTCACGACGTTCGGTGTGCCCGTGGTCTCGGTAAGCGAGCGGT
GCCGTTTGTTGTGGCTAAGTACCATGGCTTTTTTTGGAGATACACCCTTAAGGAGGGTACAATCTCCCCCTACCTGTAACGTCTGTCAAAGACGATTCCCTGTTTTCACGCTGGTGTTGT
TGTTGTGGTGGTGGTTGTTGTTGTTGTGGTGGTGGTGGTGGTGTTGTTGTTGTTGTGGTGGTGGTGTTGTTGTTGTGGTGGTGGTGTTGTTGTTGTTGTTGTGGTGGTTGTGGTGTTGTT
GTTGTGGTGGTGGTGTTGTTGTTGTGGTGGTGGTGGTTGGTGTCGTCTGTCCAGGAGACAAAAGGCAGGCAGTCCAGCTCCATCCCCAGAGACAAGCCGTTTTTCTTCTTCCGCGCAGGA
AGCCAAAGCTACGCATCGTGCTGTCGTTGCTCACCCGTATACCCCCCCCGACGGGTGAGGTCAATGGTCTAACGACTACGGCATGCACGACTATGAGTACCCCCCACCCCCCACCCCCCA
CCCCCGTATCTCCTCCGTGTTTCCCCCCCACACTTTCTTGCAGCCTGGTGCTGGTCCCGCGGCGTTGAAGCGGACGTGGTCCAGCAAGAAGCTGCTGCAACGGTTCCACGTCTGCCCCCT
TCTGTTCCGCGAGAAGATGGGCACGGACAGCCCGATTGGCCGCGGCCTGCTCTTCACCAAGCGACCGACGTACCGCTACATCTTCTCGTGCCCCGGGCAGGCTCAGGCCCTG
GTAAGCCA
ACCTATAATCTGCATCTGTCTATTTGGACATACATATTTTCATGTGTGTTGTTCTCTTCTTTTTTTTTCGTGTAGACGTGGTCCCGGTGTAGCGGTCCATCGTGTCAAATGTTGTTACCG
CTATTGAGGGCATCGCCGCTGAACCCGATTGGCAGTAGGAGGTGCAGCCACGGTAGTTTGAAACGATATTGACGGCATCCCGCTGAACAGGGGACCGCTAAACCGGGACCACGACTCTAC
CTCGGAAGTGTAACACAGCAATCGTCCCCATCCACGGATGAGTCGTTTTGTCCTTTTTTTTTTTTTCGTTGCAATTGGCGTTCCGAATCGGCGAACAAAAGTATGTAGCGGTCAATCCCC
CTCCTTCCTCTACCCTTCCTGCATTTTTCTCCTGTTTACCTTATTGCCCCCTCCTACTCGCCTTGCGTTCTACTTCCCCCCCCCCCCCCCCCCTTGGGGCAACGTCGGCTTTGCCGCCCA
AACAGGTCGAAACAATCCACGGGGTTTGCCACTTCCACATGCCCGGTCAGGTTCCAGGAAAGGTGCGACGTTTTTGGTTGTTCTGTACTGCAGTCCTCCTCGGTTGTTGACACCTTTTTT
TCACAGCTATGGATAAAAAAGCAAAATTCACCACGCACCCTAAAAGGAAGGTGGGGCACGAAAACAAAATAAAAAGAAGAAAAAAGCCCCAGTGTTTACCCCCCTCTTTTGTGACCCTGG
ATGGTCGTAGTTGTACGAAAGAAATTCACTGAAAAGTGTAGTACTCTACATACACTGAAGAGTGTAGTACACGTTTCACCACGAAAAACGGGGGGACTTTCGCCATACCGGTAGTAAATA
GGACGAAAACACACACAAAACACATGGTTTCTCATAGAGTGTACAATATAACATACTTACTTAGCCCAAGGGATCTGTGCGGCCAGAACGAGGGTCGTCTCAACACCATTTCAAGACACG
GGCATGTTTCCGATGATTGTCGCGTTTGCTGCCTGCTGCTGCTGCGGCGGCGGAGGCGCTTTGCCCTGACTGGTGCTGTGCAATATCTACACAACGATAAAGAAAGACACTCCCTGCGTT
CATCGAGATGCTACAGTATCCCAATCGAAGGGATGCGTGTTGAGTGAAGTATTTACAGCAAATCAGTTAGAGAGTCGAGGGGACACCCGCTGCTGGATGATACAACTGCTGTCCCATGAT
CGCTCTTCGGTGACGGTGCTCCCTCCCTTTCTGACCCTTTCCCCGTTGCGTCCGGCTGGGTGGCCACCCGCCCGGCTCTGCCTGCCATAAACGCAGGGCGTGATCCAGAGGGCCTACAAC
GCGTACGCCGTGCGGGTTCAGGGATTTGTCGACGGCAAGGACGGGAGCGGCAAGGGGGCGACTCCTCCCAGAGTCGTGCCCGCGCAGGAGACCTCGGAGGGGGTGCTGTGCATTGAGATG
AGGATCCGGCTTTACCACGACGGGGCCATGAGCCAACTTCTGGAGAAACTGTCGAAG
GTAAGGTTTGTATTTGTGTTGTCTCGTCTGTTCTGTCTATCTCCTTGGTGTATTTTTTTGTTT
TTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGCCTGTCTGCCGGTGTATAGCACTCCCCGTAATCCTGGCATTGGTGAAAAATCAACCA
ATATCTGTGTTTCTCGTCGCTCTGCCTTGTTGCGACTTTTTTTCCCCGCGTTCTTCCGTGGTGATTTCCTCGTGGACCCTCTCGTGTTGCTTCTACGTTCGTTTCCTCTCTCCTTTCTCC
TCTTCTCGTGACGGTGGCTGCATACCATACCACACGTGCACACAGGACACGGACAATCCGGCGATCCAGCTGCAGGGCCCCTTCATCATCACCAAGCTCGTGCCGCCGCCCGCCCACCGC
AACGTCGTCATGATCGCCGCCGGCACCGGCGTCAATCCGA
GTACGTTGCGTAGCAGTTTTTTTGTGCCTTGGCAATGTTTTTGGTGGCTGTTTTTTTCCTGGGTAAGGGCTGCCTCGTGT
AAAAAAAAAAATGCGAAACAAGCCAGGGAAAATTGTCTGACACATGCTGGAGAAAGGGGCCTTGAATGCCCTCTTGTTTTACCTGGGGCATGGTTCTTAATTTCTTGTGTGAAGGTAGAG
GTATCCCAAGATGAACTATTCGTACGACAAAGTAGGGTTTAGTGCTGGCCTCTTGGCTGAGCACCTTTTCTTGTAGTCAAGTTTCTTTGGCCATGGGTATTTTTTTTAGTCTTGAGGTTC
TTAACCCCCTTGTTGAGGTCGTGGCGCGCTCTGTGCTATGCAACACCCCGAAAATTACCGGCACCATCTTTGTCTCCTACGACCTTCACGGAGCCCCCCCCCCCCCCCGCGCGCGCCGTG
TGACCCTATCCTTTGTCGCTCGGCTTGTGTTTCCTTGTGTGTCGGGTGACACTCAAACAACACCGTACTTGTCTTCCGCCAAATGTTTCCGGGACGACTTCCGTGGGTGACCATCGCGAA
CACGGGTCAACCACTCCTCACCTCGACAACCTGGCCATGGTATGGAATTCGAACATGGGAATCTCTCCTCGTGGACACGTACCCTCGACTGCAACACGTGCGCCGGGCTTGAAAATTCGT
GTGATCATCATCACCGATGCTTCCAATCAACATCGACCTCAACACACACGCGCACACGATGGTCGACTTGAATGCAGTGGTGCAACAAATTCGAGACTACCTCGCCCTTCCCAGGTACAG
CAGTCTACCGTGCGTGTCCTTCCGTTGCGGAGAAGATTTTTGCTTACCGGGGTGCCGTGTTTTTCTGTAGGAGTAGTAGTGGCTGCGAATGGTTCTTCTCTCCTATGCATGCCTTTTGGT
TTGCTGATGGGCGCAGATATGTGTGTAATCGTTTGCCTTGGGTGTTGACCGATTATTTGATTTCTAGAAAGGCGTTCCCTTTTGGGTAGTGGTTGGCCTGCTGTGGCCACGGAAGGTGTC
CGCGCCAGCTGGACCATTCCGGGCATTAGAAGGTACCTCCAAGCACAGACCGAACGATATTTTATGTGAAAAATACAACCACAACAACCAATACTGAAACAACAAAAACGTTCATCCTCT
TGTCGGTTCTTGTTGCACAATGCTTGCTGTGCTTGCTGTGCTTGCTATGCTTGCTATGCTTGCTATGCTTGCTATGCTTGCTATGCTTGCTATACTTGCTATACTAAACGAACTCAATCA
TGAATCAATCGTTGTGCTTATCAATCAATCGTCGTGCTTACGAAACAGGGACCAGGCTCACTCTACAAGGTCCCGGCTGTGCCTGATCTGGCAGAGCATGAGTGAGGCGGAGCTATACGG
GTCAGAAGAGATTACGGAGATGCAG
GCGAGCTTTCCTTTTGTTTCGTTCGTTCTGTTGTGCCCCGCAGGCTGTGGCATTTGGCCCCGTAAGCTTCCACGCGGCGAGCGTTGCGCGGGATC
GACAGTTTTGGGAACTTGGTGTTTTCAACGGTTTACGCTGTGCTCGGCTCCGGCGCAAAGCAGCAACAAAACTACTGCCCATGATTGCGAAGCTCGCCCCTTTCTTCTCCACGGGCATAG
GTTAGGTTATGAACGACAGTGACATGCGCGCGAATGTGCCTCATCCACGCGTCCTTCGAAGTACGATCATCTCGCAAGAACTCGGGAGACCCTTTTGTTTCGTGAGAACGTTTTTTTTCA
TTCGTGTTTGATGTTCATGCCCCTTTCTGAAATGGGTCAGAAGGCCGGACTGCACCAGCTGCACGTTTTGTTCTGTTTTTGTACAGGTATTGATATGTGTCGTGCAGCAAACCACCAGGT
GCAGCAGGGAGGTAGACACAGAACAGCAGCAACAGCGCCAAGAACGACGGTCAAATCTCTCGACATAGACCTGCTTAATTTCAAACCCTGTTACTTGGTGTCCAGGACACACGAGGAGCG
TCTCTACTGCCAACACTCACGGCTCACGGCTATTGCAGGCGCTACACAACGAACGTTCGCCGCGGCATCCACGCCACCTTGGGTCGTTTTTTTTTTTTAGTCACGGGTGCCCCCCCGCGC
CGCCACTTCTTTTTTTTTCAGGCCAAGAGCAAGGGCCTTCTGGAAGTGATTGTTCTCGTGAGCGGGGACCAGAGGCGTCGTAACGTTCCCGGGGCAGCTTTCCGCAGGGGCAAGAAGATG
ATGAGCAAGGCAATGGCGATGGTCTCCCCCGTTAGCAGCTCTCCGAGCAGCTCGGTCATCGCCATGCCAGCCGGGAG
GTGGGTGGGTGGGGAGAAGATGCTGGCGTTTGGTTTGGTAGTA
TCGTTTTTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTCGTTGTTGCTGTTGTTGTCGTTGTTGTCGTCGTCGTCGTTGGTGGT
GGTGGTGTTGTCGTTGTTGTTGAGGTCGGCGGTCTGCACGACAAGTTTCGTTCGGTTCGGATCAAGTAGTGTGTCGAAATCACAACGCAGGATTTAATTTTTCGAGCGACCCTCCCCGCC
CAAAGGCACCAGCCACAAGAACAAGCCTGAAGAACAATCGTGGGTCCGGTTCTTGCTTTTCCCGTGCACGTGCCCGTCCCATCAACCATCCCGCTACCGGTCAGGCCTCCCAAGGTCTAC
GATATGAGCCCGAACCGTCCGGATGATGAAGAACGTTCCTCGGGAGGCATTGCTGGGCACAAACGTGGCAGGCGGAGATCTGATCAG
GCGAGCAAAAAAAGTTTTGTCTTACCTTTGTTG
TTTTTCCTTCCTTTTTTTTTTTATCTTCTCTACGCCGGCCTGGTGGTCTCATTCTCCTTGGTTACGCTGTTGTCTGGAAGATCCAGCGGTTGGTTGTAGGGCAAGGAGGCCTCGTGTGCA
TGCGTCCCCCTCCCCCCCCCTCCCCCCGCAGTAGGGGTAGGAACGGTGCTCCGTCTCGAAAGGGACGCGTGGTCAATGGTCAAGTGACTAAGGCAAGCAACAAATGAGTACGCCCCCCCA
CCCCCCAAGTCGGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGAGCCTGGTCCGGTGAGAACCCGGCGTGCTCCGTCCCGTCTTTGTAGGGATGCGAGGTCAATGGTC
TAACGACTACGGCATGCACGACTATGGAGTCACACCCCCCCCCCCCCCCCCTTTTTGTGGGGGGCTGACGATGAAATGCTATATGTTTCCTTGCTTGTAAGAGGGCTGGCCGTTCTTTCG
ACGAAGTTACATGTACGCATTGAAGGCAGTCTACATATACCATGACAAACGTGAGGCGGTATCCCCTCGTCGAAAATAGCGGAGAGGTTGAATCGGCAGCGCGTCGATTTCGAGTACAAG
CGGGAAATAGAGGCAATCCTTCTCCTCGGAAGGGGTGCCAGGTCAGGTCAACGGCCTACGTGATCCAGCAGCTGAGCGCCCTGTTGAACCCTCGAGCCGTTTCCATTTCCTGGGCACTTT
TTTCATCGCGGCGTTGCCCCGCTCGGTTGTTGGTGTCCTCTCAAACGGGGGGAGGAAGGTACCGATTCAACCTCACCGCCACCGCTGCCTGTAAGAGCTGGCTTGCAAGGCTCTTTACTC
ACGACTATTTTATTTTATTTTCTCGACAAATCCTTTCAGCAACTTTTTGGTTTCCGATAACTACATTTACATTGTAAGACGACCAGATTTTTTCTTGTTTTTTTTTTTTGCGTGGGGTAA
CAGCAAGTAGTATCTCACTTTCTTTCTTTCTGTGTGTGTGTTCACGTGTATTTTTTCATGGAAGCAGAAGCCACTGGCGGCAAATCCGTGGGAAAAGTTCCAAGACGTCAAGTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGGGGTCGCTTGATCGAGTGGGATGCTGGTCCATGATGCCCCCCCCCCCCCCCCGCTCTTACAACGCGAAGATTTGCGCCAAACCCAA
GCATATCCAATCGTATCGTCCTACTTCGTTGTGTCTATATACAAAGTAGCGTCAAATCTGATCAAATCACACCTTTTTTTTTCTTTGTCCAGTCTGGTCGTGGCCCCCCCAAGTCTCAAT
GCACCACGTCTGCATTCATTCAATCTCGTGTCGTGTTCGAATCCGATGCGGTCATTCCATTCCAGGTGGTGGTTTCCGGTCCGAGCGTGTTCGTGTTCTACGTGGAGACTATCCTGGCAG
AGATGGGAGTGCCTTCCGAAGCAATCGTCTTCCTCGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGGACGTCTTCTTGACGTCGACGGCCGGGCTGTCGGCGAAGAGCTCCCTCTTCATCGCGTGGGGCCAGCTGCTGACCTACGACCTGGCCCTCACGGTGGCCAACGGGACCGAGTCC
CTCGACGTGCCTTGCAACGACGCCGACCAAAACGGGGGGATAGACGTGTGGTGTCCCCTAGGTGCCGCCTCGGAGGATATTCCCTTCTCCAG
ATCGGACGCCGCGGAGGGAACGGACGGC
GTGCGCAGCCCCATCAACTACGCGTCCTCGTACATCGACCTGGACTTCGTGTACGGGAGAAGCGCGGAGGAGGCAGAGCTCCTGAGGACCATGGAAGACGGTTTCATGAACGTCACGGAC
AGTGGAGTGCCCTTCCAGAACGAGGACGGAACGTGGCTG
GTGGCGCCGGACATGGGCTTCGAGGGAGACGAGGACATTTTCCAGGCCTGCCGGGGATGGACGATCGCCATCTTTCAGCAC
GTGACGCAGAACGACTTCCTCATCAGGCTTCTCGGCATCACTCTGACGGACCTGGGCCTCGCCATGTACCTTGGCAGCGACGACGACTTCACGTCCACATACGACTCGGAGGGCGCGCAC
AGGAGATCGCGTAG
AGGGAGGAGGCTCTATGTTTCTTCGAACGACTACAACACGACGATCAACGCAGCCGCCGACGCGTTCACCGTCACCGCCGGAGGCGCGGCGTTCGAGTCGGCCCTG
CCGGGCACCGTGCGCATTGTGTCGGACGG
GTATGTCTCAACCGACGACGATAACGTCGAGCTGAACGTCGCGAGCGCCGACATGGCCGGGATCTTCGCGAGAAACAATGTCGCCGACGTC
CTTCGCGGCGCCGTGCTCTCGCCGGCCCTGACGGTGGACGCCTACTACTCCCCCGTGGTGTCCAACCTGTCCCCGCTGTTCAAGCTCCCGGTCGACGGCGTCCAGAGGGGGCGGGACCAC
GGGCTGCCCTCGTACAACGGTGCCCGAGAG
GCGTTCGGCCTGGACCCGGCGACGACGTTCGAGGACGTCTCCGACGATGCCGACCTGGCCTCGCGCCTGTCCGACGCGTACGGCGGGGAC
ATCAACGGCCTCGACGCCTTTACGGGGGCGCTGGCGGAGGGGACGCACTCGAGCACGGGGGGCGTGCTGGGGGACCTCCTCGTCGCCGCGTGGTCGGACCAGCTCACCCGCTCCATCGCG
GGGGACAG
GTTCTATCACCTACACGCCCGTTACATGGAGAACGTGGCCAACACGACGCTCATGGATGTCATAGGCCGCGTCACCAACGCCACGGACCTACCGCTCTCCGTATTTCAGGCG
CCCAGCATCACCGTCTGCGACGGAGGGTGCGCCGGGGACGGAGACGGCATCGCCGTATTGTCGGACAACTTCGAGCTAGAGTGGGAG
GAACTGGAGGACGACCAGATGGCCATCACGTTC
CGGTGCAAGGATCTCGGGACGTCGGGATGGATGGGGGTAGGGTGGGGAGGGCTGACGATGGAGCTGGCCCAG
GATTTTATCATCTGCGAGATCACCGACGAGAGCACTGCTTCCTGCACA
GATCGTGCTTACACCACCGAGCGCGAGGCACCCCCCCTGGACTCCGCGGGCGAGACCTCCCTTAACTTCACCGACCTCTCCATGGAGGACGGGTGGACGTCCGTCACCTTCCTGCGAGAC
CGGGGGGCGTTCGATGACCAGGACTACGACTTGGGTTCG
GACATCGACAACGCCGCGGACACTCTGATGATATACGCCTACCGAGAGGGGGAGGGTATCGGGCAGCACCCGAACGGAAAC
CGCGGGGCCGCCACGGTCAACTTCGCCACCGGCAACGTGGAGGCGGAGTGCGACGACGACGACTTCGTGCTCCTGCACGGGGCCCTGATGCTTGTCGCGTGGATGGTGCTGGCACCCGTG
GGCATCTACTACGTCAG
GTACCGCAAGGGGGAGAGGGTGAAGTGGGCCGGTTTCGAGTGGTTCGAGATGCACCAGGAGATCATGATCGTCGCTTCCGAGGCCGTGCTCCCTCTCGGGTTC
AACAAGCACTTCCACATCTGGGCCGGGCGCTTCGCCTACCTGGCCGGCGTGGTGCAGTGCTACCGGGGGCTGGAGCTGGTGTCGAGCGACGACAACCTCGTGCTGTCCGCGGGAGACGGC
TTGGACCTCGAG
ATCGGGAGCTTCGGCGTGTTCAGGGATGTCGGCTTCCCGATATGGTTCGCGTTAGTCGGCTTGGGCTTCTTGGTCTTGGAGACTCGGAAGCAGTATCGCAGGTACTTC
CGCAAGGGCGCGGCCAACCTGTGCGGGTGCGTCGAGCTCATCAACGAGGAGTACACGGGAGAGAAGGGGGACGACGGCGAAAAAGTGGAGGACCGGCTCGTGCCTAGGACGGAGGCGCTA
CCCTTGTACACCGTAGAGGAGTTCAACGACAAG
GAAGAGGAGGAAGGAGATGAGGAGGAGGAGGAGGAGGAAAAAGACAAGAGCGTGAGAAAGGCGGGAGCAGCAGGGGAGGAGACGCAA
GCCGCCGCCGGCGGCAAGGAACCTAATCGGGCTTTCCGCATCGCCGGGAAGGCGGTATTGATGCAGGCGAGGGGGACTGCTGGCCGCACGTTCGACCTG
GAAACCAAGGCGGCCAAGGCC
AACGAACTCGCTGTCGTTCCCGACGGCCCTTCGGCGCCCTCAGCCGGAGCGGGAGTCACGACGTTCGGTGTGCCCGTGGTCTCG
CCTGGTGCTGGTCCCGCGGCGTTGAAGCGGACGTGG
TCCAGCAAGAAGCTGCTGCAACGGTTCCACGTCTGCCCCCTTCTGTTCCGCGAGAAGATGGGCACGGACAGCCCGATTGGCCGCGGCCTGCTCTTCACCAAGCGACCGACGTACCGCTAC
ATCTTCTCGTGCCCCGGGCAGGCTCAGGCCCTG
GTCGAAACAATCCACGGGGTTTGCCACTTCCACATGCCCGGTCAGGTTCCAGGAAAGGGCGTGATCCAGAGGGCCTACAACGCGTAC
GCCGTGCGGGTTCAGGGATTTGTCGACGGCAAGGACGGGAGCGGCAAGGGGGCGACTCCTCCCAGAGTCGTGCCCGCGCAGGAGACCTCGGAGGGGGTGCTGTGCATTGAGATGAGGATC
CGGCTTTACCACGACGGGGCCATGAGCCAACTTCTGGAGAAACTGTCGAAG
GACACGGACAATCCGGCGATCCAGCTGCAGGGCCCCTTCATCATCACCAAGCTCGTGCCGCCGCCCGCC
CACCGCAACGTCGTCATGATCGCCGCCGGCACCGGCGTCAATCCGA
TGGTGCAACAAATTCGAGACTACCTCGCCCTTCCCAGGGACCAGGCTCACTCTACAAGGTCCCGGCTGTGCCTG
ATCTGGCAGAGCATGAGTGAGGCGGAGCTATACGGGTCAGAAGAGATTACGGAGATGCAG
GCCAAGAGCAAGGGCCTTCTGGAAGTGATTGTTCTCGTGAGCGGGGACCAGAGGCGTCGT
AACGTTCCCGGGGCAGCTTTCCGCAGGGGCAAGAAGATGATGAGCAAGGCAATGGCGATGGTCTCCCCCGTTAGCAGCTCTCCGAGCAGCTCGGTCATCGCCATGCCAGCCGGGAG
GCCT
CCCAAGGTCTACGATATGAGCCCGAACCGTCCGGATGATGAAGAACGTTCCTCGGGAGGCATTGCTGGGCACAAACGTGGCAGGCGGAGATCTGATCAG
GTGGTGGTTTCCGGTCCGAGC
GTGTTCGTGTTCTACGTGGAGACTATCCTGGCAGAGATGGGAGTGCCTTCCGAAGCAATCGTCTTCCTCGACTAA

Retrieve as FASTA