Entry information : EsilPxd06 (Esi_0032_0017)
Entry ID 16975
Creation 2021-02-04 (Christophe Dunand)
Last sequence changes 2021-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Peroxidase information: EsilPxd06 (Esi_0032_0017)
Name (synonym) EsilPxd06 (Esi_0032_0017)
Class Peroxidasin    [Orthogroup: Pxd003]
Taxonomy Eukaryota Phaeophyceae Ectocarpaceae Ectocarpus
Organism Ectocarpus siliculosus    [TaxId: 2880 ]
Cellular localisation N/D
Tissue type
Inducer
Repressor
Best BLASTp hits
Perox score E-value EsilPxd06
start..stop
S start..stop
EsilPxd02 498 5e-161 162..610 14..432
EsilPxd03 481 2e-154 158..608 10..430
EsilPxd01 466 7e-148 98..381 22..304
EsilPxd04 404 4e-127 165..610 1..399
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 50904..50952 49 N° 2 51175..51369 195 N° 3 57910..57957 48 N° 4 60867..60982 116
N° 5 61217..61293 77 N° 6 61596..61744 149 N° 7 62035..62315 281 N° 8 62758..62877 120
N° 9 63335..63437 103 N° 10 64321..64577 257 N° 11 65724..65885 162 N° 12 66166..66528 363
join(50904..50952,51175..51369,57910..57957,60867..60982,61217..61293,61596..617 44,62035..62315,62758..62877,63335..63437,64321..64577,65724..65885,66166..66528 )


exon

Literature and cross-references EsilPxd06 (Esi_0032_0017)
Protein ref. GenBank:   CBJ26336.1
DNA ref. GenBank:   FN648509 (50904..66528)
Protein sequence: EsilPxd06 (Esi_0032_0017)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   639
PWM (Da):   %s   67948.64  
PI (pH):   %s   4.05
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGRAAPEARTPQKQQHFGRAAPGGQAPGGGDVDSEGPRFSANLQNATNLGRGVEIIFQNIGRWRISLADLVGRDSRGEYPDGQAEPNSKGTPLQTTQVGQTVLADDLDLEEFTPRSFDGVGNNEAFPSWGAVGATLRSVAGAYYADADFTPPGDLTRPTAREVMTDVFLESPPALSTMSALFIGWGQLLAFDLSLTSDNSSEPLDIECNGTGAGGVDVWCPLGAESDPIPFYRSDAALSDDDGALGEETRSPVNYATAFVDLDFVYGRSEDEAAALRSSADGDGFMALTENGLPYVNDDGTWIADQRSAQFPVTFALHVMLLLEHNRCCMDIAPSEGFEGDEDIYQACRGWTIAVFQHVTENDFLIRLLGGNIQDLDEDGREHPVPGRQSRRGLWLTTDYDENTNPGADTFTLTAGVAAFESALPSTVRVVGEGYESTRYDNIELAAAVGADGLVSFFNNVVVDVLRGAVLSPVYAADTHYTAAVSNGSPLFKLPVDSVQRGRDHGLPTYNDARAAFGLSEATTFTDVTTSSSSTSSSTTTTSTTSSSGSDADEEVADILSTAYGGNVSTLDAVTGALAEPTMASSGGVFGELLHAAWLEQMYRCVHVCVSFVCVLCIFCRPRYPRLCVCVCILK*

Retrieve as FASTA  
Remarks
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACGAGCTGCACCCGAAGCGAGAACACCACAAAAGCAGCAACATTGCACGTTGCTGTTCTCTTTTCTGAGACGTTTCTATTCTCGTCCTGAAGCGACGTTTCCGACAGTTGGAAGA
GCTGTAGCTGGAGCAAAATCACAATGAAGCAACGACATGCACGTTCTCTTTCTGATGACGTGTCCTGCAAGTTGGCAGAGCTGTCACGGAAGCGAAAGCACCAGGGAGCAGCAACACTCA
CGTTTTCTATTCTCTCTCTGATTTCCTGCAGTTGGAAGAGCTGCTCCTGGAGGGCAAGCACCAGGAGGCGGCGACGTTGATTCGGAGGGTCCGAGATTTTCCGCGAACCTTCAGAACGCC
ACCAACTTGGGGCGAGGGGTGGAGATAATCTTCCAGAACATTGGTCGATGGCGTATTTCGTTGGCGGACCTTGTTGGCCGAGATAGCCGCGGCGAATACCCTGACG
GTGAGAGAAGAAAG
AAGATCTTCGGTAAGGGTCGGTGTTGTCGTTGATGTTGTTGGTGGTGCTGTTGTCGGTGGTGTTGTTGTTGTTATTCTGACGGTAAGAGAAGAAGGTTTCTGGCGAGGGTCCATGGTGGT
TGTCCGTGTTGTTGGTGTTGTTGGTGTTGTTGGCGGCGGTGTTCGTGCTGATGGTGATGTTTCTGGTGTCGTCCTCGTTCGCGTTGTTGCTGTTAGGAGTGTTGACAACACCGATTTCGC
TGTTGTCGTTGCTGATGCGGTTGTTGTTGGTGGTGTTGTTGCTGCTGCTGCTCTGTCGTAAACTCAGTAGCTAGTGCAGGTAGAATATGATGGCAATGAGGGGACATCATTTGGTAGCGA
TGAAGGAGGAGGAGAGGGAACGGGAGGACAAGAGAATAACCAAGACAGCAATCGAGGAGGGAATCATGGAGTGGAAGAGAGCAAGAGCTTCGAGCAAGAGGACCTTCCTCACAACAGACG
GTACAGGGGCAGAGAAGAACTGCCGAGAAATAGCTGTAATAATGATGATGAGAGTGGCGGTAGCGAAAACAAGGAGGATGGTGGAAGCACTCCAAAACGAACTGGAGTGCAAGGTAGCAG
CCTTGGTAGATACGTGCAGCTTTCCTCTGTTGCTGCCATTTCTGTCTTTAATCCGGAGAATAGCTTAGCCTCCCCCATGCCGCCCCATCGCGGGGTCCCAGTTAATGGCATTTATAAGTG
TTTGTGTTATCAACCGCACTGAGACTGACGTCTTTTCTTTGGCCAGCCGGTTAGCGCGGTCAATGCTAATCGATAATTCGGGTGGCTCAGTTGTGTGTGATGGGAGCGTAGAGCAGCTCG
GCCATGACGGAGGCTAGCCTACTGCGCAAAACAGCAAATCTCCCAAAGTATTCTTGCGGGGTCTCTCCTACTTTCATCTCAAGAGCGTGATATTGAAATGACAGCCTTTCTTTTTCGGCC
CTTGCACGCGGCTCGTAATAGTCAAGGAATATCTTCCAACCTCCACTTGGACTACCATCGGCGATGATCTGGGTCAGGATTGGCATGTATGTCACAGTCGTGATCAGCAGGTTCCACACC
GTTATTGCCTTTTCTACTCTTTCACTCGAATGCACCCTACGCATCTCTTCCATGCTCACGCCTTCTTTTCCGACTGGAATCTTTTCTTCAGTCAGCACCACGTCACGCACTCCTTCCTGG
GCAAACATAGCTACCATGTTCGTCGAAAAATCAAAAACTTAGCCTGCTCATCCTCCCCTTGCTTAAATACACCATCCCAAGGCGCTAGGCGCTTAGTCTCAGTCATTCTAACCGTCGCTG
CGTTAATGGGTACTCTACCCATGTCCCCTGATGAGACGTGAAGTCGACCGGTGAGGGCGTCGGCGAGTGTGCGGGCGATTTCGTCGGTCGTCGGGTTGGCCGATGGCCGCCCCGCGTGTT
GCTGGTGGCGATCCTCGTGCTCTCTTCCGGTCCGGACGTCATCTGTCCTCCGCTCCTCGGCTCGTTGCCTCGAAATCTCGGCCAGTCTTGCTTCTACCCTCTGGTTGACCAAGTCGTTGA
TCCGGGCGTCCTCCTCTGCTAGTCGGGCGCTCACTCGATCTTGCTCGGTGTCGCTCATCGGTGGCTGCTGCTGATCGCCGCAAAGCGATACTCCAAACTAAGCTCGACCCGAATCTCGTA
GACGACGTGTCGTACGCTAGCGTAATCGATAATTCGGGTGGCTCAGTTGTGTGTGATGGGAGCGTAGAGCAGCTCGGCCATGACGGGCCGTAAGGGTAGGTAAAGACGTGTAGACGTGTT
GAAAAACGTGTTGTATTCATCGGGGGCGTGATTGAGCTCGTCATTCCATCACGGCATCAAGTCATGCATAACGCTTTAATACCCAGAACGAATGTCCATGAATCTCCACCAATCTATCAT
ACTCCCAAGGAAAACACAAAGAAGCTTCCTGTTCCTCCGCAGTTCGTCACTGCAATTCCCGCATATGTATACGCAATATACCACCCCCATGCTATGCTACGAGTATATCGAATAAATGGT
ACTTGGAAAAAAACACACACACACACGAACAGGCAGAAGACAGGCCCCACAGAGAAATAGGGTACACGTGCTACTGAAGACCCGAAACGCTTAGCACGAACGGGAGCTTTTCAAGCAGTT
TTTCCGTCACCGGTTAATCGGGTGCATGGCGCGTGTCTTACTTTCGCCGTCGACTCAAGCATAATGCTAGTGAGGTACTGTAGCCCGAAATGCAATTATTTTATTGTTCAACAAACTCTT
GAGGGTTCGACAGTGTGGAGAAAGTTTGCCCCCCCCCACGCTAGAAATTCAATAAATAATGTCGATCCATTTCGTATTATGTTGGCCCCGCAAGCAAGCGTGAGCGCCACACCACAAACT
ATATATGTTTCCTAAACACGTCCTCAATAGCGTCGGATGCCCAGTTTAGTACCGGTGAATGTTCTGTGCACGTACCTTCACTACGAAGGTCCCTCGACTGCTGTACGGCATTTATTTACA
TTGCGCCTGGACAACGACGACACGGCACGTGCCCGGCATTACGATTCAGCAGCAGGTGCTGTACAGTGTACCCAGCCACCACCGGAAGGGGAAAACAATACCCGAAGACGGGGGCCCCCG
AAGCAGCCCAAGACGGACCGACAGTCCGGTATCGGTTAGGGCGGAGGCTCTCTCAGCAGCAATTCATGACGTACTGAAGCGTATATCTTGTCCCCAACGCAACGACATTCAGTTATTTGC
ATCACTTGGAAGCAAAGTTTGTCGTCCATCCAGTATGTCGGGTGTCCAGTCAAACTTGTTGTTTACGCACAGCCTTGGGCGGTCGGAGTGCTTTTCATTCCAATTGATTATTCGCCTCGC
CAAAGCCTCGCACCCCACGGAGATGTTTGGTCCCCGGTCCCCGGTCAGGCGCTTCCATCGCTTCCATCCAAGAAAGCGGTGGCAAGAACGTCGCGCCCACTTCCTTCAAGGAGTACATAT
CGCTTGCGCCCTGTCAAGTCGAACAGCTTGGACGTTTTGTCGTTCTCTCTCTCCAGACATAGATGTATTGGCACATATCTGTACACACTCCGCAGTCTACTAGTCTGCTGTAGGTATTCT
GTGCCGCCACGGGTGACGACGACGTCCACCACACCCCATGTGGGCCGCGTTGCAAGGCTCGATTCCTCCACGACGGAAGAGGATGGATAAATCAAACGATACGTTTAGGAAAAGTCTGGA
TAAGGCGGTACCAACCAGCCGGTACCAACGCCGCGATTGTCTGCACGGCCACTCTCTCTGCCGTTGGAGTAATCGAGTCCTTGGAAAATCCGGGCCAGGGAGTGTGATATCTTCTGTCAT
ACAAGGTTTCCCTTCGGGAAGTGGGTGTCTACCCTCCCTCAGGTGACGCAAGACCACATACGCATTGCCCGAAGAGGTATGTCTTACAACGCTTGTATTTCCGCACAAAACATCCCACAC
GTTGTTGTTATATTCGACATTGACTGGAGCCAGCTCGAGTGGACAATATTTTGGCAGCGAAAACTCAGACTTCCATGATGTCTTTGATTGATGATGGCAGATTTCCGATTGGAACCGCAT
TTGAAGCGGAAACAACACCACAAATGGGACATGTTCAACACTGCGGCTGGATGCATGCATGCTCTCAGACTTGTCTAAACTTCGCCCGCTGCGAAGTGTAAGTAAACGTAGGTACTGCTG
TTGTTGGACAAAATGCGATGACACGAAGAGAGTCACAGCCATGAATCATCGTAAGAATGAATGAATGAATGTACGAATGAAAGTGGATAAGAAGCAAGAGGCAAATATTTCAAACCGTCG
TACTTGATGGGTTTGATAGGTTTCAGAATTGGTTCGCCAGGCTTTGTCAGCGCGGAACGCGTCCCCGGGGTTTCGAGCCAGTTTTCGCAACTTTGGCCGTCAACCACACGCGCCACGGAG
GCCTACCGAGCTCCGGGCGCGGTTAATGTACCGACGAGCCTCCTGCGTGCCCCTGAGAAGGAATTGCGATAAAAGGCTCGCTGCCGCGAGAGAAAGAAACGCCGAAGCATGAAAAGTGAC
CAAATCTTACATGTACATACACTACGGTATTGGGTACGTACATAGATGCAGCAGTAGTAGTAACGTAACAACACGAGATACCTCACCCCTGGACCGATTTTAAAGCTCGATTACTCCACG
TTAAGGAGGATGCATAATCGAAACGATACGTTTTCGGAGAGCTCTCGATTAGGCAGCTTCAACGCCGCCGTTTTTGGCACCCCCCACTCTTTCTGCTGTTGATAACCCAGCTTTGAAAAT
CGGTCCAGGGGGTGTGTTACGCTGTGTCGTACAGTGGGGGGCCCTCTATAGTGCCGGTTGAATAGTGCCAACTGCCGGTATAGTGCCGGTAAAATCTCTCCACACAGAAAGCGCCCTCAA
TAGTGCCAAACGGCACTATTGAGGGCGGGCCTGGTATAGTGCCGGTTGGGCACCACGTCAGCCCGCAATAGTGCCGGTTCACACACGCACGCACACACACCACCACACTCCCAAAATACA
GACACCGTGCTGCTGCAGTCCAACACAGCTCTACGCAGAGGCGCACCATGCCGTGTGCGGAAGGTGAACTGTGCCTTCAACAGAACAGAACGCCGAAGGCCCCTCATGGCCACGTCTGCA
AGGGAGGATGTGGCGGGCGGCTCCATGGCACTTGCGGCAGCGTGGAGGGTGACTTCGAAACATCCCGCATCTGCAGTTCTTGCGTCGCTGCTAAGACTGGCAAGCGCAAAGCGACCGCAG
CTGGGGTTGATGCTGGGGCGGGACCATCTAAACGTCCGACAGAGAAAGGGGGGGGGAAGAAGGCTTCTCGCGCGCGGCTGAGCAACGCTGACAAGGTTGAGGTCCTCAAGCTGCTGGATG
CCAAGATTTCTCATGAGCAGATAGCAGATCGCTTTAAGTGCTCGGAACGGCTGGTCTGCAAGGTGAACGCTGAACGGAAGGAAGTGGAGGCTAAGGCAGCTGCAGGCGACGGAAGCCAGA
AAACCGCACGCAGAGGAGACTTTCCGGAGGTAGGTAGAGTACACGACATGCCTGGCAATTTCCTCTCGAACGTTGTTTTTCCCCGCCATTTTTCAAAAATGCCCTCATGTCGCCGATTTC
TACTGCTGTACCTTTTTTTTTTTGCCCTTCCTTGTTTCTTTGCCTTTCCCTTTTCGTCTTTTCGTATGTATCATATGGTGTTTTTTTTTTTCATGTCACCTCCTTTTTTTGTTATGTCTT
TGGCCTTTGAGGTCCTCGATGTCCACACTCATAGACCTTCCGGATTATTTGTCCTTGAAATTGAAAGAGCACTGTTGTGTACATATTCGCACCCGCTTTTTTTTCAAAACAAACAAGCAG
GCGGACAGTGATCATGAGGACACGGGGGGCGGCCGCCGCGCCCCACCGGCTTACGGTGAACTGTCTTCTCACTTCGGCGTCCTGGAGGTGGCCGCGCGGGAGAGTGGAAACGGGGACGCT
GCGTTCCACCTATCGAAAGCGAAGATGGCGATGATCGCGGCGCATGCCGCTAAGGGCGTGCGCCAGACAGACATGAGAGAGTTTGTTGATGAGTGAGGGGGGGACAGCTATACCGCAGTT
TTTTTCTTTTTGTTTTGTTTTATTTTTGTCCGCTTCGTTGCTGGCGCGTTTATTGGTTTTGTTGGCGTGTCTCATCACGCAACATCGTAGGGAGGCAGCGAGGAACGTGATATTTTTTCA
AGTATACTAAGTTGCACGGACAGGAGCTGTACACGGGGTTTGGCTCCGAAGGTGAATTCTGCGCGTGCATGCGGGAATGGTTTCGCGGCAAACTCAGCTATCAGAGTGGAACCCACATTT
GTCTCAGAAAAGGCTGCCCCTGCCGCCCACAAAGTATATTCACCACACTCGATCCACATGCTACTCTGTTGGCCTCGCAAATGGTAAGCGATACACCATGAACTCAAACAGCAGTGCCTC
AGTAGTGCCAGACCGGCACTACTGAGGGATATCGATCACCCGAATAGTGCCGTTTGGCACTATTGAGGCACTATTCCCAGTTGTGCCGGTGCCCGCTATAGTGCCGGTGAACGCCCTGCG
CACGTACCGGCACTATAGAGGGCCCCCCACTGTATATGCATACGATGATACTGGTGCATGTATGCATGCATACGTTCATCAGCTCCGTACTGGAGCGGCAGGTGGTTTCCGGAAGATTGA
GATTATAAGATTTGTACCTTCACTCATCCGTGCGAACTCTTGTCGCTGCTACAGCAGCAACAGCAGCAGCAGGAGCAGCAACAGCAGCACCAGCACCAGCAACAGCACCAGCACCAGCAC
CACAGCGCCGCCCACCTCCTCTCCTTCCACCACGGGAAACTTTCCTCGATTTTTTTTCAGAAGGAAAACCATTTTTTTTTTTTTTTCTGGCGACGTGAACCTGGCCTGTGTCCTGTGTTC
GCGCTTTCCTCAAAAGCCCAACTGTGGCTTGTGTGACACGAAAAAGGCCAGGCGGAGCCGAACTCCAAAGGCACGCCATTGCAAACCACACAAGGTAAGTGCATCAGTTTGTGCGATCCG
AGGGGAGAGAGGGAAGGAAACAGCGAGTTAATTCATCAACCCTCGCACACACCGGGCCCTGAACATCGATCGAACCATGTGGTTCCCAAACCTGTTGCCAACACATCACCAGCTGGCTTT
GTCTCACGCGCGACTCATGTATAACAGCGGCACGTGGTTCCCACGGGGAATCAAGTCCCCCCCGCTGGCCTTGAGCGTCGTGTTTCTCGAGCGATCTTGCGACGGCAACAGCACGTGGTC
TCTTTGATCGTGGCTGATGGTTTGATGATTATTGGCGACACCCACGGACCGACGGAAGATGGTGACATTGCCCCGCGTTTTTTTGTTTCTGGTCACCAACCTCGAATGTTCGCCTGCCGT
TGGTGACTGCCCCTTCTTTTTGCCGAACCAGTTGCCTTTTGGCATGCCAGTTGCGCCCGCCTCTTGTGCTTTGAGTATGTCTCTCGTACTCTCGTACGCCCGGCGTTGAAATCAGGACGT
TTGCGTACACCGCTAGGCAAGGCGTGTGTCCGGAAGGCACTGCTGCTGTATCTGAAATGTTTCGGATGCAGGCAGTCTATCGTACATCTACATGTATCTAAATATCTTGGGTTGGTCTCG
ATGTCTCGACACATGGCAACAACATGTTTTTTTCTCCTCGCCTGCCCCTCTAAAAGCACTGCTGTGGCGGGGTATTTGCAAAAGATGTCGATTGCCGCTGGCTGGACTGGTTCTCTTGCA
ATGATGAACGCCGATACGACTGTGCATACATACATGTGCCGACCGTATGTGTGCATGTTCCAGTCAAGGCAATGTACTACAATTGTACAACGCTGTAACGGGTAATCGGGGATGTAGCAA
TATTCGGGAATGTTTACTGACCATCCCCCCGGAACCGCTTCTCTACCACAAGCAGCACAACATTTATTAATATTTGTACCTGTCATCCCCTCCAACAGTTCAAAAGAGGGAACTCGGATA
CATGACCCCAGAAAATTGTGGTATGAATTTTCCCGGTATCACCAGCACAGCAGTCGTTGAGCAATCAACTGCACCTGGCACCCGCCCGAATCAGGGGAGGATTGTTGTGACGAGATTGCA
GTATGGAGCTGCTGTGTTCAGCGCTGTTCCGTTCCAGTCCGATTCCTCCTTTTTGCCTCCTATTTCTCTTTCAGTCAGCCGCTCTCTATGGCTCACTCCGAGCCAACGCTGATCGAGAGG
GAACGCGTCAACACCACTTGTTGCCGCTAAATAGCAATGTATCAACCGTTGCTGTTCCGTCCTATCGCGGGATACTAGAAGTCTGGGCGCGTGGTCGGCGTCCACGTCTCTCTACCAAGA
CATGTACCCGCCCAGATGGCATCCTAGCCCAATGGCCCACTACCGAGACACCAACCTGCTGTTGTTTACGCGCTTCGTACGTACATACTTCATTTAACTGTTCCCAGGCTGAGCAGCCCC
AAATATCAACATCCAACTGCTCTTGGTCCTGGCTTGAACTCTTTTTATCACGAGGGGATGTCATGATGTCATGTCAGAATTTCTCGCGTGCATTATTTGATCATACCCATCCATAATAAA
AAGGTCGACGTATGCACTACGTTGGACATGTCACAAGTACCAGCCTACCCCAATCACGCCAACGCGGTCCGTGTTTACCCGATTTACGTAGATTTCTTTCAACGGGATCACAACGCTGTC
AGTGAGTAAGGGAAAAGCCGTTCTCTCCGACGTTCTGTGTCAGGCGGCCAAAATCTGTCGCGAATTATTAAATCGACACAAGCGCGAGGTGACTTCCTCACTGCTGCCACCTCTTTCTCT
TCTCGAACGTGTATGTTGCACGGGAGCACTATGAGGCGGCCGCTCGGCGAACATGTAGTCTACAACAGCATGCTGCCTGTTCTTACGAGATGGCACTTTATATCTCTTGATTGGTAAATA
TTAATATGCAGTTTTGAACGTCACAGGCCGTTGCACGCTTTTCTTGCTAGTACGAGTCTCTCTCATCACATGGTTTCCAATAGAAGGAGGCCATTGCCTGATGGACTACATAGCTATAGG
AAGACAGGCTGAAACAGAGTCTTGGAGTAGGGGGGCGGGGCTTGCCAACCGTTGAGGGTGACGTGGGCCATGGCGGACAAAGGGTGCGAAGACGTTCCATTGTCGCGAAGACGAAAAGAG
AACGGAGCTCTCACGCAGCTTAAGGCTGGGCATTTTCCGGGGGAGAAAACGGCCGCCCTCAAGAAGGGGGGCAATGGAAGCACATATGGGTGTTACCTTGTGTTTGTTACGCCTTGGGCG
TGTTAAACACAGCAGCTTGGCGATGGTTGGGACTATTCGTAAGAGGTGATGGGAGGCCACACAACGCGAAGCAGACAGGAACGATCAATAGGCAAGCACGTTGGCAGAACCGAAAGGAGC
GTCCATCGAGTACGGGGATGCCCTCGTACGAAAGTGGAGTGTGGGCCCTGCCAACCTGCTATATTGTCGTTCGTTCAGGAAAGAACCCCACGAGCGTTCTCGCCCGGGCTGCTCGTTGGG
CGAAAAAGTACGCTACAGCAATCCATCCCCGCTCTATACGGGTGCCGAGGTGCCCTGGACGGTAGGAAGACAGCGGCCATGCACGATGCTATCGAAGTACACGCACCTACTCCCGTGCTA
ACCCCCTCTTGCTCCCATCACCAGCAGGGGCTGAGGGATCGACTGGCCAACCGCTCAATCAAGAGCGCACCGCCATGGCGGCTCGCAGACACGAACCCGGCGCCTCCGGCGCCGCTGACG
GCGGACCACGGCGGCGGCGACGCCCCCCTCTCCGCGGCCGCCGCCGCCGCCGCCGCCGCCCGCTTCTCCGTTCCTTTTGCGGCTGCTGCGGCGCCGCCGCTGTCGCCGCTTCTGCGTTGC
TAGTGGGGCAGACGGTACTGGCGGACGACTTGGACCTGGAAGAGTTCACCCCCAGGAGCTTCGATGGGGTCGGCAACAACGAGGCGTTTCCGTCCTGGGGAGCGGTCGGGGCAACGCAGG
TGGGTTTGGTTGTATGCTGTGTTTTGTTTTTGTTGTTGTGGTTGTTTGAAAACATACCTCCGCACACGCACGCACACCAGGGACGTTGTTTTTTTCCTCCGGCGCTGACGTGTTTTCATT
TGTCAGCCGGTTATCACCGTCGATGCTAGTAGTAAGAAAGGCATACAAACGTACACACTTTTTCGCTCCAATTTGTAGTGACTCTTCGCGTGTGTGTGTCGTTGCGGCGGCAGCTCCGTT
CGGTGGCCGGGGCCTACTACGCCGACGCGGACTTCACTCCACCGGGGGACCTGACAAGACCGACTGCGAG
GCAAGTGCTCAGTTCCTCCGCGAGCAACAACACTCCTCTGAGTTTCCGTT
CTCCTTTTTTTTTTTTATTCAGAGAGCAGAGGGAGACTCTGTGTTAAAGAGTGGATTATGGTGAAAATTTGTGTGCCCTTCCTCCTGTGTGAGACTCCGGTTGGAACGCAAAGCACGCAC
ACCGAACGTTCTGCATCACAATAAACGGGACGAACACCCACAGCAGTATATAATTTTCCATTGGCGTGGCGTGTTGGATTTTTTTTGTTGTTGTTCACGTGATTTTTTGTTGTGTTGCAC
TTTGTTGTCCAGGGAGGTGATGACCGACGTGTTTCTGGAGTCGCCGCCGGCGCTGTCCACCATGAGCGCTCTCTTCATCGGTTGGGGGCAGCTGCTGGCTTTCGACCTGTCTCTCACCAG
CGACAACTCTTCCGAACCCTTGGACATCGAGTGCAACGACG
GTGAGAGCGGTAGGAAGGAGTCATGCTGTGAAGGGCAGGACCAGGGGGGGGGGTGCGTATCCCGCGGCAGGCTTTCGGC
CGTGGACCTCGCATCCCTACGAAGTCGAGATAGATGACGTCGAACGCTCGGGGGGAGTTGACGCTTGCGGCGCAGGGGGCGGGCGTCTTCCCCCGCGACAACAAAATACCACGTTCCTCT
GTTTGCACCCATACAGCGCTTGATCCTCTCGCCCGTTTTCTAACCCGTTCATGTTCTTTCGCTCAATCACTCGCGCACGTAATTTCTGAAGGGACCGGGGCCGGGGGGGTCGACGTGTGG
TGTCCCCTGGGGGCGGAGTCGGACCCCATCCCTTTCTACAGGTCGGACGCGGCGCTGTCGGACGACGACGGAGCCCTGGGCGAGGAGACGAGGAGCCCCGTCAACTACGCCACCGCGTTC
GTGGACCTCGACTTCGTGTACGGGCGGAGCGAGGACGAGGCCGCTGCCCTGCGGTCGTCCGCGGACGGCGACGGTTTCATGGCCCTCACGGAGAACGGCTTGCCCTACGTGAACGATGAC
GGGACTTGGCTG
GTCAGTCGAGTCGTTCGTTTCCCGCGGAATAGTTGCTGAGAGGTTACATGTTCCGTGTGTTGTGTGTGTGTCCCCCCCGCTCCCGCGCCCCCAGCTAGTAGCCTGTGT
TACCCTGTAGTCGATGTGTGTTTTCCGTCTGGCTGCTGCGTATTGAACCCAGTTTGTGTACTCGAGAGCGGGGAAGACAGCAGCAAGTATGTTGAATTTCTTTTTTCCGTTGTTTCGCAC
ATGCCGCAATGTTTGTTGTTTTTTCTACGTGGTTTGTGACATTGCCGTCGAAGGAAGCCTTTTCCCTCACGTGTCTGATTTTTTGTTGTTGTTCATGATTGGTTAGTGGTTTAGCGCAGC
TTACCTCTGGTGTCTGTCTGTGTGTCTGTTGATGCTGTTGTTTCGCTTACTACGTGCTCGAAAACCGACGAACGACGGCGACGCCCTCCGCCAGATCGCGGACCAGCGATCGGCCCAATT
CCCGGTCACGTTTGCCCTGCACGTCATGCTTCTCCTCGAGCACAATCGCTGCTGCATGGACATCGCGCCCAGCGAGGGCTTCGAGGGCGACGAG
GTCAGTTAACGCAATATCCTTCGAGT
GCCGGGGGGGAGGGGGGGGGGCGGGGGCGGGGGCGGGAGGGTTCACCCAAGCGTACCATCTTTTTAGTTTTTTCGGCTGTAGTTTGAGGGGTTGAATGTTTCGAATGAACCGTGAGTGTG
CCACCGTCGGTTGTACGGTGGTACGGGTTTTTTTCTGCCTCTTTCCGTGAAGGACGCATCCACCCGTGTGATGCGGAATATTTTGGAGACCACATCAATCGATGGAGAGGTGTCGCGCGA
ACTGCTGTGCCAGTGTACGTGCTACCTGAGACGACTCTGAGGTAGTGGTGGTCGGAAGTATCGGGTGTCCCGTTAATTATGTCGTCCATTTGCGGTTCCGGTGTCGTCTTCGTCCCCCCA
CTGGCGGGTATGAGCTGGCACCCGGAATTCCGGTTTGACGGGAAATCCCGCCTTTTTTTGCAAACGCGCAGGACATCTACCAGGCATGCCGGGGATGGACCATAGCCGTTTTCCAGCACG
TCACGGAGAACGACTTTCTGATCCGCCTCCTGGGGGGTAACATCCAGGACCTCG
GCGAGAGCATGTCGTCGTCGTCGTCGTTGTCGTCGTTGTCGTCGTCGTCTTCGTCAACAACAACGA
CAACGGAAGCAACAACAGCGCCAACGGAAGCTACAACAGCGCCAACGGAAGCAACAACAGCGCCAACGGAAGCAACAACAGCGCCAACGGAAGCAACAACAGCGCCAACGGAAGCAACAA
CACCACCTGCGGAAGCGACGACAGCGCCAGTGGAAGCGACAACAGCGCCGGTGGAAGCGACAACACCACCTGCGGAAGCGACAACACCACCTGGAGACAGCGGTGATGGTAGCGCCGGTG
GCAGGGGAGAAGAACGGAGAAGAATTAGGAGGAGGGGGCTACAGGAAATGAGAGGGGAACCACCAGGTGGAGTGCAGGACGAGCGGCGGGAGGGAGGGGTGCATACGTGTTTGAAAATCG
GGTTGCCGCTGTCGTTCTTGTTGCTCTCTCCTCTTCAAGTGAAAATCAATGTCGGAATGGGTATGGTTTCAGGTCGCGTTCCCCCACTTTGTTAGTTGCACCAACCGCGAGTGTTTGTTA
GACGGGGAAGACTGTCGGTACCACCGACGCCTCCACGAACGACGGGAGACGAGTGGGGGTTGTAGACGCAACTTAGACACGTTCAAACACCATTTCAGACCCACTTGCTTGCATGCCAAC
ACTCCGTTCCGCAGGGCGGCCAAAAACGAAACCAACCAAACAAATATCAAATGTCCTTTCGCTCACTAACAGTCAAGAGCTCAGTACATCTCCTTCTTAGACAGTAGTGGATTTTTTCTC
GAACAAAGGGCATTTGGTCTTTTCTGTGATGGCCTGCATGTGTTTTTTCTAAGAAATCGAAGAATGTCCTTCAACGACCTCAATCGCAACCGTTCAGATGAAGACGGACGCGAGCATCCG
GTGCCCGGGCGGCAGAGCAGGAGGGGCCTGTGGCTGACCACGGACTACGACGAGAACACTAACCCGGGCGCCGATACCTTCACCTTGACGGCGGGGGTGGCGGCCTTCGAGTCGGCCCTG
CCGTCCACCGTGCGGGTGGTCGGGGAGGGCTACGAGTCGACGCGGTACGACAACATCGAGCTCGCGGCGGCCGTCGGGGCCGACGGCCTCGTGTCCTTCTTCAACAACGTGAAG
GTGTGT
GTGTGTGCGGTGTTTGTGTGTGCGCGTCTTTTTCTTTGTTGGGAGTACGAATTGCGTATTTTTTCCCTTATTCAACAGTGTAAATGTGTCCGGTGTGTGCGTGTGTATATAAATAACCAT
ATATTTTTCGTATGCATACATACATACGTAACATTTCGCCTGGTTGGTGCTTCGCGACATATTCCGCTTGCTGAGGAGAATCTTTTCTCACGCTTCCTTCTCAGGGGCAAGCAGGGAGAT
CGTACATTACCGCGCACGCCGGAGGACCGCCAGCCACCCGTGGCACTTGTGCTAGTCGCCCAAAATTGAAAAAATTGGCTCCATTCCCCGGGGACGTGTTCCGCGCGAAGAAAGCCACCG
CAAGAAATACACGAAACGTGTGCTTGATTTAACAGGACATTTTGGTTCCTCGCAACTCACAGAAATCCCAGACCATGGGCAACACGGATACGTAAGAGCGAGCAATCAAACGCAGCGGAT
TGCAGCAGTAGGGCGTGCAACAAAGACGCCACTAGCATTGAAAAAAATGCACACATTTACGGACACCCGAAAAGTCACGGCGAGGAACAAAAATACCCCTCACATGTTGATTGCAATTTC
CAGGAAAATTCTGCAGGCTGTTCGCCAAACCTGCACTCACCACGAACGCCATGACGTTGAGATTCAACGATGCAACCGCGATGCCATAGGCCATGTCCTCATGCGTCGCCCCCGGGAGGC
AAGCCACCTAACTCCCGAAGGGGAGCAATTTGTTTTTTCATTTATCATAACGATTCCATTTCCATCTACAGCAGTGTCCGGGATAAATGACGTTAAAGTAGAATGTGCAGGGGAATGCGG
GTTCGCTCTTTCATTGACGTCGACCGCGCTACCCCACTGACCAATGAACATCCGTCAGTCTCTCGTCAGTGCGGCTACATATGTAGAAACAAAAGGGAAATCGCTTCTAAAGGCGACCAT
GATCTGGAGACCGCGTGAGCGAGCGGGGGGGAAGGGCATCACCGAACGCCGCCGAAGTACCTGGCACCTCAGTTTTTCCCAACATCTTCTCTCTATCTCTCTATCTGTCTCACTCTCTCT
CTCTCTCTCTCCCTCGCTCTCTTCCCTCTCTCTCTCTCTCTCCCGCTCTCTGTTCTCCAGGTTGTGGACGTGTTGCGAGGGGCGGTGTTGTCCCCGGTGTATGCGGCCGACACTCACTAC
ACCGCGGCGGTCTCGAACGGGTCTCCGCTGTTCAAGCTCCCGGTGGACTCGGTGCAGCGGGGGAGGGACCACGGGCTGCCGACCTACAACGATGCTCGGGCG
GTGAGACAAGAGAATGAT
TTTTGTTGTTGTTGTTGTTGTTATCCTTGTTGTTGTTGTTGAAGTTGATCCGCTACCCTGTGTGACATGGAAAAAAAAAACAGCAACGTTTTTCGTTTACTTTTAGCACCTTGAGAGCGA
TAGTGGACGGGGATTGAGAGAGTATTGGGCTGCGGTTGTTGTGCTAGTCCGCCCCCACTATCTTCCTCTCCGACCAAAATCCCACCGCGGGGATGAAAAACAAAATTCAACACACTAAAA
ACACACACACACACACACACAGGCGTTCGGTCTCTCGGAGGCGACCACTTTCACAGACGTCACTACGTCGTCGTCGTCGACGTCATCATCGACGACGACGACGAGCACGACGTCATCTTC
CGGCTCCGACGCCGACGAGGAGGTGGCGGACATCCTCTCGACCGCGTACGGGGGCAACGTGTCGACCCTCGACGCCGTGACGGGGGCCCTGGCCGAGCCGACGATGGCGAGCTCCGGGGG
CGTCTTCGGGGAGCTCCTGCACGCCGCCTGGCTTGAGCAGATGTACAGGTGTGTGCACGTGTGTGTATCTTTCGTTTGTGTTTTGTGTATCTTTTGTCGGCCGCGCTATCCCCGGCTGTG
TGTTTGTGTTTGTATCTTGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGACGAGCTGCACCCGAAGCGAGAACACCACAAAAGCAGCAACATTTTGGAAGAGCTGCTCCTGGAGGGCAAGCACCAGGAGGCGGCGACGTTGATTCGGAGGGTCCGAGATTTTCC
GCGAACCTTCAGAACGCCACCAACTTGGGGCGAGGGGTGGAGATAATCTTCCAGAACATTGGTCGATGGCGTATTTCGTTGGCGGACCTTGTTGGCCGAGATAGCCGCGGCGAATACCCT
GACG
GCCAGGCGGAGCCGAACTCCAAAGGCACGCCATTGCAAACCACACAAGTGGGGCAGACGGTACTGGCGGACGACTTGGACCTGGAAGAGTTCACCCCCAGGAGCTTCGATGGGGTC
GGCAACAACGAGGCGTTTCCGTCCTGGGGAGCGGTCGGGGCAACGCAG
CTCCGTTCGGTGGCCGGGGCCTACTACGCCGACGCGGACTTCACTCCACCGGGGGACCTGACAAGACCGACT
GCGAG
GGAGGTGATGACCGACGTGTTTCTGGAGTCGCCGCCGGCGCTGTCCACCATGAGCGCTCTCTTCATCGGTTGGGGGCAGCTGCTGGCTTTCGACCTGTCTCTCACCAGCGACAAC
TCTTCCGAACCCTTGGACATCGAGTGCAACGACG
GGACCGGGGCCGGGGGGGTCGACGTGTGGTGTCCCCTGGGGGCGGAGTCGGACCCCATCCCTTTCTACAGGTCGGACGCGGCGCTG
TCGGACGACGACGGAGCCCTGGGCGAGGAGACGAGGAGCCCCGTCAACTACGCCACCGCGTTCGTGGACCTCGACTTCGTGTACGGGCGGAGCGAGGACGAGGCCGCTGCCCTGCGGTCG
TCCGCGGACGGCGACGGTTTCATGGCCCTCACGGAGAACGGCTTGCCCTACGTGAACGATGACGGGACTTGGCTG
ATCGCGGACCAGCGATCGGCCCAATTCCCGGTCACGTTTGCCCTG
CACGTCATGCTTCTCCTCGAGCACAATCGCTGCTGCATGGACATCGCGCCCAGCGAGGGCTTCGAGGGCGACGAG
GACATCTACCAGGCATGCCGGGGATGGACCATAGCCGTTTTCCAG
CACGTCACGGAGAACGACTTTCTGATCCGCCTCCTGGGGGGTAACATCCAGGACCTCG
ATGAAGACGGACGCGAGCATCCGGTGCCCGGGCGGCAGAGCAGGAGGGGCCTGTGGCTGACC
ACGGACTACGACGAGAACACTAACCCGGGCGCCGATACCTTCACCTTGACGGCGGGGGTGGCGGCCTTCGAGTCGGCCCTGCCGTCCACCGTGCGGGTGGTCGGGGAGGGCTACGAGTCG
ACGCGGTACGACAACATCGAGCTCGCGGCGGCCGTCGGGGCCGACGGCCTCGTGTCCTTCTTCAACAACGTGAAG
GTTGTGGACGTGTTGCGAGGGGCGGTGTTGTCCCCGGTGTATGCG
GCCGACACTCACTACACCGCGGCGGTCTCGAACGGGTCTCCGCTGTTCAAGCTCCCGGTGGACTCGGTGCAGCGGGGGAGGGACCACGGGCTGCCGACCTACAACGATGCTCGGGCG
GCG
TTCGGTCTCTCGGAGGCGACCACTTTCACAGACGTCACTACGTCGTCGTCGTCGACGTCATCATCGACGACGACGACGAGCACGACGTCATCTTCCGGCTCCGACGCCGACGAGGAGGTG
GCGGACATCCTCTCGACCGCGTACGGGGGCAACGTGTCGACCCTCGACGCCGTGACGGGGGCCCTGGCCGAGCCGACGATGGCGAGCTCCGGGGGCGTCTTCGGGGAGCTCCTGCACGCC
GCCTGGCTTGAGCAGATGTACAGGTGTGTGCACGTGTGTGTATCTTTCGTTTGTGTTTTGTGTATCTTTTGTCGGCCGCGCTATCCCCGGCTGTGTGTTTGTGTTTGTATCTTGAAGTAG

Retrieve as FASTA